Preparation method of foot and mouth disease virus nucleic acid standard substance

Abstract

The invention provides a preparation method of a foot and mouth disease virus nucleic acid standard substance, and belongs to animal epidemic disease detection. The preparation method of the foot-and-mouth disease virus nucleic acid standard substance comprises the following steps: inoculating a host cell with a foot-and-mouth disease virus, and culturing until the foot-and-mouth disease virus is diseased to obtain a cell virus seed; and inoculating the cell virus seed into a new host cell for culturing, inactivating the virus when the cell is diseased, and collecting diseased cells to obtain the foot-and-mouth disease virus nucleic acid standard substance. The foot-and-mouth disease virus nucleic acid standard substance prepared by the invention contains a virus whole-genome sequence, is wide in application range, has good safety, is convenient for subsequent experimental operation, is accurate in copy number constant value, and is suitable for large-scale popularization and application. The method can be used for quality control of RT-PCR or fluorescent quantitative PCR diagnostic reagents, comparison of scientific research and laboratory diagnosis and capability comparison between laboratories.

Description

Technical Field

[0001] The invention belongs to animal disease detection, and in particular relates to a method for preparing a foot-and-mouth disease virus nucleic acid standard substance. Background Art

[0002] Foot-and-mouth disease is an acute, febrile, highly contagious disease caused by foot-and-mouth disease virus (FMDV) that occurs in even-toed ungulates such as cattle, sheep, and pigs. The World Organization for Animal Health has classified foot-and-mouth disease as a Class A severe infectious disease in animals, which seriously threatens the healthy development of animal husbandry.

[0003] With the development of molecular biology detection technology, RT-PCR, fluorescent quantitative PCR and other detection technologies have gradually been widely used in the detection of foot-and-mouth disease virus. This type of technology detects foot-and-mouth disease virus by detecting virus-specific nucleic acid fragments, and has the advantages of high sensitivity and rapid detection; but it is also easily affected by the quality of the test kit, nucleic acid extraction, transcription efficiency, nucleic acid contamination, RNA enzyme contamination, etc. The experimental results often have large errors due to the quality of the reagents, the experience and ability of the personnel, and the influence of the experimental facilities and environment, which seriously restricts the accuracy of the test results. Therefore, it is urgent to use nucleic acid standard substances as a ruler for the quality control of the test kit products.

[0004] However, the quality requirements for foot-and-mouth disease virus nucleic acid standard materials are very high, including uniformity assessment and stability assessment. Uniformity is a basic property of nucleic acid standard materials, including intra-unit and inter-unit uniformity. Inter-unit uniformity is an important condition to ensure that each characteristic of each unit of nucleic acid standard materials has the same characteristic value. Intra-unit uniformity determines that users of nucleic acid standard materials can obtain representative sub-samples for measurement from the standard material unit. Stability usually involves stability under long-term storage conditions, transportation conditions, and storage conditions in the user's laboratory (if applicable). If reuse is allowed, it may also include stability after opening the package. At present, the foot-and-mouth disease nucleic acid standard materials on the market are all plasmids, and the plasmid fragments are relatively short and cannot cover the entire sequence of foot-and-mouth disease virus nucleic acid. The preparation method of foot-and-mouth disease virus nucleic acid standard materials has not been reported so far. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a method for preparing a foot-and-mouth disease virus nucleic acid standard material. The prepared foot-and-mouth disease virus nucleic acid standard material covers all sequences of foot-and-mouth disease virus nucleic acid and has universal applicability.

[0006] The present invention provides a method for preparing a foot-and-mouth disease virus nucleic acid standard substance, comprising the following steps:

[0007] The foot-and-mouth disease virus is inoculated into host cells and cultured until pathological changes occur to obtain cell virus strains;

[0008] The cell virus seed is inoculated into new host cells for cultivation, the virus is inactivated when the cells become cytopathic, and the cytopathic cells are collected to obtain a foot-and-mouth disease virus nucleic acid standard substance.

[0009] Preferably, the host cell, before the inoculation, further comprises a monolayer culture;

[0010] The cell seeding density of the monolayer culture was 2×10 5 / mL~3×10 5 Pieces / mL;

[0011] The temperature of the monolayer culture is 36-38°C, and the time of the monolayer culture is 45-50h;

[0012] The host cells include BHK-21 cells.

[0013] Preferably, the inoculation form of the foot-and-mouth disease virus includes at least one of the following: a suspension of foot-and-mouth disease virus-infected tissue, a supernatant of blister fluid, and an upper layer of OP fluid.

[0014] Preferably, the inoculation volume of the foot-and-mouth disease virus is 100 μL / 6-well plate.

[0015] Preferably, the culture solution is a cell maintenance solution;

[0016] The cell maintenance medium is a MEM culture medium containing 20% ​​fetal bovine serum in volume percentage and 1% GlutaMax in mass percentage;

[0017] The culture temperature is 36-38° C. and the culture time is 1-2 days.

[0018] Preferably, the morphology of the diseased cells includes cell rounding, aggregation, and then lysis and shedding.

[0019] Preferably, the inoculation amount of the cell virus seed is 5% to 10% of the volume of the cell maintenance solution;

[0020] The density of the cell poison seed is 1×10 5 / mL~3×10 5 Pieces / mL.

[0021] Preferably, the virus inactivating agent comprises diethyleneimine and sodium thiosulfate;

[0022] The working concentration of diethyleneimine is 1.5 to 2.5 mmol / L;

[0023] The working mass percentage of the sodium thiosulfate is 1.5% to 2.5%.

[0024] Preferably, the temperature for inactivating the virus includes 28 to 32° C.; the temperature for inactivating the virus is 22 to 26 hours.

[0025] Preferably, the foot-and-mouth disease virus comprises at least one of the following strains: O / GD / NX / 92, foot-and-mouth disease virus type O HN / ZK / 93 and type A foot-and-mouth disease virus epidemic strain A / GDMM / 2013.

[0026] The invention provides a method for preparing a foot-and-mouth disease virus nucleic acid standard substance, comprising the following steps: inoculating the foot-and-mouth disease virus into a host cell, culturing until the cell becomes diseased, and obtaining a cell virus seed; inoculating the cell virus seed into a new host cell for culturing, inactivating the virus when the cell becomes diseased, collecting the diseased cells, and obtaining a foot-and-mouth disease virus nucleic acid standard substance. The invention aims at the limitation that only specific types of nucleic acid standards are provided in the prior art. The invention prepares an inactivated cytotoxin of foot-and-mouth disease virus as a nucleic acid standard material, which not only covers the entire viral genome sequence, but is also compatible with the target fragment detected by general PCR or fluorescent PCR, has good specificity and a wide range of application; the foot-and-mouth disease virus nucleic acid standard material prepared by the method of the invention is non-infectious, has no biosafety risk, can be widely used, has a wide range of application and high safety; the foot-and-mouth disease virus nucleic acid standard material prepared by the method of the invention is an RNA fragment rather than a DNA fragment or a plasmid, is consistent with the original nucleic acid type of the foot-and-mouth disease virus, and can fully control the experimental conditions and experimental process of the subject; the foot-and-mouth disease virus nucleic acid standard material prepared by the method of the invention has an accurate copy number value obtained by measurement and calculation; the foot-and-mouth disease virus nucleic acid standard material prepared by the method of the invention can be diluted into a series of samples containing different copy numbers per unit volume according to the known copy number, and is used for quality control of RT-PCR or fluorescent quantitative PCR diagnostic reagents, comparison of scientific research and laboratory diagnosis, and capability comparison between laboratories. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the result of FMDV fluorescence quantitative detection, where 1-virus culture fluid detection result; 2-uninoculated virus culture fluid detection result;

[0028] Figure 2 It is a 1D single channel scatter plot;

[0029] Figure 3 The sample test results;

[0030] Figure 4 This is an example of a 3D preview of digital PCR test results. DETAILED DESCRIPTION

[0031] The present invention provides a method for preparing a foot-and-mouth disease virus nucleic acid standard substance, comprising the following steps:

[0032] The foot-and-mouth disease virus is inoculated into host cells and cultured until pathological changes occur to obtain cell virus strains;

[0033] The cell virus seed is inoculated into new host cells for cultivation, the virus is inactivated when the cells become cytopathic, and the cytopathic cells are collected to obtain a foot-and-mouth disease virus nucleic acid standard substance.

[0034] The invention inoculates foot-and-mouth disease virus into host cells, and culture them until pathological changes occur to obtain cell virus seeds.

[0035] The present invention has no special restrictions on the type of the foot-and-mouth disease virus strain, and strains well known in the art can be used. The foot-and-mouth disease virus preferably includes at least one of the following strains: O / GD / NX / 92, foot-and-mouth disease virus O type HN / ZK / 93 and foot-and-mouth disease virus A type A / GDMM / 2013. O / GD / NX / 92 is reported in the prior art (Research on the application of immunochromatography technology in foot-and-mouth disease POCT). The foot-and-mouth disease virus O type HN / ZK / 93 is reported in the prior art (Cao Weijun, Li Pinghua, Bai Xingwen, et al. Rescue of foot-and-mouth disease virus O / HN / 93 vaccine strain and identification of virus activity [J]. Acta Agriculturae Boreali-Sinica, 2010, 25(03): 32-37.). Foot-and-mouth disease virus A type A / GDMM / 2013 is disclosed in the patent publication number CN112076314A.

[0036] In the present invention, the host cells are preferably cultured in a monolayer before the inoculation. The cell inoculation density of the monolayer culture is preferably 2×10 5 / mL~3×10 5 / mL, more preferably 2.5×10 5 / mL. The temperature of the monolayer culture is preferably 36-38°C, more preferably 37°C. The time of the monolayer culture is preferably 45-50h, more preferably 48h. The host cells preferably include BHK-21 cells. The culture solution is preferably a cell maintenance solution; the cell maintenance solution is preferably a MEM culture medium containing 20% ​​fetal bovine serum in a volume percentage concentration and 1% GlutaMax in a mass percentage concentration. The inoculation amount of the foot-and-mouth disease virus is preferably 100μL / 6-well plate.

[0037] In the present invention, the inoculation form of the foot-and-mouth disease virus preferably includes at least one of the following: a suspension of tissue infected with foot-and-mouth disease virus, a supernatant of blister fluid, and an upper layer of OP fluid. The preparation method of the suspension of tissue infected with foot-and-mouth disease virus is preferably grinding the body tissue of the diseased foot-and-mouth disease animal, adding a PBS solution containing antibiotics for poisoning treatment, centrifuging, and collecting the supernatant. The volume ratio of the obtained grinding liquid to the PBS solution containing antibiotics is preferably 1:5. The antibiotics include penicillin and streptomycin. The working concentration of penicillin is preferably 1000IU / mL. The working concentration of streptomycin is preferably 500IU / mL. The molar concentration of the PBS solution is 0.05M. The temperature of the poisoning treatment is preferably 5°C. The time of the poisoning treatment is preferably 10 to 14h. The speed of the centrifugation is preferably 3000rpm. The time of the centrifugation is preferably 10min. The supernatant of the blister fluid is preferably centrifuged to collect the supernatant. The speed of the centrifugation is preferably 3000rpm. The time of the centrifugation is preferably 10min. The method for preparing the OP fluid supernatant preferably comprises centrifuging the OP fluid from animals or tissues infected with foot-and-mouth disease and collecting the supernatant.

[0038] In the present invention, the culture temperature is preferably 36-38° C., more preferably 37° C. The culture time is preferably 1-2 days, more preferably 1.5 days. The morphology of the diseased cells preferably includes cell rounding, aggregation, and then dissolution and shedding.

[0039] After obtaining the cell virus seed, the present invention inoculates the cell virus seed into new host cells for cultivation, inactivates the virus when the cells become cytopathic, collects the cytopathic cells, and obtains the foot-and-mouth disease virus nucleic acid standard substance.

[0040] In the present invention, the inoculation amount of the cell poison seed is preferably 5% to 10% of the volume of the cell maintenance solution, and more preferably 8% of the volume of the cell maintenance solution. The density of the cell poison seed is preferably 1×10 5 / mL~3×10 5 / mL, more preferably 2×10 5 / mL. The method of culturing is the same as the above steps and will not be repeated here. The virus is inactivated when 90% of the cells are cultured to develop pathological changes. The reagent for inactivating the virus preferably includes diethyleneimine and sodium thiosulfate. The working concentration of diethyleneimine is preferably 1.5-2.5mmol / L, more preferably 2.0mmol / L. The working mass percentage of sodium thiosulfate is preferably 1.5%-2.5%, more preferably 2.0%. The inactivated virus preferably includes 28-32°C, more preferably 30°C. The temperature of the inactivated virus is preferably 22-26h, more preferably 24h. Before the inactivation of the virus, the pH of the culture system is preferably adjusted to 7.6-7.8, and antibiotics are added. The antibiotics include penicillin and streptomycin. The working concentration of penicillin is preferably 100IU / mL. The streptomycin is preferably 100IU / mL. The purpose of adding the antibiotics is to prevent bacteria from growing and multiplying in the culture solution, which is beneficial to the culture of cells.

[0041] In the present invention, after obtaining the foot-and-mouth disease virus nucleic acid standard material, it is preferred to further include detecting the uniformity, stability and fixed value of the foot-and-mouth disease virus nucleic acid standard material. The detection method preferably adopts RT-qPCR detection. In an embodiment of the present invention, the primers for RT-qPCR detection include 3D gene amplification primers; the 3D gene amplification primers preferably include a forward primer with a nucleotide sequence as described in SEQ ID NO:1 and a reverse primer with a nucleotide sequence as described in SEQ ID NO:2 and a TaqMan probe with a nucleotide sequence as shown in SEQ ID NO:3. The RT-qPCR detection also preferably includes 2× one-step RT-PCR buffer, TaKaRa Ex Tag HS and PrimeScript RT Enzyme Mix. The RT-qPCR reaction procedure of the 3D gene is preferably reverse transcription at 50°C for 10min; pre-denaturation at 95°C for 3min; denaturation at 95°C for 10sec, annealing at 60°C for 30sec, for a total of 40 cycles. The method for judging the amplification result of the RT-qPCR: if the sample curve is a standard S-shaped curve, and the Ct value is <35, it is positive; the Ct value is ≥35, it is negative. The standard substance determination test is carried out using a digital PCR instrument.

[0042] The foot-and-mouth disease virus nucleic acid standard material prepared by the method of the present invention has an accurate copy number value obtained by measurement and calculation. In addition, the foot-and-mouth disease virus nucleic acid standard material prepared by the present invention can be diluted into a series of samples containing different copy numbers per unit volume according to the known copy number, and can be used for quality control of RT-PCR or fluorescent quantitative PCR diagnostic reagents, comparison of scientific research and laboratory diagnosis, and capability comparison between laboratories.

[0043] The following is a detailed description of the preparation method of a foot-and-mouth disease virus nucleic acid standard material provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Example 1

[0045] A method for preparing foot-and-mouth disease virus nucleic acid standard substance

[0046] 1. Select foot-and-mouth disease virus type O HN / ZK / 93 strain.

[0047] 2. Preparation of monolayer cells: Subculture cells (BHK-21) were placed in 25 cm 2 In the cell culture flask, the cell density of each flask should be 2.5×10 5 / mL, cultured at 37℃ for 48h.

[0048] 3. Inoculation of cells:

[0049] 3.1 Preparation of tissue supernatant after overnight poisoning: Grind the collected tissues of the diseased FMD animals in a tissue homogenizer, add 1000 IU / mL penicillin, 500 IU / mL streptomycin, and 0.04 mol / L PBS (pH 7.4) to make a 1:5 tissue suspension, and soak overnight at 4°C. Centrifuge at 3000 r / min for 10 min the next day, and take the supernatant for later use.

[0050] 3.2 Treatment of blister fluid samples: Centrifuge the blister fluid at 3000 r / min for 10 min and take the supernatant for later use.

[0051] 3.3 Inoculation: Inoculate BHK-21 cells with the tissue suspension after overnight poisoning. Inoculate 2 to 4 bottles of cells for each sample, and set up 2 to 4 bottles of cell control. Before inoculation, pour out the nutrient solution in the cell culture bottle, add 1mL of the treated diseased material solution, and let it stand at room temperature for 30 minutes. Then add 4mL of cell maintenance solution. The cell control bottle is not inoculated with samples, and after pouring out the nutrient solution, 5mL of cell maintenance solution is added and cultured at 37℃;

[0052] 4. Observe and record. If there is foot-and-mouth disease virus in the sample, CPE may appear 1-2 days after inoculation, mainly showing cell shrinkage, aggregation, and finally dissolution and shedding. The control cell monolayer should be intact, with basically normal or slightly senescent cell morphology. Harvest the cell fluid and store it at -70℃ for virus identification;

[0053] 5. Inoculate the foot-and-mouth disease cell virus strain into a well-growing BHK-21 monolayer cell roller bottle at 5% to 10% of the maintenance solution, and culture at 37°C for 8 to 12 hours. When the cytopathic effect reaches more than 90%, adjust the pH to 7.6 to 7.8 with 7.5% NaHCO3 solution, add penicillin (100 IU / mL) and streptomycin (100 IU / mL), inactivate the virus solution with 2 mmol / L diethyleneimine at 30°C for 24 hours, add 2% sodium thiosulfate to block, centrifuge at 4000 r / min, 2 to 8°C for 30 minutes, take the supernatant, and freeze at -20°C.

[0054] Example 2

[0055] Extraction of Total RNA from Foot-and-Mouth Disease Virus

[0056] Use FineQuick Rapid Viral DNA / RNA Column Extraction Kit (purchased from Jifan Biotechnology Co., Ltd.) to extract total RNA from viral fluid (tissue). Add 200μL Buffer VLQ to a new 1.5ml centrifuge tube. Add 200μL foot-and-mouth disease cytotoxin, cover the tube, vortex and mix evenly, and incubate at room temperature for 5-10min. Add 100μL Buffer PP, vortex and mix evenly, and centrifuge at 10,000rpm for 1min. 7. Transfer 400μL of the supernatant after centrifugation to a new 1.5ml centrifuge tube (need to be prepared by yourself), and add 270μL Buffer IP, mix upside down 6-8 times. Add the liquid mixed in step 7 to the adsorption column FineBind DNA Spin Columns (the adsorption column is placed in the collection tube). Centrifuge at 10,000rpm for 1min, pour out the waste liquid, and put the adsorption column back into the collection tube. Add 500μL Buffer VW to the adsorption column, centrifuge at 10,000rpm for 30sec, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Repeat step 7 once. Put the adsorption column back into the waste liquid collection tube, centrifuge at 10,000rpm for 1min, and discard the waste liquid. Put the adsorption column into a 1.5ml RNase Free MicrocentrifugeTubes, carefully open the cover of the adsorption column, add 40-60μL Buffer EB to the middle part of the adsorption membrane, cover the cover, and leave at room temperature for 1min. Centrifuge at 10,000rpm for 1min to collect nucleic acids and store at -20℃.

[0057] Example 3

[0058] Fluorescence quantitative RT-PCR technology to detect RNA

[0059] Using the RNA extracted in Example 2 as a template, a fluorescent quantitative RT-PCR reaction system was prepared, and the total reaction system was 25 μL, specifically: 2× one-step RT-PCR buffer 12.5 μL, TaKaRa Ex Tag HS (5U / μL) 0.5 μL, PrimeScript RT Enzyme Mix 0.5 μL, PCR forward primer (10 μmol / L) 0.5 μL, PCR reverse primer (10 μmol / L) 0.5 μL, TaqMan probe (5 μmol / L) 1 μL, total RNA 2 μL, nuclease-free water 7.5 μL;

[0060] Among them, forward primer: ACTGGGTTTTACAAACCTGTGA (SEQ ID NO: 1);

[0061] Reverse primer: GCGAGTCCTGCCACGGA (SEQ ID NO: 2);

[0062] TaqMan probe: FAM-TCCTTTGCACGCCGTGGGAC-BHQ1 (SEQ ID NO: 3).

[0063] Place the plate or PCR tube on a fluorescent quantitative PCR instrument for RT-PCR amplification, and amplify according to the following reaction program: reverse transcription at 50°C for 10 minutes; pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, for a total of 40 cycles;

[0064] Result determination: If the sample curve presents a standard S-shaped curve and the Ct value is less than 35, it is positive; if the Ct value is greater than or equal to 35, it is negative.

[0065] CT value determination results: The CT value of the sample was determined using the fluorescent quantitative PCR detection method, and the CT value of each tube of sample was found to be: 24.00±1.00.

[0066] Example 4

[0067] Inspection and determination of standard materials for nucleic acid of foot-and-mouth disease virus

[0068] (1) Homogeneity test: 10 samples were randomly selected from the sample and the RNA copy number per unit volume of each sample was tested. After statistical analysis, there was no significant difference between the samples, indicating that the batch of samples had good homogeneity.

[0069] (2) Stability test: Randomly select samples for testing every week. Take 3 tubes of foot-and-mouth disease virus nucleic acid standard material and test each sample 3 times. Use digital PCR method for testing and calculate the average value. The digital PCR detection system: 5xProbe one-step Buffer 4μL, RT-Polymerase Mix 2μL, reference dye 1μL, 10μM forward primer 0.8, 10μM reverse primer 0.8, 10μM probe 0.4μL, RNA template 10μL, ddH2O to 20μL. Digital PCR detection program: 53℃ reverse transcription 25min; 95℃ pre-denaturation 5min; 95℃ denaturation 30sec, 58℃ annealing 45sec, a total of 45 cycles; 20℃ end reaction. Stability evaluation of foot-and-mouth disease virus nucleic acid standard material.

[0070] (3) Fixed value: Statistics and analysis are performed on the measurement results of all samples, and outliers are eliminated.

[0071] Results of testing and determination of standard materials for foot-and-mouth disease virus nucleic acid

[0072] 1. Homogeneity test: 10 samples were randomly selected from the samples, and the RNA copy number per unit volume of each sample was tested. The results are shown in Table 1. After statistical analysis, there was no significant difference between the samples, indicating that the batch of samples had good homogeneity.

[0073] Table 1 RNA sample copy number (×10 3 copies / μL)

[0074]

[0075] 2. Stability results: There was no significant difference between the test results after 11 weeks and the test results in the first month, indicating that the sample had good stability. It is speculated that its stable shelf life is more than 5 years.

[0076] 3. The final RNA copy number per unit volume of the nucleic acid standard material prepared in the embodiment of the present invention is 2.55±0.05×10 3 copies / μL.

[0077] Figure 2 to Figure 4 This is an example of digital PCR test results. The sample detection concentration is 1530.17 copies / μL, and the sample original concentration is 2601.29 copies / μL.

[0078] Note: Sample original concentration = sample detection concentration × 4 × 0.425.

[0079] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for preparing a foot-and-mouth disease virus nucleic acid standard substance, characterized in that: The following steps are involved: The foot-and-mouth disease virus is inoculated into host cells and cultured until pathological changes occur to obtain cell virus strains; The cell virus seed is inoculated into new host cells for cultivation, the virus is inactivated when the cells become cytopathic, and the cytopathic cells are collected to obtain a foot-and-mouth disease virus nucleic acid standard substance.

2. The preparation method according to claim 1, characterized in that: The host cells, prior to the inoculation, also include monolayer culture; The cell seeding density of the monolayer culture was 2×10 5 / mL~3×10 5 Pieces / mL; The temperature of the monolayer culture is 36-38°C, and the time of the monolayer culture is 45-50h; The host cells include BHK-21 cells.

3. The preparation method according to claim 1, characterized in that: The inoculation form of the foot-and-mouth disease virus includes at least one of the following: a suspension of a tissue infected with the foot-and-mouth disease virus, a supernatant of blister fluid, and an upper layer of OP fluid.

4. The preparation method according to claim 1, characterized in that: The inoculation volume of the foot-and-mouth disease virus is 100 μL / 6-well plate.

5. The preparation method according to claim 1, characterized in that: The culture solution is a cell maintenance solution; The cell maintenance medium is a MEM culture medium containing 20% ​​fetal bovine serum in volume percentage and 1% GlutaMax in mass percentage; The culture temperature is 36-38° C. and the culture time is 1-2 days.

6. The preparation method according to claim 1, characterized in that: The morphology of the diseased cells includes cell rounding, aggregation, and then dissolution and shedding.

7. The preparation method according to claim 1, characterized in that: The inoculation amount of the cell virus seed is 5% to 10% of the volume of the cell maintenance solution; The density of the cell poison seed is 1×10 5 / mL~3×10 5 Pieces / mL.

8. The preparation method according to claim 1, characterized in that: The virus inactivation reagent includes diethyleneimine and sodium thiosulfate; The working concentration of diethyleneimine is 1.5 to 2.5 mmol / L; The working mass percentage of the sodium thiosulfate is 1.5% to 2.5%.

9. The preparation method according to claim 8, characterized in that: The temperature for inactivating the virus includes 28 to 32° C.; the temperature for inactivating the virus is 22 to 26 hours.

10. The preparation method according to any one of claims 1 to 9, characterized in that: The foot-and-mouth disease virus includes at least one of the following strains: O / GD / NX / 92, foot-and-mouth disease virus type O HN / ZK / 93 and type A foot-and-mouth disease virus epidemic strain A / GDMM / 2013.

Images