Compositions, kits and methods for detecting HPV genotypes

Abstract

The present invention provides a composition, a kit and a method for detecting HPV genotypes. The present invention optimizes respectively from aspects of urine extraction and PCR sensitivity, develops a method for extracting high-quality DNA from 40 mL of whole urine, and optimizes and screens a set of probe primer combinations with high sensitivity. By using this extraction method and combining with the screened probe primer combinations, it is possible to accurately and effectively detect a total of 15 HPV types including HPV type 53 and genotype HPV16 / 18 with only one-tube multiplex PCR reaction in urine with low HPV content, and the lower limit of detection LOD in urine samples reaches 10-50 copies / mL, having good sensitivity and specificity.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biological detection, and specifically relates to a composition, a kit and a method for detecting HPV genotype. Background Art

[0002] Human papillomavirus (HPV) is a common epithelial cell virus. Its genome is a double-stranded circular DNA with a length of 8000bp. It mainly encodes 8 open reading frames. The genome can be divided into three regions, namely the early region (E region), the late region (L region) and the non-coding region (NCR). The E region can be further divided into 7 open reading frames (E1-E7), which mainly encode proteins involved in viral replication, transcription, regulation and cell transformation. The L region can be divided into L1 and L2 regions, and L1 region encodes major capsid protein and minor capsid protein respectively. A total of more than 200 HPV subtypes have been discovered. Among them, high-risk HPV is closely related to the occurrence of tumors such as cervical cancer, anal canal cancer, penile cancer, and oropharyngeal cancer; while low-risk HPV infection can induce skin and mucosal system diseases such as common warts and genital warts. HPV-16 and HPV-18 have been found to be the most common subtypes that cause cervical cancer, and their typing detection is also an important basis for diversion during cervical cancer screening. Studies have shown that 99% of cervical cancer patients can detect HPV. Therefore, regular HPV testing can effectively prevent the occurrence of related cancers.

[0003] At present, the most commonly used method for clinical detection of HPV infection in my country is the liquid phase hybridization capture method. Hybridization capture has high sensitivity and can fully type the infected HPV, which is conducive to doctors to give the most reasonable follow-up treatment plan in a targeted manner. It is widely welcomed by doctors in hospitals. However, due to its long operation cycle, easy contamination, and relatively high cost, its scope of application is also limited. The HPV mRNA detection method is a new detection method. The HPV mRNA detection method has good specificity for the detection of cervical lesions after CIN2 (cervical intraepithelial neoplasia stage 2), but the detection method uses mRNA as the detection target and has high requirements for clinical specimen collection and preservation, nucleic acid extraction, etc. Fluorescence real-time PCR technology has become a major trend in today's detection methods due to its advantages such as low cost, high sensitivity, simple operation and low pollution. It is currently widely used in the field of HPV detection.

[0004] Currently, fluorescence-based real-time PCR products are relatively mature, and companies such as Kap Biosystems and Shengxiang Biotech have already launched a variety of products on the market, including some multiplex PCR products with partial genotyping such as 12+2, 13+2, and 16+2. However, the clinical test samples used in these listed products are usually cervical exfoliated cell samples collected by swabs or sampling brushes. Although the samples collected by cervical swabs have relatively high sensitivity, this sampling method is invasive and may cause pain and discomfort. Due to cultural and / or religious reasons, the above-mentioned invasive sampling method is not acceptable to women, especially unmarried women. This has greatly reduced women's willingness to participate in HPV testing, thus limiting the participation rate of HPV testing. At the same time, men can also carry HPV, so detecting HPV in the male population has a positive effect on preventing the occurrence of cervical cancer in the female population. However, the common sampling method for men (i.e., urethral swab) can cause pain and discomfort, and currently, few listed products are targeted at male HPV testing, which limits the application scope of HPV screening.

[0005] In this regard, using urine samples to detect HPV is an idea with broad application prospects, and many enterprises have started to actively research it. The 4800 HPV test is based on real-time fluorescence PCR technology and was approved by the FDA for cervical cancer screening in 2014. When Bernal et al. (Journal of Clinical Virology 61:548 - 552 (2014)) used the 4800 HPV test to detect urine samples and cervical samples from the same patient, the overall coincidence rate of HPV test results between urine and cervical samples was only 88%, indicating that while using urine samples is feasible, the sensitivity needs to be further improved. Chinese Patent CN 111936641 A discloses a primer-probe composition that can detect 14 high-risk types of HPV, including 12 + 2, in urine samples, and its effect is basically the same as that of using exfoliated cervical cell samples for microfluidic chip detection. However, although this method can achieve a detection effect similar to that of using exfoliated cervical cells as samples, this method can only detect 14 high-risk types, including 12 + 2. There are currently 18 recognized high-risk types in total. In particular, recent research on HPV53 has shown that its importance in the occurrence of cervical cancer has been underestimated. Research in recent years has found that the incidence and carcinogenicity of HPV53 rank very high. A 2023 literature study on the incidence of HPV infection and cervical cancer in nearly 200,000 women in Guangzhou, China (Cervical HPV infection in Guangzhou, China: an epidemiological study of 198,111 women from 2015 to 2021, Emerging Microbes & Infections 2023, VOL. 12, e2176009) reported that the incidence and carcinogenicity of HPV53 both rank fifth among all HPV types.The literature "Human papillomavirus genotype - specific risk in cervical carcinogenesis" (J Gynecol Oncol. 2019 Jul;30(4):e52) and "Prevalence characteristics of cervical human papillomavirus (HPV) infection in the Zhoupu District, Shanghai City, China" (Li et al. Virology Journal (2020) 17:84) also reported on the incidence and carcinogenicity of HPV53, and the conclusions were consistent. As can be seen above, previous product development obviously did not take into account the importance of HPV53 and could not meet future market demands.

[0006] Therefore, it is necessary to develop an HPV multi - type detection product that can use urine as a sample and includes the detection of HPV type 53. Summary of the Invention

[0007] To solve the problem that the prior art cannot detect HPV type 53 from urine samples, the present invention provides a detection composition, kit and method that can use urine as a sample, can genotype HPV16 / 18, and simultaneously detect a total of 13 + 2 HPV genotypes, namely HPV31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68.

[0008] The technical solution adopted by the present invention is: a composition for detecting and / or identifying HPV genotypes, the composition comprising:

[0009] HPV type 16 probes with base sequences shown in any one of SEQ ID NO. 1 - 2, HPV type 16 upstream primers with base sequences shown in any one of SEQ ID NO. 3 - 5, and HPV type 16 downstream primers with base sequences shown in any one of SEQ ID NO. 6 - 8;

[0010] HPV type 18 probes with base sequences shown in any one of SEQ ID NO. 9 - 10, HPV type 18 upstream primers with base sequences shown in any one of SEQ ID NO. 11 - 12, and HPV type 18 downstream primers with base sequences shown in any one of SEQ ID NO. 13 - 14;

[0011] HPV type 31 probes with base sequences shown in any of SEQ ID NO. 15 - 16, HPV type 31 upstream primers with base sequences shown in any of SEQ ID NO. 17 - 18, and HPV type 31 downstream primers with base sequences shown in any of SEQ ID NO. 19 - 20;

[0012] HPV type 33 probes with base sequences shown in any of SEQ ID NO. 21 - 22, HPV type 33 upstream primers with base sequences shown in any of SEQ ID NO. 23 - 24, and HPV type 33 downstream primers with base sequences shown in any of SEQ ID NO. 25 - 26;

[0013] HPV type 35 probes with base sequences shown in any of SEQ ID NO. 27 - 28, HPV type 35 upstream primers with base sequences shown in any of SEQ ID NO. 29 - 30, and HPV type 35 downstream primers with base sequences shown in any of SEQ ID NO. 31 - 32;

[0014] HPV type 39 probes with base sequences shown in any of SEQ ID NO. 33 - 35, HPV type 39 upstream primers with base sequences shown in any of SEQ ID NO. 36 - 38, and HPV type 39 downstream primers with base sequences shown in any of SEQ ID NO. 39 - 40;

[0015] HPV type 45 probes with base sequences shown in any of SEQ ID NO. 41 - 43, HPV type 45 upstream primers with base sequences shown in any of SEQ ID NO. 44 - 47, and HPV type 45 downstream primers with base sequences shown in any of SEQ ID NO. 48 - 50;

[0016] HPV type 51 probes with base sequences shown in any of SEQ ID NO. 51 - 52, HPV type 51 upstream primers with base sequences shown in any of SEQ ID NO. 53 - 54, and HPV type 51 downstream primers with base sequences shown in any of SEQ ID NO. 55 - 56;

[0017] HPV type 52 probes with base sequences shown in any of SEQ ID NO. 57 - 58, HPV type 52 upstream primers with base sequences shown in any of SEQ ID NO. 59 - 62, and HPV type 52 downstream primers with base sequences shown in any of SEQ ID NO. 63 - 65;

[0018] An HPV 53 type probe with a base sequence shown in any of SEQ ID NO. 66 to 67, an HPV 53 type upstream primer with a base sequence shown in any of SEQ ID NO. 68 to 69, and an HPV 53 type downstream primer with a base sequence shown in any of SEQ ID NO. 70 to 71;

[0019] An HPV 56 type probe with a base sequence shown in SEQ ID NO. 72, an HPV 56 type upstream primer with a base sequence shown in SEQ ID NO. 73, and an HPV 56 type downstream primer with a base sequence shown in SEQ ID NO. 74;

[0020] An HPV 58 type probe with a base sequence shown in any of SEQ ID NO. 75 to 76, an HPV 58 type upstream primer with a base sequence shown in any of SEQ ID NO. 77 to 78, and an HPV 58 type downstream primer with a base sequence shown in any of SEQ ID NO. 79 to 80;

[0021] An HPV 59 type probe with a base sequence shown in any of SEQ ID NO. 81 to 83, an HPV 59 type upstream primer with a base sequence shown in any of SEQ ID NO. 84 to 85, and an HPV 59 type downstream primer with a base sequence shown in any of SEQ ID NO. 86 to 87;

[0022] An HPV 66 type probe with a base sequence shown in SEQ ID NO. 88, an HPV 66 type upstream primer with a base sequence shown in SEQ ID NO. 89, and an HPV 66 type downstream primer with a base sequence shown in SEQ ID NO. 90;

[0023] An HPV 68 type probe with a base sequence shown in any of SEQ ID NO. 91 to 94, an HPV 68 type upstream primer with a base sequence shown in any of SEQ ID NO. 95 to 97, and an HPV 68 type downstream primer with a base sequence shown in any of SEQ ID NO. 98 to 100;

[0024] The two ends of the base sequence of the probe are respectively connected with a fluorescent reporter group and a fluorescent quenching group; among them, the fluorescent reporter groups of the HPV 16 type probe and the HPV 18 type probe are different, and the fluorescent reporter groups of the HPV 16 type probe and the HPV 18 type probe are also different from those of the remaining HPV probes.

[0025] Preferably, the composition is selected from any one of combination 1, combination 2, and combination 3, and more preferably combination 1.

[0026] The combination 1 includes:

[0027] An HPV 16 probe with a base sequence as shown in SEQ ID NO. 1, an HPV 16 upstream primer as shown in SEQ ID NO. 4, and an HPV 16 downstream primer as shown in SEQ ID NO. 8;

[0028] An HPV 18 probe with a base sequence as shown in SEQ ID NO. 9, an HPV 18 upstream primer as shown in SEQ ID NO. 11, and an HPV 18 downstream primer as shown in SEQ ID NO. 13;

[0029] An HPV 31 probe with a base sequence as shown in SEQ ID NO. 15, an HPV 31 upstream primer as shown in SEQ ID NO. 17, and an HPV 31 downstream primer as shown in SEQ ID NO. 19;

[0030] An HPV 33 probe with a base sequence as shown in SEQ ID NO. 21, an HPV 33 upstream primer as shown in SEQ ID NO. 23, and an HPV 33 downstream primer as shown in SEQ ID NO. 25;

[0031] An HPV 35 probe with a base sequence as shown in SEQ ID NO. 27, an HPV 35 upstream primer as shown in SEQ ID NO. 29, and an HPV 35 downstream primer as shown in SEQ ID NO. 31;

[0032] An HPV 39 probe with a base sequence as shown in SEQ ID NO. 35, an HPV 39 upstream primer as shown in SEQ ID NO. 38, and an HPV 39 downstream primer as shown in SEQ ID NO. 39;

[0033] An HPV 45 probe with a base sequence as shown in SEQ ID NO. 43, an HPV 45 upstream primer as shown in SEQ ID NO. 45, and an HPV 45 downstream primer as shown in SEQ ID NO. 48;

[0034] An HPV 51 probe with a base sequence as shown in SEQ ID NO. 51, an HPV 51 upstream primer as shown in SEQ ID NO. 53, and an HPV 51 downstream primer as shown in SEQ ID NO. 55;

[0035] An HPV 52 - type probe with a base sequence as shown in SEQ ID NO. 58, an HPV 52 - type upstream primer as shown in SEQ ID NO. 62, and an HPV 52 - type downstream primer as shown in SEQ ID NO. 64;

[0036] An HPV 53 - type probe with a base sequence as shown in SEQ ID NO. 66, an HPV 53 - type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 - type downstream primer as shown in SEQ ID NO. 70;

[0037] An HPV 56 - type probe with a base sequence as shown in SEQ ID NO. 72, an HPV 56 - type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 - type downstream primer as shown in SEQ ID NO. 74;

[0038] An HPV 58 - type probe with a base sequence as shown in SEQ ID NO. 75, an HPV 58 - type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 - type downstream primer as shown in SEQ ID NO.79;

[0039] An HPV 59 - type probe with a base sequence as shown in SEQ ID NO. 82, an HPV 59 - type upstream primer as shown in SEQ ID NO. 84, and an HPV 59 - type downstream primer as shown in SEQ ID NO.86;

[0040] An HPV 66 - type probe with a base sequence as shown in SEQ ID NO. 88, an HPV 66 - type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 - type downstream primer as shown in SEQ ID NO. 90;

[0041] An HPV 68 - type probe with a base sequence as shown in SEQ ID NO. 93, an HPV 68 - type upstream primer as shown in SEQ ID NO. 95, and an HPV 68 - type downstream primer as shown in SEQ ID NO. 98.

[0042] The said combination 2 includes:

[0043] An HPV 16 - type probe with a base sequence as shown in SEQ ID NO. 2, an HPV 16 - type upstream primer as shown in SEQ ID NO. 5, and an HPV 16 - type downstream primer as shown in SEQ ID NO. 8;

[0044] An HPV 18 probe with a base sequence as shown in SEQ ID NO. 9, an HPV 18 upstream primer as shown in SEQ ID NO. 11, and an HPV 18 downstream primer as shown in SEQ ID NO. 13;

[0045] An HPV 31 probe with a base sequence as shown in SEQ ID NO. 15, an HPV 31 upstream primer as shown in SEQ ID NO. 18, and an HPV 31 downstream primer as shown in SEQ ID NO. 19;

[0046] An HPV 33 probe with a base sequence as shown in SEQ ID NO. 21, an HPV 33 upstream primer as shown in SEQ ID NO. 24, and an HPV 33 downstream primer as shown in SEQ ID NO. 26;

[0047] An HPV 35 probe with a base sequence as shown in SEQ ID NO. 27, an HPV 35 upstream primer as shown in SEQ ID NO. 29, and an HPV 35 downstream primer as shown in SEQ ID NO. 31;

[0048] An HPV 39 probe with a base sequence as shown in SEQ ID NO. 34, an HPV 39 upstream primer as shown in SEQ ID NO. 38, and an HPV 39 downstream primer as shown in SEQ ID NO. 39;

[0049] An HPV 45 probe with a base sequence as shown in SEQ ID NO. 43, an HPV 45 upstream primer as shown in SEQ ID NO. 45, and an HPV 45 downstream primer as shown in SEQ ID NO. 48;

[0050] An HPV 51 probe with a base sequence as shown in SEQ ID NO. 51, an HPV 51 upstream primer as shown in SEQ ID NO. 53, and an HPV 51 downstream primer as shown in SEQ ID NO. 55;

[0051] An HPV 52 probe with a base sequence as shown in SEQ ID NO. 57, an HPV 52 upstream primer as shown in SEQ ID NO. 59, and an HPV 52 downstream primer as shown in SEQ ID NO. 63;

[0052] An HPV 53 type probe with a base sequence as shown in SEQ ID NO. 66, an HPV 53 type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 type downstream primer as shown in SEQ ID NO. 70;

[0053] An HPV 56 type probe with a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74;

[0054] An HPV 58 type probe with a base sequence as shown in SEQ ID NO. 75, an HPV 58 type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 type downstream primer as shown in SEQ ID NO. 79;

[0055] An HPV 59 type probe with a base sequence as shown in SEQ ID NO. 82, an HPV 59 type upstream primer as shown in SEQ ID NO. 85, and an HPV 59 type downstream primer as shown in SEQ ID NO. 87;

[0056] An HPV 66 type probe with a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90;

[0057] An HPV 68 type probe with a base sequence as shown in SEQ ID NO. 93, an HPV 68 type upstream primer as shown in SEQ ID NO. 96, and an HPV 68 type downstream primer as shown in SEQ ID NO. 99.

[0058] The said combination 3 includes:

[0059] An HPV 16 type probe with a base sequence as shown in SEQ ID NO. 1, an HPV 16 type upstream primer as shown in SEQ ID NO. 5, and an HPV 16 type downstream primer as shown in SEQ ID NO. 8;

[0060] An HPV 18 type probe with a base sequence as shown in SEQ ID NO. 10, an HPV 18 type upstream primer as shown in SEQ ID NO. 12, and an HPV 18 type downstream primer as shown in SEQ ID NO. 14;

[0061] An HPV 31 probe with a base sequence as shown in SEQ ID NO. 15, an HPV 31 upstream primer as shown in SEQ ID NO. 18, and an HPV 31 downstream primer as shown in SEQ ID NO. 20;

[0062] An HPV 33 probe with a base sequence as shown in SEQ ID NO. 21, an HPV 33 upstream primer as shown in SEQ ID NO. 23, and an HPV 33 downstream primer as shown in SEQ ID NO. 26;

[0063] An HPV 35 probe with a base sequence as shown in SEQ ID NO. 27, an HPV 35 upstream primer as shown in SEQ ID NO. 27, and an HPV 35 downstream primer as shown in SEQ ID NO. 31;

[0064] An HPV 39 probe with a base sequence as shown in SEQ ID NO. 35, an HPV 39 upstream primer as shown in SEQ ID NO. 36, and an HPV 39 downstream primer as shown in SEQ ID NO. 39;

[0065] An HPV 45 probe with a base sequence as shown in SEQ ID NO. 43, an HPV 45 upstream primer as shown in SEQ ID NO. 44, and an HPV 45 downstream primer as shown in SEQ ID NO. 49;

[0066] An HPV 51 probe with a base sequence as shown in SEQ ID NO. 52, an HPV 51 upstream primer as shown in SEQ ID NO. 54, and an HPV 51 downstream primer as shown in SEQ ID NO. 55;

[0067] An HPV 52 probe with a base sequence as shown in SEQ ID NO. 58, an HPV 52 upstream primer as shown in SEQ ID NO. 62, and an HPV 52 downstream primer as shown in SEQ ID NO. 63;

[0068] An HPV 53 probe with a base sequence as shown in SEQ ID NO. 67, an HPV 53 upstream primer as shown in SEQ ID NO. 69, and an HPV 53 downstream primer as shown in SEQ ID NO. 71;

[0069] An HPV 56 probe with a base sequence shown in SEQ ID NO. 72, an HPV 56 upstream primer with a base sequence shown in SEQ ID NO. 73, and an HPV 56 downstream primer with a base sequence shown in SEQ ID NO. 74;

[0070] An HPV 58 probe with a base sequence shown in SEQ ID NO. 76, an HPV 58 upstream primer with a base sequence shown in SEQ ID NO. 78, and an HPV 58 downstream primer with a base sequence shown in SEQ ID NO. 80;

[0071] An HPV 59 probe with a base sequence shown in SEQ ID NO. 81, an HPV 59 upstream primer with a base sequence shown in SEQ ID NO. 84, and an HPV 59 downstream primer with a base sequence shown in SEQ ID NO. 86;

[0072] An HPV 66 probe with a base sequence shown in SEQ ID NO. 88, an HPV 66 upstream primer with a base sequence shown in SEQ ID NO. 89, and an HPV 66 downstream primer with a base sequence shown in SEQ ID NO. 90;

[0073] An HPV 68 probe with a base sequence shown in SEQ ID NO. 91, an HPV 68 upstream primer with a base sequence shown in SEQ ID NO. 95, and an HPV 68 downstream primer with a base sequence shown in SEQ ID NO. 100.

[0074] Referring to Table 1, compared with the currently most commonly used 12 + 2 detection reagent, the composition provided by the present invention adds primers and probes for detecting HPV type 53 with relatively high incidence and carcinogenicity, thereby improving the effectiveness of HPV detection for cervical cancer prevention. Further, aiming at the problem that the sensitivity of HPV detection using urine as a sample is lower than that of cervical exfoliated cells, the present invention conducts adaptive screening and optimization in the design of primers and probes. At the same time, the effects of combining primers and probes of 13 + 2 types of HPV are also considered. It is necessary to ensure not only the specificity and sensitivity of the probes and primers for each detection type respectively, but also to avoid the mutual influence between the primers and probes of different detection types (such as forming dimers or non-specific products, etc.). So that the composition can accurately and effectively detect a total of 15 types of HPV including HPV type 53 (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) in urine with low HPV content with just one tube of multiplex PCR reaction and type HPV16 / 18. Taking CV < 5% as the standard, a preferred 13 + 2 type composition (Composition 1) provided by the present invention reaches the lower limits of detection LOD of 10 - 30 copies / reaction and 5 - 40 copies / mL for the 13 + 2 type HPV standard product and HPV detection in urine samples respectively. This lower limit of detection LOD effect obtained by the preferred 13 + 2 type composition in urine samples is unexpected. In summary, obtaining the preferred 13 + 2 type primer-probe composition with good specificity and sensitivity in this application and combining it with a fluorescence labeling system with good reporting effect, and then obtaining the composition with an extremely low lower limit of detection in urine samples claimed in the present invention cannot be achieved merely through logical analysis, reasoning, or limited experiments based on the prior art.

[0075] Preferably, the composition further includes: an internal reference ACTB probe shown in SEQ ID NO. 101, an upstream primer of the internal reference ACTB shown in SEQ ID NO. 102, and a downstream primer of the internal reference ACTB shown in SEQ ID NO. 103; wherein, the fluorescence reporter group of the internal reference ACTB probe is different from that of the HPV probe. The internal reference gene is Actin (ACTB). That is to say, the composition of the present invention can further include internal standard primers and internal standard probes, which can be used in combination with other primers and probes in the composition of the present invention without mutual influence. The use of internal standard primers and probes can judge whether this detection is effective and further ensure the detection accuracy of the composition.

[0076] Table 1. Composition for detecting HPV genotypes

[0077] SEQ ID NO. Name Sequence Information (5' to 3') 1 Probe HPV16-P1 CAACATATTCATCCGTGCTTACAACCT 2 Probe HPV16-P2 CCAGGAGGCACACTAGAAGATACT 3 Primer HPV16-F1 GGACTGGAATTTTGGTC 4 Primer HPV16-F2 GTCTACTTGCCTCCTG 5 Primer HPV16-F3 ACTGGAATTTTGGTCTAC 6 Primer HPV16-R1 GGGATCATCTTCTTTAGG 7 Primer HPV16-R2 GTGCTGGAGGTGTATG 8 Primer HPV16-R3 CCTGCATGATAATATATGTTTG 9 Probe HPV18-P1 TGGCTCTATTGTTACCTCTGACTCC 10 Probe HPV18-P2 TTCTTCCTCTGAGTCGCTTAATTGCT 11 Primer HPV18-F1 GTGTGTATTCTCCCTCTC 12 Primer HPV18-F2 CGGTTGACCTTCTATGTC 13 Primer HPV18-R1 TGCCTTATGTAACCAATATG 14 Primer HPV18-R2 GCTGGTAAATGTTGATGATTA 15 Probe HPV31-P1 TGTGTTTGTTTATAATCCAT 16 Probe HPV31-P2 ATTATCAGTGCCAGGACCACCG 17 Primer HPV31-F1 GCACTGATAATAGGGAATG 18 Primer HPV31-F2 AGTGGTCATCCATTACTAA 19 Primer HPV31-R1 GCAACCAAGTAAACACAG 20 Primer HPV31-R2 GCTGTGTTTGTTTATAATCC 21 Probe HPV33-P1 TGTGTTTGTTTATAATCCAT 22 Probe HPV33-P2 CACCTGCCAATGATTGTCCACC 23 Primer HPV33-F1 TGCTGATAATAGGGAATGT 24 Primer HPV33-F2 AGGTGTTGCTTGTACTAA 25 Primer HPV33-R1 GCTTACATCCAAGTAAACATA 26 Primer HPV33-R2 TCACCATCCTCAATAATAGTA 27 Probe HPV35-P1 TGTGTTTGTTTATAATCCAT 28 Probe HPV35-P2 CACACCTTGTAATGCTAACCAGG 29 Primer HPV35-F1 GGTACAGATAACAGGGAAT 30 Primer HPV35-F2 CTCCTATAGGTGAACATTG 31 Primer HPV35-R1 CTACAACCTATTAAACACAAT 32 Primer HPV35-R2 CAGTGTTTAGTAACTCCAAA 33 Probe HPV39-P1 ACTGTCCTCCTTTGGAC 34 Probe HPV39-P2 CATGCAAGCCCAATAATG 35 Probe HPV39-P3 AGGTGTCTGCATATC 36 Primer HPV39-F1 TGGTGGTCGCAAGCAG 37 Primer HPV39-F2 GGCCAGCCATTGGGTGT 38 Primer HPV39-F3 AATGGTGGTCGCAAG 39 Primer HPV39-R1 ATACTGAATTTATTAGGATCGG 40 Primer HPV39-R2 ACCAACACCCAATGGCTGGCC 41 Probe HPV45-P1 CAAATGTCTGCTGATCC 42 Probe HPV45-P2 TCCATCTGTAAATATC 43 Probe HPV45-P3 TCATATTCCTCCACATG 44 Primer HPV45-F1 AATCCTGTGCCAAGTAC 45 Primer HPV45-F2 ATATGATCCTACTAAGTTTAAGC 46 Primer HPV45-F3 TATGTGCCTCTACACAA 47 Primer HPV45-F4 TCCTACTAAGTTTAAGCAATATAG 48 Primer HPV45-R1 ATATGATCCYACTAAGTTTAAGC 49 Primer HPV45-R2 CCTCTGCAGTTAAAGTAATAG 50 Primer HPV45-R3 CACAACTGAAAAATAAACTGTAA 51 Probe HPV51-P1 TAGGCTGTGCTCCA 52 Probe HPV51-P2 CATAACTGAGTCTG 53 Primer HPV51-F1 CAAACAGACTCAGTTATGTATA 54 Primer HPV51-F2 TTAGAGATAACACATCTGTTG 55 Primer HPV51-R1 GCATGTAGTGCCAATAC 56 Primer HPV51-R2 GGTCATCCCTTATTTAATAAATATG 57 Probe HPV52-P1 AACAGTAGGACATCC 58 Probe HPV52-P2 ACCACTCGTAGCACTAACATGACTT 59 Primer HPV52-F1 AGGGAATGTTTATCTATGGAT 60 Primer HPV52-F2 GCAGGCAGTTCTCG 61 Primer HPV52-F3 GGAATGTTTATCTATGGATTATAAG 62 Primer HPV52-F4 TTGTCACAGTTGTGGA 63 Primer HPV52-R1 CATTACCACTACTGGTGT 64 Primer HPV52-R2 CATGACGAAGGTATTCCT 65 Primer HPV52-R3 CCATGACGAAGGTATTCC 66 Probe HPV53-P1 ATTACAACGGATGCC 67 Probe HPV53-P2 CTAAACACCCTATACTGA 68 Primer HPV53-F1 CCTACCCCTGTATCAAAG 69 Primer HPV53-F2 ACATCCCTAAGGTGTCT 70 Primer HPV53-R1 AATATAGTGGTGCGTTTTAC 71 Primer HPV53-R2 ATCTGGGAGGCGTAC 72 Probe HPV56-P1 TCATATTCCTCCACATG 73 Primer HPV56-F1 CGAAAAATTAATCAGTACCTTAG 74 Primer HPV56-R1 GCATAATTGAAAAACAAATTGTAA 75 Probe HPV58-P1 TGTGTTTGTTTATAATCCAT 76 Probe HPV58-P2 CTGCTACTGATTGTCCTCCATTGG 77 Primer HPV58-F1 CTGATAACAGGGAATGC 78 Primer HPV58-F2 GTTCCTTGTAACAATAATGC 79 Primer HPV58-R1 GTTTACAGCCAATTAAACATAA 80 Primer HPV58-R2 GTCACCATCCTCAATAATAG 81 Probe HPV59-P1 CTTCTTACAGTTGGAC 82 Probe HPV59-P2 AGGTGTCTGCATATC 83 Probe HPV59-P3 ACGTGCCAACCCAGGCAGT 84 Primer HPV59-F1 GGTAGACAGGATGTTCC 85 Primer HPV59-F2 CTTCCTGAATCACTATATA 86 Primer HPV59-R1 GTAAMTTAACCCTAAATACTCTGT 87 Primer HPV59-R2 GCCAACCCAGGCAGTTATTCG 88 Probe HPV66-P1 TCATATTCCTCCACATG 89 Primer HPV66-F1 TGAAATCAATCAATACCTTCG 90 Primer HPV66-R1 AGTTGAAACACAAACTGTAG 91 Probe HPV68-P1 CACTGACATTCGTGAAAC 92 Probe HPV68-P2 ATCCTGACTATTTGCAAAT 93 Probe HPV68-P3 AGGTGTCTGCATATC 94 Probe HPV68-P4 ACAGAGTGTTTAGGGT 95 Primer HPV68-F1 CGCAAGCAGGRCATT 96 Primer HPV68-F2 AGGTYCCTATGTCTGG 97 Primer HPV68-F3 CGCAAGCAGGRCATT 98 Primer HPV68-R1 GRTTATATAATGTAGACTCAGG 99 Primer HPV68-R2 GGAAATCCTAAACACCCT 100 Primer HPV68-R3 GGATCAGGTAGGGAAATC 101 Reference probe ACTB-P CACTGGCATCGTGATGGACTCCG 102 Reference primer ACTB-F GCCATGTACGTTGCTATC 103 Reference primer ACTB-R GAGGTAGTCAGTCAGGTC

[0078] Preferably, the fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, OregonGreenTM, CALRedTM, Red640, Texas Red, LighterCycler® Cyan500, LighterCycler® Red610, biotin-binding material, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid, tetramethylrhodamine, tetramethylrhodamine isocyanate, fluorescein isocyanate, χ-rhodamine.

[0079] Preferably, the fluorescence quenching group is selected from DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa Black FQ, Iowa Black RQ, BHQ1, BHQ2, BHQ3, QSY7, QSY9, QSY21.

[0080] Preferably, the fluorescent reporter group of the HPV 16 type probe is VIC, the fluorescent reporter group of the HPV 18 type probe is ROX, the fluorescent reporter groups of the remaining HPV probes are FAM, and the fluorescent reporter group of the internal reference ACTB probe is Cy5.

[0081] Preferably, the fluorescence quenching groups of the HPV 16 type and HPV 52 type probes are BHQ1, the fluorescence quenching group of the HPV 18 type probe is BHQ2, the fluorescence quenching groups of the remaining HPV probes are MGB, and the fluorescence quenching group of the internal reference ACTB probe is BHQ3.

[0082] The present invention also provides the use of the composition in the preparation of a kit for detecting and / or identifying HPV genotypes.

[0083] The present invention also provides a kit for detecting and / or identifying HPV genotypes, and the kit includes the composition.

[0084] Preferably, the kit further includes a reagent for separating DNA from a sample. The reagent for separating DNA from a urine sample includes at least one of a stabilizer, purification beads, urine cell digestive juice, proteinase K, lysis solution, and ethanol.

[0085] Preferably, the lysis solution comprises: 2 - 5 M guanidine isothiocyanate, 10 - 100 mM EDTA, 10 - 100 mM Tris, 1% - 12% Triton, 0.5% - 2% SDS. More preferably, the lysis solution comprises: 4 - 5 M guanidine isothiocyanate, 10 - 20 mM EDTA, 10 - 20 mM Tris, 2% - 4% Triton, 1% - 2% SDS.

[0086] Preferably, the urine cell digestion solution comprises: 100 - 150 mM EDTA, 3% - 8% Triton, pH 5.5 - 6. More preferably, the urine cell digestion solution comprises: 100 mM EDTA, 3% - 8% Triton, pH 5.5.

[0087] Preferably, the concentration of proteinase K is 20 - 50 mg / mL, more preferably 50 mg / mL.

[0088] The sample is selected from cervical smears, fresh tissue samples, fixed tissue samples, section samples of tissue samples, urine samples, samples containing exfoliated cells, peripheral blood samples, penile swabs, or other body fluids, more preferably urine samples. The urine sample is selected from whole urine samples or urine supernatant samples.

[0089] The present invention also provides a method for detecting and / or identifying HPV genotypes for non-diagnostic purposes in vitro, the method comprising the following steps:

[0090] Step 1: Extract the DNA of the sample to be tested;

[0091] Step 2: Perform fluorescence quantitative PCR on the DNA obtained in Step 1 using the composition or the kit described above;

[0092] Step 3: Obtain and analyze the results.

[0093] Preferably, the sample is selected from cervical smears, fresh tissue samples, fixed tissue samples, section samples of tissue samples, urine samples, samples containing exfoliated cells, peripheral blood samples, penile swabs, or other body fluids, more preferably urine samples. The urine sample is selected from whole urine samples or urine supernatant samples.

[0094] Preferably, Step 1 includes:

[0095] Add purification beads to the urine sample, vortex, centrifuge, and collect the cell pellet;

[0096] After mixing the cell pellet with the urine cell digestion solution, add 20 - 50 mg / mL proteinase K, incubate at 55°C for 0.5 - 1 h, vortex, and incubate;

[0097] After adding lysis buffer and ethanol to the incubation system, pass through an adsorption column. Wash the adsorption column after loading the sample 3 to 4 times with the washing solution and centrifuge. Elute the washed adsorption column with water and collect the solution containing DNA after centrifugation;

[0098] Among them, the lysis buffer includes: 2 - 5 M guanidine isothiocyanate, 10 - 100 mM EDTA, 10 - 100 mM Tris, 1% - 12% Triton, 0.5% - 2% SDS;

[0099] The urine cell digestion solution includes: 100 - 150 mM EDTA, 3% - 8% Triton, pH 5.5 - 6.

[0100] The present invention also provides a reagent for separating DNA from a urine sample, including at least one of a stabilizer, purification beads, urine cell digestion solution, proteinase K, lysis buffer, and ethanol; the urine sample is selected from a whole urine sample or a urine supernatant sample.

[0101] Preferably, the lysis buffer includes: 2 - 5 M guanidine isothiocyanate, 10 - 100 mM EDTA, 10 - 100 mM Tris, 1% - 12% Triton, 0.5% - 2% SDS. More preferably, the lysis buffer includes: 4 - 5 M guanidine isothiocyanate, 10 - 20 mM EDTA, 10 - 20 mM Tris, 2% - 4% Triton, 1% - 2% SDS.

[0102] Preferably, the urine cell digestion solution includes: 100 - 150 mM EDTA, 3% - 8% Triton, pH 5.5 - 6. More preferably, the urine cell digestion solution includes: 100 mM EDTA, 3% - 8% Triton, pH 5.5.

[0103] Preferably, the concentration of the proteinase K is 20 - 50 mg / mL, more preferably 50 mg / mL.

[0104] The present invention also provides a method for separating DNA from a urine sample using the reagent for separating DNA from a urine sample, and the method includes the following steps:

[0105] Add purification beads to the urine sample, vortex and centrifuge to collect the cell pellet;

[0106] After mixing the cell pellet with the urine cell digestion solution, add 20 - 50 mg / mL proteinase K, incubate at 55°C for 0.5 - 1 h, vortex and incubate;

[0107] After adding lysis buffer and ethanol to the incubation system, pass through an adsorption column. Use the washing solution to wash the adsorption column after loading the sample 3 to 4 times, and centrifuge. Use water to elute the washed adsorption column, and collect the solution containing DNA after centrifugation.

[0108] To ensure that the DNA sample for PCR detection contains a higher concentration of HPV virus and improve the sensitivity of urine HPV detection, the present invention also improves the method for isolating DNA from urine samples. By means of magnetic bead purification in combination with an adsorption column, and specifically adjusting the formula of the lysis buffer, adjusting the concentration and digestion time of the cell digestion solution and proteinase K, the formula and washing method of the washing solution, etc., while avoiding PCR inhibitory components, effectively improving the extraction amount of DNA in urine. Therefore, combining the 13+2 type primer-probe composition with good specificity and sensitivity of the present invention with a fluorescence labeling system with good reporting effect, and combining with the improved method for extracting high-quality total urine DNA from urine samples, it is possible to accurately and effectively detect a total of 15 HPV types including HPV53 type and genotype HPV16 / 18 through a one-tube multiplex PCR reaction in urine with a low HPV content, and has an extremely low detection limit in urine samples.

[0109] Advantages of the present invention: According to existing research results and literature reports, the biggest defect in detecting HPV in urine samples is that the virus load is too low. Compared with traditional cervical swabs, the virus load may be only one-tenth or even one-hundredth of it, which is the fundamental reason for the low sensitivity of detecting HPV in urine samples. To solve this problem, it is necessary to optimize and improve from two aspects: on the one hand, develop a better urine extraction technology to ensure more nucleic acids are extracted from urine; on the other hand, improve the detection sensitivity of the HPV kit PCR to ensure that HPV infection can be detected even at a lower HPV virus load. Therefore, the present invention optimizes from the aspects of urine extraction and PCR sensitivity respectively, develops a method for extracting high-quality DNA from 40 mL of total urine, and optimizes and screens a set of probe primer combinations with high sensitivity. Using this extraction method and combining with the screened probe primer combination, it is possible to accurately and effectively detect a total of 15 HPV types including HPV53 type (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) and genotype HPV16 / 18 through a one-tube multiplex PCR reaction in urine with a low HPV content, and the detection limit in urine samples reaches 5 to 40 copies / mL, with good sensitivity and specificity. Brief Description of the Drawings

[0110] Figure 1 It is the amplification result of all types in combination 1 in Example 2 of the present invention in the same tube reaction.

[0111] Figure 2 This is the result of the reaction without template for all types in combination 1 in Example 2 of the present invention.

[0112] Figure 3 This is the amplification result of the reaction with all types in combination 2 in Example 2 of the present invention.

[0113] Figure 4 This is the result of the reaction without template for all types in combination 2 in Example 2 of the present invention.

[0114] Figure 5 This is the amplification result of the reaction with all types in combination 3 in Example 2 of the present invention.

[0115] Figure 6 This is the result of the reaction without template for all types in combination 3 in Example 2 of the present invention.

[0116] Figure 7 This is the result of the fluorescence quantitative PCR detection of all types in combination 1 in Example 4 of the present invention. Detailed implementation manners

[0117] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, without conflict, the following embodiments and the features in the embodiments can be combined with each other. In the embodiments of the present invention, unless otherwise specified, the methods used are all conventional methods, and the reagents used can all be obtained from commercial channels.

[0118] Example 1: Extracting DNA to be detected from urine samples

[0119] Experiment 1. Optimization of the lysis buffer formula

[0120] A total of 500 ml of urine was collected. 50 mL centrifuge tubes were taken, and 40 mL of urine was added to each tube. The whole urine was designated as C, and the supernatant was designated as S. The S sample was: the whole urine sample was centrifuged at 3000 g for 15 minutes, the supernatant was collected, and the sediment was discarded. Subsequently, the S sample and the supernatant of the C sample were synchronously subjected to extraction treatment. Among them, the lysis buffers used in the urine extraction scheme provided in this embodiment were lysis buffer 1, lysis buffer 2, lysis buffer 3, lysis buffer 4, and lysis buffer 5. The core component guanidine isothiocyanate of the lysis buffer was optimized with emphasis, and its auxiliary components Triton and SDS were verified and compared within the conventional usage range, while the conventional DNA enzyme inhibitors and buffers EDTA and Tris were verified within the appropriate usage range.

[0121] Components of Lysis Buffer 1: 2 M guanidine isothiocyanate, 10 mM EDTA, 10 mM Tris, 1% Triton, 0.5% SDS.

[0122] Components of Lysis Buffer 2: 3 M guanidine isothiocyanate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0123] Components of Lysis Buffer 3: 4 M guanidine isothiocyanate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0124] Components of Lysis Buffer 4: 4.5 M guanidine isothiocyanate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0125] Components of Lysis Buffer 5: 5 M guanidine isothiocyanate, 20 mM EDTA, 20 mM Tris, 4% Triton, 2% SDS.

[0126] The specific steps for extracting the DNA to be tested from urine samples provided in this example include:

[0127] 1. Add 10 μL of purification beads (Thermo Fisher 37002D) to the supernatant of S sample or C sample, vortex, centrifuge at 3000 g for 15 minutes, and collect the cell pellet.

[0128] 2. Remove the supernatant and retain 100 μL of cell pellet (make up to 100 μL with water if less than 100 μL); add 100 μL of urine cell digestion solution (ZYMO, catalog number BJD3061 - 3 - 20) to the cell pellet.

[0129] 3. Add another 10 μL of proteinase K (20 mg / mL, MCE), vortex, and incubate at 55 °C for 30 minutes.

[0130] 4. Add another 210 μL of lysis buffer, then add 420 μL of absolute ethanol, pass through the adsorption column (Tiangen Biotech CA5), and centrifuge at 13000 g for 2 min.

[0131] 5. Add 700 μL of washing buffer (70% ethanol, 50 mM hepes, 100 mM sodium chloride, pH = 7.2) to the adsorption column, centrifuge at 13000 g for 2 min, and discard the washing buffer.

[0132] 6. Add 700 μL of 85% ethanol to the adsorption column, centrifuge at 13000 g for 2 min, and discard the washing buffer.

[0133] 7. Add 700 μL of 85% ethanol to the adsorption column, centrifuge at 13000 g for 3 min, and discard the washing solution.

[0134] 8. Place the adsorption column in a 1.5 mL centrifuge tube, add 50 μL of water for elution, let it stand at room temperature for 5 min, centrifuge at 12000 g for 2 min, collect the precipitate, and store it at 4 °C for later use.

[0135] Measure the Qubit of the extracted DNA solution and compare the average concentration. The results are shown in Table 2.

[0136] Table 2. Concentrations of DNA solutions extracted from urine samples using different methods / lysis buffers (ng / μL)

[0137] Sample Volume Lysis solution 1 Lysis solution 2 Lysis solution 3 Lysis solution 4 Lysis solution 5 Supernatant 40 mL 1.5 2.5 6.2 7.5 7.3 Total urine 40 mL 3.8 5.8 15.9 23.3 24.1

[0138] Result discussion: There is no significant difference between lysis buffer 4 and lysis buffer 5. Considering the reagent cost and preparation difficulty, a formulation with a lower concentration but achieving the expected effect is preferably selected as much as possible. The preferred lysis buffer 4 formulation of the present invention is: 4.5 M guanidine isothiocyanate, 20 mM EDTA, 20 mM Tris, 2% Triton, 1% SDS.

[0139] Experiment 2. Optimization of urine cell digestion solution

[0140] Cell digestion solution formulation:

[0141] Digestion solution 1: 4 mM Tris, 6 mM EDTA (pH 8.0), 1 M guanidine isothiosulfate.

[0142] Digestion solution 2: 100 mM Tris (pH 8.0), 20 mM calcium chloride, 3% Triton.

[0143] Digestion solution 3: 150 mM Tris (pH 6.0), 150 mM acetic acid, 80 mM calcium chloride, 3% Triton.

[0144] Digestion solution 4: 100 mM EDTA (pH 5.5), 3% Triton.

[0145] Digestion solution 5: 100 mM EDTA (pH 5.5), 8% Triton.

[0146] Process and extract urine samples according to the methods and steps of Experiment 1, using the optimized lysis buffer 4 as the lysis buffer. Measure the Qubit of the extracted DNA solution and compare the average concentration. The results are shown in Table 3.

[0147] Table 3. Concentrations of DNA solutions extracted from urine samples using different digestion solutions (ng / μL)

[0148] Sample Volume Digestion solution 1 Digestion solution 2 Digestion solution 3 Digestion solution 4 Digestion solution 5 Supernatant 40 mL 1.5 4.5 0.7 6.8 5.3 Total urine 40 mL 3.8 11.2 1.5 21.7 17.2

[0149] Results and Discussion: Compared with Digestive Fluids 2 - 3 using Tris as buffer, Digestive Fluids 4 - 5 use pH 5.5 EDTA as buffer and are supplemented with an appropriate concentration of Triton, which have better effects on the extraction of DNA from urine samples. The optimal urine cell digestive fluid is Digestive Fluid 4: 100 mM EDTA (pH 5.5), 3% Triton.

[0150] Experiment 3: Optimization of Proteinase K Dosage and Reaction Time

[0151] Reaction Condition 1: 20 mg / mL Proteinase K, 55°C for half an hour.

[0152] Reaction Condition 2: 20 mg / mL Proteinase K, 55°C for 1 hour.

[0153] Reaction Condition 3: 50 mg / mL Proteinase K, 55°C for half an hour.

[0154] Reaction Condition 4: 50 mg / mL Proteinase K, 55°C for 1 hour.

[0155] Process and extract urine samples according to the methods and steps of Experiment 1, where Step 3 is adjusted according to Reaction Conditions 1 - 4 above respectively. The lysis buffer uses the optimized Lysis Buffer 4, and the digestive fluid uses the optimized Digestive Fluid 4. Measure the Qubit of the extracted DNA solution and compare the average concentration. The results are shown in Table 4.

[0156] Table 4. Concentrations of DNA Solutions Extracted from Urine Samples under Different Proteinase K Reaction Conditions (ng / μL)

[0157] Sample Reaction condition 1 Reaction condition 2 Reaction condition 3 Reaction condition 4 Supernatant 40 mL 7.2 8.3 8.7 8.1 Total urine 40 mL 23.8 27.2 31.6 32.7

[0158] Results and Discussion: Both prolonging the Proteinase K digestion time and increasing the Proteinase K concentration can significantly increase the recovery concentration of total urine DNA. However, prolonging the reaction time will significantly increase the labor cost, and the long - time reaction also affects the stability of DNA. Therefore, Reaction Condition 3: 50 mg / mL Proteinase K, 55°C for half an hour is preferred.

[0159] Experiment 4: Comparison between the Optimized Extraction Protocol and the Urine Extraction of ZYMO Kit

[0160] A total of 500 mL of urine was collected. 50 mL centrifuge tubes were taken, and 40, 20, and 10 mL of urine were added respectively. The whole urine sample was designated as C, and the supernatant sample was designated as S. The S sample was obtained by centrifuging the whole urine sample at 3000 g for 15 minutes, collecting the supernatant, and discarding the sediment. Subsequently, the S sample and the C sample were subjected to extraction treatment synchronously. The urine extraction protocol provided by the present invention and the ZYMO D3061 kit were used for extraction respectively to compare the differences in the extraction effects of the two protocols.

[0161] Table 5. Concentrations of DNA solutions extracted from urine samples using different extraction protocols (ng / μL)

[0162] Sample Volume The present invention ZYMO Supernatant 10 mL 4.43 1.41 Supernatant 20 mL 8.20 1.74 Supernatant 40 mL 9.35 3.74 Total urine 10 mL 11.20 5.50 Total urine 20 mL 19.45 11.70 Total urine 40 mL 39.35 29.70

[0163] Result discussion: To ensure that the DNA samples for PCR detection contain a higher concentration of HPV virus and improve the sensitivity of urine HPV detection, in this example, the method for separating DNA from urine samples was improved. By means of magnetic bead purification in combination with an adsorption column, and the formulation of the lysis solution was adjusted specifically, including adjusting the concentrations of the cell digestion solution, proteinase K, and the digestion time, as well as the formulation and washing method of the washing solution, etc. While avoiding PCR inhibitory components, the extraction amount of DNA in urine was effectively increased. Using the extraction protocol provided by the present invention, a DNA solution with a concentration of nearly 40 ng / μL can be extracted from 40 mL of whole urine samples, which is 32% higher than that of the existing technology ZYMO. Therefore, it helps the primer / probe composition provided by the present invention to accurately and effectively detect a total of 15 HPV types including HPV type 53 and genotype HPV16 / 18 through one-tube multiplex PCR reaction in urine with low HPV content, and has an extremely low detection limit in urine samples.

[0164] Example 2: Composition for detecting HPV genotypes

[0165] The present invention designed multiple pairs of probe primer combinations for each HPV type respectively. These combinations have good detection effects for individual types. However, in the final reaction system of the present invention, all the probe primers for 15 types plus the internal reference ACT are subjected to PCR reaction in the same tube. Unpredictable non-specific reactions may occur among numerous probe primers. Therefore, different probe primers need to be debugged and screened to find out the 13 + 2 combinations that meet the requirements. The probe primer combinations that meet the requirements need to satisfy two points: First, all 15 types can be detected normally and the signal intensity is good; Second, the no-template control (NTC) must have no non-specific amplification signal. Three sets of compositions for detecting HPV genotypes were screened out in this example. The details of the three sets of compositions are shown in Table 6, and the specific sequences of each probe or primer are shown in Table 1.

[0166] Table 6. Three sets of compositions

[0167] Type Combination 1 Combination 2 Combination 3 Type Combination 1 Combination 2 Combination 3 16 HPV16-P1 HPV16-P2 HPV16-P1 52 HPV52-P2 HPV52-P1 HPV52-P2 16 HPV16-F2 HPV16-F3 HPV16-F3 52 HPV52-F4 HPV52-F1 HPV52-F4 16 HPV16-R3 HPV16-R3 HPV16-R3 52 HPV52-R2 HPV52-R1 HPV52-R1 18 HPV18-P1 HPV18-P3 HPV18-P2 53 HPV53-P1 HPV53-P1 HPV53-P2 18 HPV18-F1 HPV18-F1 HPV18-F2 53 HPV53-F1 HPV53-F1 HPV53-F2 18 HPV18-R1 HPV18-R1 HPV18-R2 53 HPV53-R1 HPV53-R1 HPV53-R2 31 HPV31-P1 HPV31-P1 HPV31-P1 56 HPV56-P1 HPV56-P1 HPV56-P1 31 HPV31-F1 HPV31-F2 HPV31-F2 56 HPV56-F1 HPV56-F2 HPV56-F1 31 HPV31-R1 HPV31-R1 HPV31-R2 56 HPV56-R1 HPV56-R2 HPV56-R1 33 HPV33-P1 HPV33-P1 HPV33-P1 58 HPV58-P1 HPV58-P1 HPV58-P2 33 HPV33-F1 HPV33-F2 HPV33-F1 58 HPV58-F1 HPV58-F1 HPV58-F2 33 HPV33-R1 HPV33-R2 HPV33-R2 58 HPV58-R1 HPV58-R1 HPV58-R2 35 HPV35-P1 HPV35-P1 HPV35-P1 59 HPV59-P2 HPV59-P2 HPV59-P1 35 HPV35-F1 HPV35-F1 HPV35-F2 59 HPV59-F1 HPV59-F2 HPV59-F1 35 HPV35-R1 HPV35-R1 HPV35-R1 59 HPV59-R1 HPV59-R2 HPV59-R1 39 HPV39-P3 HPV39-P2 HPV39-P3 66 HPV66-P1 HPV66-P1 HPV66-P1 39 HPV39-F3 HPV39-F3 HPV39-F1 66 HPV66-F1 HPV66-F1 HPV66-F1 39 HPV39-R1 HPV39-R1 HPV39-R1 66 HPV66-R1 HPV66-R1 HPV66-R1 45 HPV45-P3 HPV45-P3 HPV45-P3 68 HPV68-P3 HPV68-P3 HPV68-P1 45 HPV45-F2 HPV45-F2 HPV45-F1 68 HPV68-F1 HPV68-F2 HPV68-F1 45 HPV45-R1 HPV45-R1 HPV45-R2 68 HPV68-R1 HPV68-R2 HPV68-R3 51 HPV51-P1 HPV51-P1 HPV51-P2 51 HPV51-F1 HPV51-F1 HPV51-F2 51 HPV51-R1 HPV51-R1 HPV51-R1

[0168] Among them, in each group of compositions, the fluorescent reporter group of the HPV 16 probe is VIC, the fluorescent reporter group of the HPV 18 probe is ROX, the fluorescent reporter groups of the remaining HPV probes are FAM, and the fluorescent reporter group of the internal reference ACTB probe is Cy5; the fluorescent quenching groups of the HPV 16 and HPV 52 probes are BHQ1, the fluorescent quenching group of the HPV 18 probe is BHQ2, the fluorescent quenching groups of the remaining HPV probes are MGB, and the fluorescent quenching group of the internal reference ACTB probe is BHQ3. Each group of compositions also includes an internal reference ACTB probe shown in SEQ ID NO. 101, an upstream primer of the internal reference ACTB shown in SEQ ID NO. 102, and a downstream primer of the internal reference ACTB shown in SEQ ID NO. 103.

[0169] Using the above three combinations, co-tube reaction amplification (2 parallels for each type) and template-free amplification (8 parallel reactions) were performed on all types. The amplification results of all types and the template-free amplification results of combination 1 are shown in Figure 1 and Figure 2 , the amplification results of all types and the template-free amplification results of combination 2 are shown in Figure 3 and Figure 4 , the amplification results of all types and the template-free amplification results of combination 3 are shown in Figure 5 and Figure 6 . According to the results, it can be seen that combinations 1 / 2 / 3 can all normally detect 15 types with good signal intensity, and there is no non-specific amplification signal in the template-free control (NTC), so it meets the requirements of the probe primer combination.

[0170] Example 3: Detection limit LOD test of HPV standard

[0171] The present invention needs to detect all 15 types of 13+2 by co-tube reaction through multiplex PCR. This requires studying the detection sensitivity of each type among the 15 types for different combinations to ensure that no type among the 15 types is missed in real clinical detection. In Example 2, probe primer combinations 1 to 3 that can meet multiplex PCR were screened out. Although each combination can detect all 15 types of HPV, there will inevitably be interference among the numerous probe primers, resulting in a decrease in detection sensitivity. To solve this problem, in Example 3, the detection limit (LOD) tests were also performed on the 3 sets of combinations screened in Example 2 respectively, and the LOD of each combination for 15 types of HPV was studied.

[0172] Standard products of 15 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) were serially diluted to prepare low-concentration HPV standard products. The concentrations were 2.5 copies / μL, 5 copies / μL, 7.5 copies / μL, 10 copies / μL, 12.5 copies / μL, 15 copies / μL, 17.5 copies / μL, 20 copies / μL, 22.5 copies / μL, 25 copies / μL respectively. 4 μL of template was added to each reaction, and the total number of copies in each reaction was: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100. The prepared low-concentration HPV standard products were subjected to fluorescence quantitative PCR using three sets of compositions provided in Example 2. The PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. Among them, since the probes HPV33-P1, HPV35-P1, HPV58-P1 are the same as HPV31-P1, HPV56-P1, HPV66-P1 are the same as HPV45-P3, and HPV68-P3, HPV59-P2 are the same as HPV39-P3, only 9 different probes need to be added.

[0173] Table 7. PCR reaction system

[0174] Component Dosage Add 0.05 μL to each 100 μM probe Subtotal 0.45 μL Add 0.1 μL to each 100 μM primer Subtotal 3.2 μL PCRMIX 12.5 μL <![CDATA[ddH2O]]> 4.85 μL DNA solution 4 μL Total 25 μL

[0175] Table 8. PCR reaction procedure

[0176] Temperature, time Cycles 95℃, 5 min / (94℃, 20 s), (63℃, 60 s) 5 cycles, with a 1℃ decrease for each cycle (94℃, 20 s), (58℃, 60 s) 40 cycles

[0177] For each type, 10 parallels were detected to calculate the CV value. The CV < 5% was used as the qualified standard. The minimum number of template copies when the CV of each type was < 5% was the LOD value of this type. The LOD of each type in each set of compositions was recorded, and the results are shown in Table 9.

[0178] Table 9. LOD test for the lower limit of detection of HPV standard products

[0179] Type First group (copies) Second group (copies) Third group (copies) Type First group (copies) Second group (copies) Third group (copies) 16 30 30 60 52 30 60 80 18 10 20 40 53 30 40 20 31 30 80 30 56 30 30 60 33 20 50 20 58 20 80 30 35 20 20 30 59 10 20 10 39 20 70 20 66 10 30 40 45 20 50 30 68 20 50 40 51 20 60 30

[0180] According to the LOD results of the 3 sets of combinations, the LOD of most types in the first set of combinations was the lowest, and the LOD of a few types (such as HPV53) was lower than that of other combinations. After comprehensive comparison, combination 1 was selected as the preferred primer / probe combination of the present invention.

[0181] Example 4: Detection of urine-simulated clinical samples

[0182] A total of 3000 ml of female urine was collected, with each urine sample being 40 ml, for a total of 15 samples. 80,000 copies of the standard products of 15 HPV types (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68) were respectively added to each urine sample. The optimized extraction protocol provided in Example 1 of the present invention was used to extract the DNA to be tested from the urine samples, and the combination 1 provided in Example 3 was used to perform fluorescence quantitative PCR on the obtained DNA solution. The PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. The results are shown in Figure 7 , indicating that by using the urine DNA extraction protocol provided by the present invention in combination with the primer / probe combination 1 provided by the present invention, a total of 15 HPV types including HPV type 53 can be accurately and effectively detected in urine with a low HPV content.

[0183] Example 5: Detection limit LOD test of HPV in urine

[0184] According to existing research results and literature reports, the biggest defect in detecting HPV in urine samples is that the viral load is too low. Compared with traditional cervical swabs, the viral load may be only one-tenth or even one-hundredth of it, which is the fundamental reason for the low sensitivity of detecting HPV in urine samples. To solve this problem, optimization and improvement must be carried out from two aspects: on the one hand, develop a better urine extraction technology to ensure that more nucleic acids can be extracted from urine; on the other hand, improve the detection sensitivity of the HPV kit PCR to ensure that HPV infection can be detected even at a lower HPV viral load. The present invention optimizes from the aspects of urine extraction and PCR sensitivity. In Example 1, an extraction method that can extract 40 mL of whole urine was developed, and in Example 3, a set of highly sensitive probe primer combinations was optimized and screened.

[0185] Using the extraction method of Example 1 of the present invention and the probe primer combination 1 screened in Example 3, the lower limit of detecting HPV in urine samples by this kit was studied. Different concentration gradients of 15 HPV type standard products were added to 40 mL of urine, and the added amount of the HPV standard products was 100 copies - 1600 copies, and the concentration range after dilution into urine was: 2.5 copies / mL - 40 copies / mL. The optimized extraction method in Example 1 of the present invention was used, and the urine was processed according to the method for extracting the DNA to be tested from urine samples provided in Example 1, and the preferred combination 1 in Example 3 was used to perform fluorescence quantitative PCR on the DNA solution in the obtained urine. The PCR reaction system is shown in Table 7, and the PCR reaction procedure is shown in Table 8. 10 parallel PCRs were performed for each concentration, the CV value was calculated, and CV < 5% was used as the qualified standard. The lowest concentration when CV < 5% for each type was the detection lower limit of that type in urine, and the results are shown in Table 10.

[0186] Table 10. Detection Limit LOD Test of HPV Standard in Urine

[0187] Type Concentration (copies / mL) CT CV% 16 2.5 31.02 33.05 30.82 32.14 40 29.82 31.54 31.73 34.14 34.09 8.31 16 5 30.26 29.82 31.05 29.64 32.31 31.37 30.99 31.18 31.24 30.11 2.54 16 7.5 30.42 31.27 30.95 30.13 30.21 33.13 30.33 30.51 31.74 30.51 2.85 18 2.5 31.46 35.46 34.42 34.37 32.68 31.21 30.96 38.3 35.92 31.36 7 18 5 32.7 30.61 32.92 31.61 33.32 31.3 31.81 31.26 31.99 30.05 3.06 18 7.5 30.43 34.32 30.54 30.69 31.99 32.46 30.85 32.12 33.3 31.37 3.85 31 10 28.03 27.15 27.14 27.67 37.09 26.88 27.03 26.85 27.71 27.06 10.5 31 20 28.8 26.57 26.38 26.53 26.48 27.22 26.29 26.34 26.84 26.34 2.71 31 40 27.19 27.04 26.08 25.7 25.96 25.86 25.91 25.87 25.6 25.86 1.99 33 10 38.28 39.14 38.73 38.51 32.26 33.2 38.53 32.67 33.14 32.15 8.41 33 20 39.22 32.06 32.45 31.77 32.57 31.63 31.79 31.28 33.25 33.22 6.55 33 40 30.41 30.2 30.3 30.9 31.22 30.58 30.4 31.01 30.25 29.54 1.49 35 10 45 38.36 26.98 29.21 29.11 29.65 29.05 29.69 28.6 28.26 17.22 35 20 28.3 45 45 28.51 28.61 29.09 28.65 28.36 28.63 28.46 20.63 35 40 27.31 26.87 26.47 26.35 26.84 26.62 26.81 26.59 27.23 26.76 1.08 39 7.5 31.49 31.54 30.32 29.71 29.25 30.02 40 29.64 28.74 29.7 10 39 10 33.97 29.53 30.37 28.99 29.74 29.25 28.81 29.3 29.3 29 4.84 39 15 30.19 31.05 29.94 29.17 30.06 30.12 29.08 28.38 29.45 28.77 2.55 45 5 29.44 31.91 30.5 32.15 29.78 29.44 29.79 31.49 33.23 29.84 4.14 45 10 29.08 29.88 30.42 29.91 30.54 31.03 30.22 29.63 28.51 26.47 4.2 45 15 29.85 31.01 29.26 29.14 29.32 28.94 29.24 29.63 31.36 28.93 2.72 51 5 33.69 30.98 30.71 30.12 30.13 29.56 40 30.7 39.64 29.12 11.87 51 10 30.02 30.01 28.38 28.09 28.14 28.83 29.37 27.21 28.73 29.17 2.92 51 20 28.01 29.01 28.62 28.28 27.69 28.03 27.13 27.96 27.94 27.21 1.94 52 10 38.37 38.91 38.16 32.45 32.52 32.75 32.53 38.1 32.37 32.49 8.27 52 20 32.23 38.17 31 31.47 31.78 31.2 31.94 32.31 39.46 31.72 8.71 52 40 32.17 29.24 29.88 30.21 29.45 31.37 29.63 28.1 32.36 29.18 4.36 53 10 40 39.42 40 31.21 38.84 31.3 29.3 29.35 29.47 29.88 13.87 53 20 40 33.35 38.54 28.8 28.83 29.26 28.84 28.62 28.07 28.02 13.7 53 40 30.92 28.72 28.81 27.62 28.35 28.83 28.29 27.27 27.3 28.04 3.53 56 20 27.46 27.68 28.82 28.45 28.74 31.71 29.04 27.72 28.39 27.82 4.07 56 40 26.94 28.48 29.37 27.81 27.13 27.08 27.11 27.26 26.92 26.95 2.82 56 80 28.59 27.83 26.97 26.31 27.22 26.92 26.91 27.09 26.51 26.55 2.37 58 5 40 40 31.25 31.38 30.28 30.02 30.61 29.16 31 31.48 11.69 58 10 32.92 30.5 30.37 30.26 29.93 29.51 29.93 29.19 29.98 29.01 3.42 58 20 31.49 30.77 30.8 29.54 29.18 30.69 30.16 30.45 29.01 31.76 2.88 66 7.5 26.72 27.66 26.98 26.52 27.13 27.66 27.25 29.67 29.32 27.33 3.62 66 10 26.47 29.96 28.74 28.41 26.79 26.91 26.65 26.62 27.11 27.2 4 66 20 26.44 26.42 26.38 26.32 26.5 26.06 26.42 26.35 25.94 26.54 0.69 68 10 32.18 37.6 29.44 30.24 29.56 29.88 29.26 29.23 29.57 29.12 8.1 68 20 31.99 27.37 27.18 27.18 27.52 26.91 27.6 27.15 27.05 25.56 5.72 68 40 27.11 26.67 26.72 26.45 26.61 26.39 26.48 26.5 26.66 26.54 0.73

[0188] Based on the above results, the detection limits of the urine extraction protocol and the HPV13+2 detection system of the present invention for urine HPV are respectively:

[0189] HPV16: 5 copies / mL; HPV18: 5 copies / mL; HPV31: 20 copies / mL; HPV33: 40 copies / mL; HPV35: 40 copies / mL; HPV39: 10 copies / mL; HPV45: 5 copies / mL; HPV51: 10 copies / mL; HPV52: 40 copies / mL; HPV53: 40 copies / mL; HPV56: 20 copies / mL; HPV58: 10 copies / mL; HPV59: 10 copies / mL; HPV66: 7.5 copies / mL; HPV68: 10 copies / mL.

[0190] The above-described embodiments are merely descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope of the present invention.

Claims

1. A composition for detecting and / or identifying HPV genotypes, characterized in that: include: An HPV 16 type probe having a base sequence as shown in SEQ ID NO. 1, an HPV 16 type upstream primer as shown in SEQ ID NO. 4, and an HPV 16 type downstream primer as shown in SEQ ID NO. 8; An HPV 18 probe having a base sequence as shown in SEQ ID NO. 9, an HPV 18 upstream primer as shown in SEQ ID NO. 11, and an HPV 18 downstream primer as shown in SEQ ID NO. 13; An HPV 31 type probe having a base sequence as shown in SEQ ID NO. 15, an HPV 31 type upstream primer as shown in SEQ ID NO. 17, and an HPV 31 type downstream primer as shown in SEQ ID NO. 19; An HPV 33 type probe having a base sequence as shown in SEQ ID NO. 21, an HPV 33 type upstream primer as shown in SEQ ID NO. 23, and an HPV 33 type downstream primer as shown in SEQ ID NO. 25; An HPV 35 type probe having a base sequence as shown in SEQ ID NO. 27, an HPV 35 type upstream primer as shown in SEQ ID NO. 29, and an HPV 35 type downstream primer as shown in SEQ ID NO. 31; An HPV 39 type probe having a base sequence as shown in SEQ ID NO. 35, an HPV 39 type upstream primer as shown in SEQ ID NO. 38, and an HPV 39 type downstream primer as shown in SEQ ID NO. 39; An HPV 45 type probe having a base sequence as shown in SEQ ID NO. 43, an HPV 45 type upstream primer as shown in SEQ ID NO. 45, and an HPV 45 type downstream primer as shown in SEQ ID NO. 48; An HPV 51 type probe having a base sequence as shown in SEQ ID NO. 51, an HPV 51 type upstream primer as shown in SEQ ID NO. 53, and an HPV 51 type downstream primer as shown in SEQ ID NO. 55; An HPV 52 type probe having a base sequence as shown in SEQ ID NO. 58, an HPV 52 type upstream primer as shown in SEQ ID NO. 62, and an HPV 52 type downstream primer as shown in SEQ ID NO. 64; An HPV 53 type probe having a base sequence as shown in SEQ ID NO. 66, an HPV 53 type upstream primer as shown in SEQ ID NO. 68, and an HPV 53 type downstream primer as shown in SEQ ID NO. 70; An HPV 56 type probe having a base sequence as shown in SEQ ID NO. 72, an HPV 56 type upstream primer as shown in SEQ ID NO. 73, and an HPV 56 type downstream primer as shown in SEQ ID NO. 74; An HPV 58 type probe having a base sequence as shown in SEQ ID NO. 75, an HPV 58 type upstream primer as shown in SEQ ID NO. 77, and an HPV 58 type downstream primer as shown in SEQ ID NO. 79; An HPV 59 type probe having a base sequence as shown in SEQ ID NO. 82, an HPV 59 type upstream primer as shown in SEQ ID NO. 84, and an HPV 59 type downstream primer as shown in SEQ ID NO. 86; An HPV 66 type probe having a base sequence as shown in SEQ ID NO. 88, an HPV 66 type upstream primer as shown in SEQ ID NO. 89, and an HPV 66 type downstream primer as shown in SEQ ID NO. 90; The base sequence of the HPV 68 type probe is shown in SEQ ID NO. 93, the HPV 68 type upstream primer is shown in SEQ ID NO. 95, and the HPV 68 type downstream primer is shown in SEQ ID NO. 98; The two ends of the base sequence of the probe are connected to a fluorescent reporter group and a fluorescent quencher group respectively; wherein the fluorescent reporter groups of the HPV 16 probe and the HPV 18 probe are different, and the fluorescent reporter groups of the HPV 16 probe and the HPV 18 probe are also different from those of the other HPV probes; The composition is based on urine as a sample.

2. The composition according to claim 1, characterized in that The composition further comprises: The base sequence is an internal reference ACTB probe as shown in SEQ ID NO. 101, an internal reference ACTB upstream primer as shown in SEQ ID NO. 102, and an internal reference ACTB downstream primer as shown in SEQ ID NO. 103; Among them, the fluorescent reporter group of the internal reference ACTB probe is different from that of the HPV probe.

3. The composition according to any one of claims 1 or 2, characterized in that The fluorescent reporter group is selected from FAM, TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, OregonGreenTM, CALRedTM, Red640, Texas Red, LighterCycler ® Cyan500, LighterCycler ® , Red610, biotin-binding materials, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid, tetramethylrhodamine, tetramethylrhodamine isocyanate, fluorescein isocyanate, χ-rhodamine; The fluorescence quenching group is selected from DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa Black FQ, Iowa BlackRQ, BHQ1, BHQ2, BHQ3, QSY7, QSY9, and QSY21.

4. The composition according to claim 2, characterized in that The fluorescent reporter group of the HPV 16 probe is VIC, the fluorescent reporter group of the HPV 18 probe is ROX, the fluorescent reporter groups of the other HPV probes are FAM, and the fluorescent reporter group of the internal reference ACTB probe is Cy5; And / or, the fluorescence quenching group of the HPV 16 and HPV 52 probes is BHQ1, the fluorescence quenching group of the HPV 18 probe is BHQ2, the fluorescence quenching group of the remaining HPV probes is MGB, and the fluorescence quenching group of the internal reference ACTB probe is BHQ3.

5. Use of the composition according to any one of claims 1 to 4 in the preparation of a kit for detecting and / or identifying HPV genotypes.

6. A kit for detecting and / or identifying HPV genotypes, characterized in that: The kit comprises the composition according to any one of claims 1 to 4.

7. The kit according to claim 6, characterized in that The kit also includes reagents for isolating DNA from a urine sample; The urine sample is selected from a whole urine sample or a urine supernatant sample; The reagent includes at least one of a lysate, a urine cell digestion solution, and a proteinase K; The lysis buffer includes: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mM Tris, 1%-12% Triton, and 0.5%-2% SDS; The urine cell digestion solution includes: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6; The concentration of the proteinase K is 20-50 mg / mL.

8. A method for detecting and / or identifying HPV genotypes in vitro for non-diagnostic purposes, characterized in that: The method comprises the following steps: Step 1: Extract DNA from the sample to be tested; Step 2: using the composition according to any one of claims 1 to 4 or the kit according to any one of claims 6 to 7 to perform fluorescent quantitative PCR on the DNA obtained in step 1; Step 3: Obtain and analyze the results; The sample is selected from a urine sample.

9. The method according to claim 8, characterized in that The sample is a urine sample; The urine sample is selected from a whole urine sample or a urine supernatant sample; The step one comprises: Purification beads were added to the urine sample, vortexed, centrifuged, and the cell pellet was collected; After the cell pellet was mixed with urine cell digestion solution, 20-50 mg / mL proteinase K was added and incubated at 55°C for 0.5-1 h, vortexed, and incubated; After adding lysis solution and ethanol to the incubation system, the adsorption column is passed through, and the adsorption column after the addition of the sample is washed 3 to 4 times with a washing solution and centrifuged, and the washed adsorption column is eluted with water, and the solution containing DNA is collected after centrifugation; The lysis solution includes: 2-5 M guanidine isothioate, 10-100 mM EDTA, 10-100 mM Tris, 1%-12% Triton, and 0.5%-2% SDS; The urine cell digestion solution includes: 100-150 mM EDTA, 3%-8% Triton, pH 5.5-6; The concentration of the proteinase K is 20-50 mg / mL.

Images