RNAi agents for inhibiting superoxide dismutase 1 (SOD1) expression, compositions and methods of use thereof

Abstract

RNAi agents, compositions comprising RNAi agents, and methods for inhibiting the superoxide dismutase 1 (SOD1) gene are described. The SOD1 RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of the SOD1 gene. Also described are pharmaceutical compositions comprising one or more SOD1RNAi agents, optionally with one or more additional therapeutic agents. Delivery of the described SOD1RNAi agents to the central nervous system (CNS) tissue in vivo provides inhibition of SOD1 gene expression and reduction of SOD1 activity, which can provide therapeutic benefits to subjects, including human subjects, for the treatment of various diseases, including amyotrophic lateral sclerosis (ALS).

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Patent Application Serial No. 63 / 495,517 filed on April 11, 2023 and U.S. Provisional Patent Application Serial No. 63 / 352,454 filed on June 15, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing submitted in XML format and is hereby incorporated by reference in its entirety. The XML copy is named 30699-WO_SEQLIST.xml, created on June 13, 2023 and is 6499kb in size. Technical Field

[0005] The present disclosure relates to RNA interference (RNAi) agents, such as double-stranded RNAi agents, such as chemically modified small interfering RNA (siRNA), for inhibiting superoxide dismutase 1 ("SOD1") gene expression, compositions comprising SOD1 RNAi agents, and methods of using the same. Background Art

[0006] Superoxide dismutase 1 (SOD1) is a member of the superoxide dismutase family of free radical scavenging enzymes, which resists oxygen free radical species produced during cell metabolism. All mammals have 3 isoforms of superoxide dismutase: Cu / ZnSOD (SOD1), mitochondrial MnSOD (SOD2) and extracellular Cu / ZnSOD (SOD3). SOD1 is a highly abundant, ubiquitously expressed and dominant dismutase in the cytoplasm, and contributes to most of the cellular SOD activity (JD Crapo et al., Copper, zinc superoxide dismutase is primarily a cytosolic protein in human cells. Proc Natl Acad Sci US A. 1992; 89 (21): 10405-9). The 153 amino acid SOD1 protein functions as a homodimer that binds copper and zinc and catalyzes the conversion of superoxide radicals to hydrogen peroxide and oxygen in two asymmetric steps using the essential copper atom in the active site of the enzyme (JD Rothstein, TDP-43 in amyotrophic lateral sclerosis: pathophysiology or patho-babel? Ann Neurol. 2007; 61(5):382-4.).In addition to being an antioxidant enzyme, human SOD1 protein has been reported to activate nuclear gene transcription after exposure to oxidative stress (CK Tsang et al., Superoxide dismutase 1acts as a nuclear transcription factor to regulate oxidative stress resistance. Nat Commun. 2014; 5: 3446.), involve the regulation of RNA metabolism (Z. Butti & SA Patten, RNA Dysregulation in Amyotrophic Lateral Sclerosis. Front Genet. 2018; 9: 712.; L Lu et al., Mutant Cu / Zn-superoxide dismutaseassociated with amyotrophic lateral sclerosis destabilizes vascular endothelial growth factor mRNA and downregulates its expression. J Neurosci. 2007; 27(30): 7929-38.), and regulate glucose sensing pathways to inhibit respiration (AR Reddi & VC Culotta, SOD1 integrates signals from oxygen and glucose to repressrespiration. Cell. 2013; 152(1-2): 224-35.). In 1993, Rosen et al. identified SOD1 mutations associated with fatal adult-onset neurodegenerative cases of familial amyotrophic lateral sclerosis (fALS) (DR Rosen et al., Mutations in Cu / Zn superoxide dismutase gene are associated with familialamyotrophic lateral sclerosis. Nature. 1993; 362(6415): 59-62.).

[0007] Amyotrophic lateral sclerosis (ALS) is a fatal motor neuron disease that causes progressive degeneration of upper and lower motor neurons in the primary motor cortex, brainstem, and spinal cord (A. Chio et al., Global epidemiology of amyotrophic lateral sclerosis: a systematic review of the published literature. Neuroepidemiology. 2013; 41(2): 118-30.; O. Hardiman et al., Amyotrophic lateral sclerosis. Nat Rev Dis Primers. 2017; 3: 17071.; N. Nowicka et al., Risk Factors and Emerging Therapies in Amyotrophic Lateral Sclerosis. Int J Mol Sci. 2019; 20(11).). Degeneration and loss of motor neurons causes progressive weakness and atrophy of skeletal muscle, which usually progresses to paralysis and death within 3 to 5 years (Hardiman 2017). Currently, therapies available for ALS show only modest efficacy with limited improvements in outcomes. Approximately 15% to 20% of fALS may be associated with genetic factors and have a slightly younger age of onset (47-53 years) compared to sporadic ALS cases, for which the median age of onset ranges from 58 to 63 years. Of genetically defined ALS cases, approximately 15% are associated with dominant inherited mutations in the SOD1 gene, and to date, more than 180 SOD1 genetic variants have been identified in patients with ALS (O. Abel et al., ALSoD: A user-friendly online bioinformatics tool for amyotrophic lateral sclerosis genetics. Hum Mutat. 2012; 33(9): 1345-51.; RAA van der Spek et al., The project MinEdatabrowser: bringing large-scale whole-genome sequencing in ALS to researchers and the public. Amyotroph Lateral Scler Frontotemporal Degener. 2019; 20(5-6): 432-40.).

[0008] Although the exact pathogenic mechanism of SOD1 mutation is still not fully understood, there is the following consensus: there is toxic gain of function, which leads to the toxicity induced by mutant SOD1 aggregation in neurons. The overexpression of mutant SOD1 in mice or rats reproduces important aspects of human ALS, including the loss of neuromuscular junction innervation and motor neuron death (LIBruijn & DW Cleveland, Mechanisms of selective motor neuron death in ALS: insights from transgenic mouse models of motor neuron disease. Neuropathol Appl Neurobiol. 1996; 22 (5): 373-87.; ME Gurney et al., Motor neuron degeneration in mice that express a human Cu, Zn superoxide dismutase mutation. Science. 1994; 264 (5166): 1772-5.). Although the loss of SOD1 leads to the ultimate motor neuron dysfunction, the loss of SOD1 does not lead to motor neuron death (PM Andersen et al., Phenotypic heterogeneity in motor neurondisease patients with CuZn-superoxide dismutase mutations in Scandinavia. Brain. 1997; 120 (Pt 10): 1723-37.; AG Reaume et al., Motor neurons in Cu / Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat Genet. 1996; 13 (1): 43-7.). In addition, although changes in enzyme activity levels were initially considered to be the main pathogenic mechanism, it was observed that the severity of the disease was not associated with the level of dismutase activity (Andersen 1997; DW Cleveland et al., Toxic mutants in Charcot's sclerosis. Nature. 1995; 378 (6555): 342-3.).In contrast, the major effects of SOD1 mutations in ALS are associated with protein aggregation and prion-like propagation of misfolded molecules (MBerdynski et al., SOD1 mutations associated with amyotrophic lateral sclerosis analysis of variant severity. Sci Rep. 2022; 12(1): 103.).

[0009] Given the toxic gain-of-function effects of SOD1, it is predicted that reducing the levels of SOD1 would be therapeutic in SOD1 ALS. Support for this hypothesis in SOD1 ALS patients is provided by the recently approved tofersen. Tofersen is an antisense oligonucleotide that causes SOD1 messenger RNA (mRNA) to be degraded. In a 28-week randomized VALOR Phase 3 trial, tofersen was associated with a reduction in the total concentration of SOD1 protein in the cerebrospinal fluid (CSF) and a reduction in the concentration of neurofilament light chain (NfL) protein in plasma. These results are interpreted as suggesting that reducing SOD1 mRNA may slow the underlying disease process. At 52 weeks, a combined analysis of VALOR and its open-label extension showed that participants who started tofersen at the start of VALOR had a smaller numerical decline in ALSFRS-R score, percent predicted slow vital capacity, and handheld ergometer composite score (megascore) compared with those who started tofersen in the open-label extension 28 weeks later (TMiller et al., Phase 1-2 Trial of Antisense Oligonucleotide Tofersen for SOD1 ALS. N Engl J Med. 2020; 383(2): 109-19.).

[0010] However, serious neurological adverse events (AEs) were reported in 7% of Tolvastatin recipients, and Tolvastatin's invasive dosing regimen of 3 biweekly doses followed by monthly doses all via intrathecal (IT) injections requiring lumbar puncture is further limited to its modest efficacy. Therefore, there remains a need for treatments that can safely and more effectively inhibit SOD1 gene expression in ALS patients. SUMMARY OF THE INVENTION

[0012] There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers or triggers), such as double-stranded RNAi agents such as siRNA, which can selectively and effectively inhibit the expression of SOD1 genes, including use as therapeutic agents or pharmaceutical uses. In addition, there is a need for compositions of novel SOD1-specific RNAi agents for treating diseases or disorders associated with mutant SOD1 gene expression and / or disorders that may be mediated at least in part by a decrease in SOD1 gene expression.

[0013] The nucleotide sequences and chemical modifications of the SOD1 RNAi agents disclosed herein and their combination with certain specific pharmacokinetic and pharmacodynamic (PK / PD) modulators are different from those previously disclosed or known in the art, and the modulators are suitable for selectively and effectively delivering the SOD1 RNAi agents to relevant CNS cells in vivo. The SOD1 RNAi agents disclosed herein provide highly potent and effective inhibition of the expression of the SOD1 gene.

[0014] In general, the disclosure features SOD1 gene-specific RNAi agents, compositions comprising SOD1 RNAi agents, and methods of inhibiting SOD1 gene expression in vitro and / or in vivo using SOD1 RNAi agents and compositions comprising SOD1 RNAi agents described herein. The SOD1 RNAi agents described herein are capable of selectively and effectively reducing the expression of the SOD1 gene, and thereby reducing the expression of the SOD1 enzyme.

[0015] The described SOD1 RNAi agents can be used in methods of therapeutic treatment (including preventative or prophylactic treatment) of conditions and diseases including, but not limited to, various central nervous system diseases and neurodegenerative diseases (including ALS and Alzheimer's disease).

[0016] In one aspect, the disclosure features an RNAi agent for inhibiting the expression of a SOD1 gene, wherein the RNAi agent comprises a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and the antisense strand may be partially, substantially, or completely complementary to each other. The length of the sense strands of the RNAi agents described herein may each be 15 to 49 nucleotides. The length of the antisense strands of the RNAi agents described herein may each be 18 to 49 nucleotides. In some embodiments, the length of the sense strand and the antisense strand are independently 18 to 26 nucleotides. The sense strand and the antisense strand may be the same length or different lengths. In some embodiments, the length of the sense strand and the antisense strand are independently 21 to 26 nucleotides. In some embodiments, the length of the sense strand and the antisense strand are independently 21 to 24 nucleotides. In some embodiments, the length of both the sense strand and the antisense strand is 21 nucleotides. In some embodiments, the length of the antisense strand is independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the length of the sense strand is independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. The RNAi agents described herein inhibit the expression of one or more SOD1 gene variants in vivo and / or in vitro after delivery to cells expressing SOD1, such as endothelial cells, neurons, microglia, and astrocytes.

[0017] The SOD1 RNAi agents disclosed herein target the human SOD1 gene (see, e.g., SEQ ID NO: 1). In some embodiments, the SOD1 RNAi agents disclosed herein target a portion of the SOD1 gene having a sequence of any of the sequences disclosed in Table 1.

[0018] In another aspect, the disclosure features compositions, including pharmaceutical compositions, comprising one or more disclosed SOD1 RNAi agents that can selectively and effectively reduce the expression of a SOD1 gene. Compositions comprising one or more SOD1 RNAi agents described herein can be administered to a subject, such as a human or animal subject, for treating (including prophylactic treatment or inhibition) symptoms and diseases associated with SOD1 protein or enzyme levels.

[0019] Examples of SOD1 RNAi agent sense and antisense strands that can be used in SOD1 RNAi agents are provided in Tables 3, 4, 5, and 6. Examples of SOD1 RNAi agent duplexes are provided in Tables 7A, 7B, 8, 9A, and 10. Examples of 19 nucleotide core segment sequences that can consist of or can be included in the sense and antisense strands of certain SOD1 RNAi agents disclosed herein are provided in Table 2.

[0020] In another aspect, the disclosure features methods for delivering SOD1 RNAi agents to neurons, astrocytes, microglia, and endothelial cells of subjects such as mammals in vivo. Compositions for such methods are also described herein. In some embodiments, methods for delivering SOD1 RNAi agents to central nervous system cells (neurons, astrocytes, microglia, and endothelial cells) of subjects in vivo are disclosed herein. In some embodiments, the subject is a human subject.

[0021] The methods disclosed herein include administering one or more SOD1 RNAi agents to a subject, such as a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more SOD1 RNAi agents can be administered in a variety of ways, depending on whether local or systemic treatment is required. Administration can be, for example, but not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subcutaneous (e.g., via an implant device), and intraparenchymal administration. In some embodiments, the pharmaceutical compositions described herein are administered by intrathecal injection or intraventricular injection.

[0022] In some embodiments, it is desirable that the SOD1 RNAi agents described herein inhibit expression of the SOD1 gene in cells of the central nervous system.

[0023] One or more SOD1 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, the SOD1 RNAi agent is delivered to cells or tissues by covalently linking the RNAi agent to a targeting group or lipid moiety.

[0024] The PK / PD regulator can be connected to the 3' or 5' end of the sense strand or antisense strand of the SOD1 RNAi agent. In some embodiments, the PK / PD regulator is connected to the 3' or 5' end of the sense strand. In some embodiments, the PK / PD regulator is connected to the 5' end of the sense strand. In some embodiments, the PK / PD regulator is internally connected to the nucleotides of the sense strand and / or antisense strand of the RNAi agent. In some embodiments, the PK / PD regulator is connected to the RNAi agent via a linker.

[0025] In another aspect, the disclosure features a composition comprising one or more SOD1 RNAi agents having a duplex structure disclosed in Tables 7A, 7B, 8, 9A, and 10.

[0026] The use of SOD1 RNAi agents provides a method for therapeutic (including preventive) treatment of a disease or condition for which a reduction in SOD1 protein levels can provide a therapeutic benefit. The SOD1 RNAi agents disclosed herein can be used to treat a variety of neurodegenerative diseases, including ALS and Alzheimer's disease. Such treatment methods include administering a SOD1 RNAi agent to a human or animal having an elevated or mutated SOD1 enzyme or SOD1 enzyme activity that exceeds a desired level.

[0027] definition

[0028] As used herein, the terms "oligonucleotide" and "polynucleotide" are intended to refer to a polymer of linked nucleosides, each of which independently may be modified or unmodified.

[0029] As used herein, "RNAi agent" (also referred to as "RNAi trigger") means a chemical composition of a substance containing RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecules, which can degrade or inhibit (e.g., degrade or inhibit under appropriate conditions) the translation of messenger RNA (mRNA) transcripts of target mRNA in a sequence-specific manner. As used herein, RNAi agents can act through RNA interference mechanisms (i.e., by inducing RNA interference through interaction with RNA interference pathway mechanisms of mammalian cells (RNA-induced silencing complex or RISC)) or through any alternative mechanism or approach. Although it is believed that RNAi agents, as the term is used herein, act primarily through RNA interference mechanisms, the disclosed RNAi agents are not subject to constraints or limitations of any particular pathway or mechanism of action. The RNAi agents disclosed herein include sense strands and antisense strands, and include, but are not limited to: small (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA) and dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., SOD1 mRNA). The RNAi agent can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0030] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene, mean that when a cell, cell population, tissue, organ, or subject is treated with a RNAi agent described herein, the expression of the gene is reduced as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from mRNA in the cell, cell population, tissue, organ, or subject in which the gene is transcribed, as compared to a second cell, cell population, tissue, organ, or subject that has not been so treated.

[0031] As used herein, the terms "sequence" and "nucleotide sequence" mean a series of nucleobases or nucleotides or an order of nucleobases or nucleotides described by consecutive letters using standard nomenclature.

[0032] As used herein, "base", "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the major purine bases adenine and guanine and the major pyrimidine bases cytosine, thymine and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, bases with enlarged size, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds comprising modified nucleobases) is known in the art.

[0033] As used herein and unless otherwise indicated, when used to describe a first nuclear base or nucleotide sequence (e.g., RNAi agent sense strand or target mRNA) with respect to a second nuclear base or nucleotide sequence (e.g., RNAi agent antisense strand or single-stranded antisense oligonucleotide), the term "complementary" means that an oligonucleotide or polynucleotide comprising a first nucleotide sequence hybridizes (forms base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions)) and forms a duplex or double helix structure under certain standard conditions with an oligonucleotide comprising a second nucleotide sequence. One of ordinary skill in the art can select the most appropriate condition group for hybridization testing. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, at least to the extent that the hybridization requirements above are met. Sequence identity or complementarity is independent of modification. For example, for purposes of determining identity or complementarity, a and Af as defined herein are complementary to U (or T) and identical to A.

[0034] As used herein, "perfect complementarity" or "complete complementarity" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, all bases (100%) in the continuous sequence of the first oligonucleotide will hybridize with the same number of bases in the continuous sequence of the second oligonucleotide. The continuous sequence may comprise all or part of the first or second nucleotide sequence.

[0035] As used herein, "partial complementarity" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 70% but not all of the bases in the continuous sequence of the first oligonucleotide will hybridize with the same number of bases in the continuous sequence of the second oligonucleotide. The continuous sequence may comprise all or part of the first or second nucleotide sequence.

[0036] As used herein, "substantially complementary" means that in a hybridization pair of nucleobase or nucleotide sequence molecules, at least 85% but not all of the bases in the contiguous sequence of the first oligonucleotide will hybridize to the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may comprise all or part of the first or second nucleotide sequence.

[0037] As used herein, the terms "complementary", "fully complementary", "partially complementary" and "substantially complementary" are used with respect to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent or between the antisense strand of an RNAi agent and a SOD1 mRNA sequence.

[0038] As used herein, the term "substantially identical" or "substantial identity", as applied to nucleic acid sequences, means that the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more identity, such as at least 90%, at least 95%, or at least 99% identity compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base appears in the two sequences to produce the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to produce the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences that are substantially identical to the nucleotide sequences disclosed herein.

[0039] As used herein, the terms "treat", "treatment", and the like mean methods or steps taken to provide relief or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" may include prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0040] As used herein, when referring to RNAi agents, the phrase "introduced into a cell" means that the RNAi agent is functionally delivered into the cell. The phrase "functional delivery" means that the RNAi agent is delivered into the cell in a manner that enables the RNAi agent to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0041] Unless otherwise specified, the symbols used in this document are The use of means that any group or groups may be attached thereto consistent with the scope of the invention described herein.

[0042] As used herein, the term "isomer" refers to compounds that have the same molecular formula but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed "stereoisomers". Stereoisomers that are not mirror images of one another are termed "diastereomers", and stereoisomers that are non-superimposable mirror images are termed "enantiomers" or sometimes optical isomers. A carbon atom bonded to four different substituents is termed a "chiral center".

[0043] As used herein, unless specifically identified as having a particular conformation in terms of structure, for various structures in which asymmetric centers exist and thus produce enantiomers, diastereomers or other stereoisomeric configurations, the various structures disclosed herein are intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers with single stereoisomers.

[0044] As used in the claims herein, the phrase "consisting of excludes any element, step, or ingredient not specified in the claim. When used in the claims herein, the phrase "consisting essentially of limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0045] Those of ordinary skill in the art will readily understand and appreciate that, depending on the environment in which the compound or composition is placed, the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state. Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups such as OH, SH, or NH may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions, regardless of their protonation state based on the environment (e.g., pH), as readily understood by those of ordinary skill in the art. Accordingly, the compounds described herein with unstable protons or basic atoms are also understood to represent the salt form of the corresponding compounds. The compounds described herein may be in free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein are understood to be within the scope of the present invention.

[0046] As used herein, when referring to a connection between two compounds or molecules, the term "connected" or "conjugated" means that the two compounds or molecules are connected by a covalent bond. Unless otherwise indicated, the terms "connected" and "conjugated" as used herein may refer to a connection between a first compound and a second compound with or without any intervening atoms or groups of atoms.

[0047] As used herein, the term "including" is used herein to mean and is used interchangeably with the phrase "including but not limited to". The term "or" is used herein to mean and is used interchangeably with the term "and / or", unless the context clearly dictates otherwise.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, the present specification including definitions shall prevail. In addition, materials, methods and examples are illustrative only and are not intended to be restrictive.

[0049] Other objects, features, aspects and advantages of the present invention will be apparent from the following detailed description, the accompanying drawings, and from the claims. Summary of the invention

[0050] RNAi Agents

[0051] RNAi agents (referred to herein as SOD1 RNAi agents or SOD1 RNAi triggering agents) for inhibiting SOD1 (or SOD1) gene expression are described herein. Various SOD1 RNAi agents disclosed herein include a sense strand and an antisense strand. The length of the sense strand can be 15 to 49 nucleotides. The length of the antisense strand can be 18 to 30 nucleotides. The sense strand and the antisense strand can be the same length or they can be different lengths. In some embodiments, the length of the sense strand and the antisense strand is each independently 18 to 27 nucleotides. In some embodiments, the length of both the sense strand and the antisense strand is each 21-26 nucleotides. In some embodiments, the length of the sense strand and the antisense strand is each 21-24 nucleotides. In some embodiments, the length of the sense strand and the antisense strand is each independently 19-21 nucleotides. In some embodiments, the length of the sense strand is about 19 nucleotides, and the length of the antisense strand is about 21 nucleotides. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the length of the sense strand of the RNAi agent is each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides. In some embodiments, the length of the antisense strand of the RNAi agent is each independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0052] Examples of nucleotide sequences for forming SOD1 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2, 3, 4, 5, 6 are shown in Tables 7A, 7B, 8, 9A, and 10.

[0053] In some embodiments, the region of perfect, substantial or partial complementarity between the sense and antisense strands is 16-26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially or partially complementary).

[0054] The sense strand of the SOD1 RNAi agent described herein comprises at least 15 consecutive nucleotides, which have at least 85% identity with a core segment sequence of the same number of nucleotides in the SOD1 mRNA (also referred to herein as a "core segment" or "core sequence"). In some embodiments, the sense strand core segment sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to the core segment sequence in the antisense strand, and thus the sense strand core segment sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length present in the SOD1 mRNA target (sometimes referred to as, for example, a target sequence). In some embodiments, the length of this sense strand core segment is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of this sense strand core segment is 17 nucleotides. In some embodiments, the length of this sense strand core segment is 19 nucleotides.

[0055] The antisense strand of the SOD1 RNAi agent described herein includes at least 16 consecutive nucleotides, which have at least 85% complementarity with a core segment of the same number of nucleotides in the SOD1 mRNA and with a core segment of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core segment is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length (e.g., a target sequence) present in the SOD1 mRNA target. In some embodiments, the length of this antisense strand core segment is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the length of this antisense strand core segment is 19 nucleotides. In some embodiments, the length of this antisense strand core segment is 17 nucleotides. The sense strand core segment sequence can have the same length as the corresponding antisense core sequence, or it can have a different length.

[0056] The sense strand and antisense strand of the SOD1 RNAi agent anneal to form a duplex. The sense strand and antisense strand of the SOD1 RNAi agent can be partially, substantially or completely complementary to each other. Within the complementary duplex region, the sense strand core segment sequence is at least 85% complementary or 100% complementary to the antisense core segment sequence. In some embodiments, the sense strand core segment sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core segment sequence (i.e., the sense and antisense core segment sequences of the SOD1 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base paired or 100% base paired.)

[0057] In some embodiments, the antisense strand of a SOD1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any antisense strand sequence in Table 2 or Table 3. In some embodiments, the sense strand of a SOD1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any sense strand sequence in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0058] In some embodiments, the sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5 or 6 nucleotides (extensions) at the 3' end, 5' end or both 3' and 5' ends of the core segment sequence. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the corresponding sequence in the SOD1 mRNA. The additional nucleotides of the sense strand (if present) may or may not be the same as the corresponding sequence in the SOD1 mRNA. The additional nucleotides of the antisense strand (if present) may or may not be complementary to the additional nucleotides of the corresponding sense strand (if present).

[0059] As used herein, an extension is included in 1, 2, 3, 4, 5 or 6 nucleotides at the 5' and / or 3' ends of the sense strand core segment sequence and / or the antisense strand core segment sequence. The extended nucleotides of the sense strand may or may not be complementary to the nucleotides that are core segment sequence nucleotides or extended nucleotides in the corresponding antisense strand. Conversely, the extended nucleotides of the antisense strand may or may not be complementary to the nucleotides that are core segment sequence nucleotides or extended nucleotides in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more 3' extended nucleotides of one strand are base paired with one or more 5' extended nucleotides of another strand. In other embodiments, one or more 3' extended nucleotides of one strand are base unpaired with one or more 5' extended nucleotides of another strand. In some embodiments, the SOD1 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotides are unpaired and form an overhang. As used herein, an "overhang" is a designation for a stretch of one or more unpaired nucleotides at the end of a sense strand or an antisense strand that does not form part of the hybridized or duplexed portion of a RNAi agent disclosed herein.

[0060] In some embodiments, the SOD1 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the SOD1 RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding SOD1 mRNA sequence. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding SOD1 mRNA sequence.

[0061] In some embodiments, the SOD1 RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4 or 5 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise adenosine, uracil or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the SOD1 mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of one of the following sequences, but is not limited to the following sequences: T, UT, TT, UU, UUT, TTT or TTTT (each listed from 5' to 3').

[0062] The sense strand may have a 3' extension and / or a 5' extension. In some embodiments, the SOD1 RNAi agent comprises a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more sense strand extension nucleotides comprise nucleotides corresponding to or identical to nucleotides in the SOD1 mRNA sequence.

[0063] Examples of sequences for forming SOD1 RNAi agents are provided in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, the SOD1 RNAi agent antisense strand comprises a sequence of any sequence in Tables 2, 3, or 10. In certain embodiments, the SOD1 RNAi agent antisense strand comprises or consists of any modified sequence in Table 3. In some embodiments, the SOD1 RNAi agent antisense strand comprises a nucleotide sequence (from 5' end v 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any sequence in Tables 2 or 3. In some embodiments, the SOD1 RNAi agent sense strand comprises a sequence of any sequence in Tables 2, 4, 5, or 6. In some embodiments, the sense strand of the SOD1 RNAi agent comprises a nucleotide sequence (from 5' end → 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21 or 4-21 of any sequence in Table 2, 4, 5 or 6. In certain embodiments, the sense strand of the SOD1 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 4, 5, 6 or 10.

[0064] In some embodiments, the sense strand and antisense strand of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense strand and antisense strand of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi agent form a flat end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi agent form a flat end. In some embodiments, both ends of the RNAi agent form a flat end. In some embodiments, both ends of the RNAi agent are not flat ends. As used herein, "flat end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed chains are complementary (forming complementary base pairs).

[0065] In some embodiments, the sense strand 5' end and the antisense strand 3' end of the RNAi agent form a frayed end. In some embodiments, the sense strand 3' end and the antisense strand 5' end of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, both ends of the RNAi agent are not frayed ends. As used herein, frayed ends refer to the ends of double-stranded RNAi agents in which the terminal nucleotides of the two annealed chains form a pair (i.e., not forming an overhang) but are not complementary (i.e., forming a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of a chain of a double-stranded RNAi agent form an overhang. Unpaired nucleotides can be located at the sense strand or the antisense strand, creating a 3' or 5' overhang. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and a 5' overhang, a blunt end and a 3' overhang, a frayed end and a 5' overhang, a frayed end and a 3' overhang, two 5' overhangs, two 3' overhangs, a 5' overhang and a 3' overhang, two frayed ends, or two blunt ends. Typically, when present, the overhang is located at the 3' end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0066] The SOD1 RNAi agent disclosed herein may also include one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand of the SOD1 RNAi agent and substantially all nucleotides of the antisense strand are modified nucleotides. The SOD1 RNAi agent disclosed herein may further include one or more modified internucleoside linkages, such as one or more phosphorothioate linkages. In some embodiments, the SOD1 RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2' modified nucleotides are combined with modified internucleoside linkages.

[0067] In some embodiments, the SOD1 RNAi agent is prepared or provided as a salt, a mixed salt or a free acid. In some embodiments, the SOD1 RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the SOD1 RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein.

[0068] Modified nucleotides

[0069] When used in various oligonucleotide constructs, the modified nucleotides can preserve the activity of the compounds in cells while increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans after administration of the oligonucleotide constructs.

[0070] In some embodiments, SOD1 RNAi agent contains one or more modified nucleotides. As used herein, "modified nucleotides" are nucleotides other than ribonucleotides (2'-hydroxy nucleotides). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%) of nucleotides are modified nucleotides. As used herein, modified nucleotides may include but are not limited to deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, reverse nucleotides, nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNA), 2', 3'-split ring nucleotide mimics (unlocking nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside connection) nucleotides, 2'-F-arabinose nucleotides, 5'-Me, 2'-fluoro nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, nucleotides containing vinylphosphonate and nucleotides containing cyclopropylphosphonate. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to herein or in the art as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein or in the art as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also referred to herein or in the art as 2'-MOE nucleotides), 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary that all positions in a given compound be uniformly modified. Rather, more than one modification may be incorporated into a single SOD1 RNAi agent or even into a single nucleotide thereof. The sense and antisense strands of the SOD1 RNAi agent may be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0071] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propargyluracil or 5-propargylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiouracil, thymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propargyluracil, 5-propargylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (e.g. 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0072] In some embodiments, the 5' and / or 3' end of the antisense strand may include an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide". An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Patent No. 5,998,203). In some embodiments, the abasic residue may be placed internally in the nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb or Ab are added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue may be replaced by a ribitol (abasic ribose) residue.

[0073] In some embodiments, all or substantially all nucleotides of RNAi agent are modified nucleotides.As used herein, the RNAi agent wherein all nucleotides present are modified nucleotides is the RNAi agent having four or less (i.e. 0,1,2,3 or 4) nucleotides as ribonucleotides (i.e. unmodified) in both sense strand and antisense strand.As used herein, the sense strand wherein all nucleotides present are modified nucleotides is the sense strand having two or less (i.e. 0,1 or 2) nucleotides as unmodified ribonucleotides in sense strand.As used herein, the antisense strand wherein all nucleotides present are modified nucleotides is the antisense strand having two or less (i.e. 0,1 or 2) nucleotides as unmodified ribonucleotides in antisense strand.In some embodiments, one or more nucleotides of RNAi agent are unmodified ribonucleotides.As shown in Table 11 herein about the chemical structure of some modified nucleotides.

[0074] Modified internucleoside linkages

[0075] In some embodiments, one or more nucleotides of a SOD1 RNAi agent are linked by a non-standard linkage or backbone (ie, a modified internucleoside linkage or a modified backbone). The modified internucleoside linkage or backbone includes, but is not limited to, a thiophosphate group (represented herein as lowercase "s"), a chiral thiophosphate, a thiophosphate, a dithiophosphate, a phosphotriester, an aminoalkylphosphotriester, an alkylphosphonate (e.g., a methylphosphonate or a 3'-alkylenephosphonate), a chiral phosphonate, a phosphinate, a phosphoramide (e.g., a 3'-aminophosphoramide, an aminoalkylphosphoramide, or a thiophosphoramide (thionophosphoramidate)), a thioalkylphosphonate (thionoalkyl-phosphonate), a thioalkylphosphotriester (thionoalkylphosphotriester), a morpholino linkage, a boranophosphate with a normal 3'-5' linkage, a boranophosphate analog with a 2'-5' linkage, or a boranophosphate with a reversed polarity, wherein consecutive nucleoside unit pairs are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. The internucleoside connection of the modification lacking phosphorus atom includes but is not limited to be connected between short-chain alkyl or cycloalkyl sugar, be connected between mixed heteroatoms and alkyl or cycloalkyl sugar or be connected between one or more short-chain heteroatoms or heterocyclic sugar.In some embodiments, the internucleoside skeleton of modification includes but is not limited to siloxane skeleton, sulfide skeleton, sulfoxide skeleton, sulfone skeleton, formyl acetyl and thioformyl acetyl skeleton, methylene formyl acetyl and thioformyl acetyl skeleton, contain olefin skeleton, aminosulfonate skeleton, methylene imino and methylene hydrazine skeleton, sulfonate and sulfonamide skeleton, amide skeleton and have N, O, S and CH2 other skeleton of mixed component.

[0076] In some embodiments, the sense strand of the SOD1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the SOD1 RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the SOD1 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the SOD1 RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0077] In some embodiments, the SOD1 RNAi agent sense strand contains at least two phosphorothioate nucleoside connections. In some embodiments, the phosphorothioate nucleoside is connected between the nucleotides at the position 1-3 from the 3' end of the sense strand. In some embodiments, a phosphorothioate nucleoside connection is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate connection is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate nucleoside connections are located at the 5' end of the sense strand, and another phosphorothioate connection is at the 3' end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate nucleoside connections between nucleotides, but contains one, two or three phosphorothioate connections between the terminal nucleotides of the 5' and 3' ends and the optionally present reverse abasic residue end cap. In some embodiments, the targeting ligand is connected to the sense strand via a phosphorothioate connection.

[0078] In some embodiments, the SOD1 RNAi agent antisense strand contains four phosphorothioate nucleoside interlinks. In some embodiments, four phosphorothioate nucleoside interlinks are connected between nucleotides at positions 1-3 from the 5' end of the antisense strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25 ​​or 24-26 from the 5' end. In some embodiments, three phosphorothioate nucleoside interlinks are located between positions 1-4 from the 5' end of the antisense strand, and the fourth phosphorothioate nucleoside interlink is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the SOD1 RNAi agent contains at least three or four phosphorothioate nucleoside interlinks in the antisense strand.

[0079] Capping residues or moieties

[0080] In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as "caps", "end caps" or "capping residues". As used herein, "capping residues" are non-nucleotide compounds or other moieties that can be incorporated at one or more ends of the nucleotide sequence of the RNAi agents disclosed herein. In some cases, capping residues can provide certain beneficial properties for the RNAi agent, such as, for example, protection from exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31 (11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues and carbon chains such as terminal C3H7 (propyl), C6H 13 (Hexyl) or C12 H 25 In some embodiments, the capping residue is present at the 5' end, the 3' end, or both the 5' and 3' ends of the sense strand. In some embodiments, the 5' end and / or the 3' end of the sense strand may include more than one inverted abasic deoxyribose moiety as a capping residue.

[0081] In some embodiments, one or more reverse abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more reverse abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more reverse abasic residues or reverse abasic sites are inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. In some embodiments, one or more reverse abasic residues or reverse abasic sites are included at or near one or more ends of the sense strand of the RNAi agent to allow the enhanced activity or other desired properties of the RNAi agent.

[0082] In some embodiments, one or more reverse abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more reverse abasic residues can be inserted between the nucleotide sequence of the sense strand of the targeting ligand and the RNAi agent. Reverse abasic residues can be connected via phosphate, thiophosphate (e.g., shown as (invAb)s herein) or other internucleoside connections. In some embodiments, one or more reverse abasic residues are included at or near one or more ends of the sense strand of the RNAi agent to allow the enhanced activity or other desired properties of the RNAi agent. In some embodiments, reverse abasic (deoxyribose) residues can be replaced by reverse ribitol (abasic ribose) residues. In some embodiments, the 3' end of the antisense strand core segment sequence or the 3' end of the antisense strand sequence can include reverse abasic residues. The chemical structure of the reverse abasic deoxyribose residue is shown in Table 11 below.

[0083] SOD1 RNAi Agents

[0084] The SOD1 RNAi agents disclosed herein are designed to target a specific position on the SOD1 gene (e.g., SEQ ID NO: 1 (NM_000454.5)). As defined herein, the antisense strand sequence is designed to target the SOD1 gene at a given position of the gene when the 5' terminal nucleobase of the antisense strand is aligned with a position 21 nucleotides downstream (towards the 3' end) of the given position of the gene when base-pairing with the gene. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target the SOD1 gene at position 304 requires that the 5' terminal nucleobase of the antisense strand be aligned with position 324 of the SOD1 gene when base-pairing with the gene.

[0085] As provided herein, SOD1 RNAi agents do not require that the nucleobase at position 1 (5'→3') of the antisense strand is complementary to the gene, provided that at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene spans a core segment sequence of at least 16 consecutive nucleotides. For example, for a SOD1 RNAi agent disclosed herein designed to target position 304 of a SOD1 gene, the 5' terminal nucleobase of the antisense strand of the SOD1 RNAi agent must be aligned with position 324 of the gene; however, the 5' terminal nucleobase of the antisense strand can (but is not required to) be complementary to position 324 of the SOD1 gene, provided that at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the gene transcript spans a core segment sequence of at least 16 consecutive nucleotides. As shown by various examples disclosed herein and other matters, the specific site of binding of a gene by the antisense strand of a SOD1 RNAi agent (e.g., whether the SOD1 RNAi agent is designed to target a SOD1 gene at position 304, at position 264, at position 785, or at some other position) is an important factor in the level of inhibition achieved by the SOD1 RNAi agent. (See, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0086] In some embodiments, the SOD1 RNAi agents disclosed herein target a SOD1 gene at or near the location of the SOD1 sequence shown in Table 1. In some embodiments, the antisense strand of the SOD1 RNAi agents disclosed herein comprises a core segment sequence that is completely, substantially, or at least partially complementary to the target SOD1 19-mer sequence disclosed in Table 1.

[0087] Table 1. SOD1 19-mer mRNA target sequence (taken from homo sapiens superoxide dismutase 1 (SOD1) transcript, GenBank NM_000454.5 (SEQ ID NO: 1))

[0088]

[0089]

[0090] Homo sapiens superoxide dismutase 1 (SOD1), GenBank NM_000454.5 (SEQ ID NO:1), gene transcript (895 bases):

[0091] 1 gcgtcgtagt ctcctgcagc gtctggggtt tccgttgcag tcctcggaac caggacctcg

[0092] 61 gcgtggccta gcgagttatg gcgacgaagg ccgtgtgcgt gctgaagggc gacggcccag

[0093] 121 tgcagggcat catcaatttc gagcagaagg aaagtaatgg accagtgaag gtgtggggaa

[0094] 181 gcattaaagg actgactgaa ggcctgcatg gattccatgt tcatgagttt ggagataata

[0095] 241 cagcaggctg taccagtgca ggtcctcact ttaatcctct atccagaaaa cacggtgggc

[0096] 301 caaaggatga agagaggcat gttggagact tgggcaatgt gactgctgac aaagatggtg

[0097] 361 tggccgatgt gtctattgaa gattctgtga tctcactctc aggagaccat tgcatcattg

[0098] 421 gccgcacact ggtggtccat gaaaaagcag atgacttggg caaaggtgga aatgaagaaa

[0099] 481 gtacaaagac aggaaacgct ggaagtcgtt tggcttgtgg tgtaattggg atcgcccaat

[0100] 541 aaacattccc ttggatgtag tctgaggccc cttaactcat ctgttatcct gctagctgta

[0101] 601 gaaatgtatc ctgataaaca ttaaacactg taatcttaaa agtgtaattg tgtgactttt

[0102] 661 tcagagttgc tttaaagtac ctgtagtgag aaactgattt atgatcactt ggaagatttg

[0103] 721 tatagtttta taaaactcag ttaaaatgtc tgtttcaatg acctgtattt tgccagactt

[0104] 781 aaatcacaga tgggtattaa acttgtcaga atttctttgt cattcaagcc tgtgaataaa

[0105] 841 aaccctgtat ggcacttatt atgaggctat taaaagaatc caaattcaaa ctaaa

[0106] In some embodiments, the SOD1 RNAi agent comprises an antisense strand, wherein position 19 (5'→3') of the antisense strand is capable of forming a base pair with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the SOD1 agent comprises an antisense strand, wherein position 1 (5'→3') of the antisense strand is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

[0107]

[0108] In some embodiments, the SOD1 agent comprises an antisense strand, wherein position 2 (5'→3') of the antisense strand is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the SOD1 agent comprises an antisense strand, wherein positions 2 to 18 (5'→3') of the antisense strand are capable of forming a base pair with respective complementary bases located at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1.

[0109] For the RNAi agents disclosed herein, the nucleotide at position 1 (from 5' end → 3' end) of the antisense strand may be perfectly complementary to the SOD1 gene or may not be complementary to the SOD1 gene. In some embodiments, the nucleotide at position 1 (from 5' end → 3' end) of the antisense strand is U, A or dT. In some embodiments, the nucleotide at position 1 (from 5' end → 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0110] In some embodiments, the SOD1 RNAi agent antisense strand comprises a sequence of nucleotides (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3. In some embodiments, the SOD1 RNAi sense strand comprises a sequence of nucleotides (from 5' end → 3' end) 1-17, 1-18 or 2-18 of any sense strand sequence in Table 2, Table 4, Table 5, Table 6 or Table 6a.

[0111] In some embodiments, the SOD1 RNAi agent comprises the following: (i) an antisense strand comprising a nucleotide sequence (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2 or Table 3, and (ii) a sense strand comprising a nucleotide sequence (from 5' end → 3' end) 1-17 or 1-18 of any sense strand sequence in Table 2, Table 4, Table 5, Table 6, or Table 6a.

[0112] In some embodiments, the SOD1 RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below.

[0113] Table 2. SOD1 RNAi agent antisense strand and sense strand core segment base sequence (N = any nucleobase; I = inosine (hypoxanthine nucleobase)

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126] The sense strand and antisense strand of the SOD1 RNAi agent comprising or consisting of the nucleotide sequence in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the SOD1 RNAi agent having the sense strand and antisense strand sequence comprising or consisting of any nucleotide sequence in Table 2 is all or substantially all modified nucleotides.

[0127] In some embodiments, the antisense strand of a SOD1 RNAi agent disclosed herein differs from any antisense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of a SOD1 RNAi agent disclosed herein differs from any sense strand sequence in Table 2 by 0, 1, 2, or 3 nucleotides.

[0128] As used herein, each N listed in the sequence disclosed in Table 2 can be independently selected from any and all core bases (including those found on both modified nucleotides and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases complementary to the N nucleotides at the corresponding positions on another chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases that are not complementary to the N nucleotides at the corresponding positions on another chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases identical to the N nucleotides at the corresponding positions on another chain. In some embodiments, the N nucleotides listed in the sequence disclosed in Table 2 have core bases different from the N nucleotides at the corresponding positions on another chain.

[0129] Certain modified SOD1 RNAi agent sense and antisense strands are provided in Table 3, Table 4, Table 5, Table 6, Table 6a and Table 10. Certain modified SOD1 RNAi agent antisense strands are provided in Table 3, and their basic unmodified nucleobase sequences. Certain modified SOD1 RNAi agent sense strands are provided in Tables 4, 5 and 6, and their basic unmodified nucleobase sequences. When forming SOD1 RNAi agents, each nucleotide in each basic base sequence listed in Tables 3, 4, 5 and 6 and Table 2 above can be a modified nucleotide.

[0130] The SOD1 RNAi agents described herein are formed by annealing the antisense strand to the sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, Table 6, Table 6a can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity within a continuous sequence of 16, 17, 18, 19, 20 or 21 nucleotides.

[0131] In some embodiments, the SOD1 RNAi agent antisense strand comprises a nucleotide sequence of any sequence in Table 2 or Table 3.

[0132] In some embodiments, the SOD1 RNAi agent comprises or consists of a duplex having the nucleobase sequence of the sense and antisense strands of any sequence in Table 2, Table 3, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0133] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Tables 4, 5, and 6.

[0134] As used in Tables 3, 4, 5, 6, 6a and 10, the following symbols are used to indicate modified nucleotides, targeting groups and linking groups:

[0135] A = adenosine-3'-phosphate

[0136] C = cytidine-3'-phosphate

[0137] G = guanosine-3'-phosphate

[0138] U = Uridine-3'-phosphate

[0139] I = inosine-3'-phosphate

[0140] a=2'-O-methyladenosine-3'-phosphate

[0141] as=2'-O-methyladenosine-3'-phosphorothioate

[0142] c = 2'-O-methylcytidine-3'-phosphate

[0143] cs = 2'-O-methylcytidine-3'-phosphorothioate

[0144] g = 2'-O-methylguanosine-3'-phosphate

[0145] gs = 2'-O-methylguanosine-3'-phosphorothioate

[0146] i = 2'-O-methylinosine-3'-phosphate

[0147] is=2'-O-methylinosine-3'-phosphorothioate

[0148] t=2'-O-methyl-5-methyluridine-3'-phosphate

[0149] ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate

[0150] u=2'-O-methyluridine-3'-phosphate

[0151] us = 2'-O-methyluridine-3'-phosphorothioate

[0152] Af = 2'-fluoroadenosine-3'-phosphate

[0153] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0154] Cf = 2'-fluorocytidine-3'-phosphate

[0155] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0156] Gf = 2'-fluoroguanosine-3'-phosphate

[0157] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0158] Tf = 2'-fluoro-5'-methyluridine-3'-phosphate

[0159] Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate

[0160] Uf = 2'-fluorouridine-3'-phosphate

[0161] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0162] dT = 2'-deoxythymidine-3'-phosphate

[0163] A UNA =2',3'-cleaved-adenosine-3'-phosphate

[0164] A UNA s=2',3'-cleaved-adenosine-3'-phosphorothioate

[0165] C UNA =2',3'-Cytidine-3'-phosphate

[0166] C UNA s=2',3'-cleaved-cytidine-3'-phosphorothioate

[0167] G UNA =2',3'-Cyclic-Guanosine-3'-phosphate

[0168] G UNA s=2',3'-cleaved-guanosine-3'-phosphorothioate

[0169] U UNA =2',3'-cleaved-uridine-3'-phosphate

[0170] U UNA s=2',3'-cleaved-uridine-3'-phosphorothioate

[0171] a_2N = See Table 11

[0172] a_2Ns = see Table 11

[0173] (invAb) = inverted abasic deoxynucleotide-5'-phosphate, see Table 11

[0174] (invAb)s = inverted abasic deoxynucleotide-5'-phosphorothioate, see Table 11

[0175] s = phosphorothioate linkage

[0176] p = terminal phosphate (if synthetic)

[0177] vpdN = vinylphosphonate deoxyribonucleotide

[0178] cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11)

[0179] cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 11)

[0180] cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11)

[0181] cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 11)

[0182] (Alk-SS-C6) = See Table 11

[0183] (C6-SS-Alk) = See Table 11

[0184] (C6-SS-C6) = See Table 11

[0185] (6-SS-6) = See Table 11

[0186] (C6-SS-Alk-Me) = See Table 11

[0187] (NH2-C6) = See Table 11

[0188] (NH-C6) = See Table 11

[0189] (NH-C6)s = See Table 11

[0190] -L6-C6- = See Table 11

[0191] -L6-C6s- = See Table 11

[0192] LP183rs = See Table 11

[0193] LP409s = See Table 11

[0194] cC16 = see Table 11

[0195] aC16 = see Table 11

[0196] gC16 = see Table 11

[0197] uC16 = See Table 11

[0198] ALNA = See Table 11

[0199] c16s = see Table 11

[0200] C22s = See Table 11

[0201] HO-C16s = See Table 11

[0202] (2C8C12)s = See Table 11

[0203] (2C6C10)s = See Table 11

[0204] LP283 = See Table 11

[0205] LP293 = See Table 11

[0206] LP310 = See Table 11

[0207] LP383 = See Table 11

[0208] LP395 = See Table 11

[0209] LP395s = See Table 11

[0210] LP396 = See Table 11

[0211] As will be readily understood by those of ordinary skill in the art, unless otherwise indicated by sequence (e.g., such as by phosphorothioate connection "s"), when present in an oligonucleotide, nucleotide monomers are interconnected by 5'-3'-phosphodiester bonds. As will be clearly understood by those of ordinary skill in the art, phosphorothioate connections as shown in the modified nucleotide sequences disclosed herein include phosphodiester connections typically present in replacement oligonucleotides. In addition, it will be readily understood by those of ordinary skill in the art that the terminal nucleotides at the 3' end of a given oligonucleotide sequence typically have a hydroxyl (-OH) group at the 3' position of a given monomer, rather than an isolated phosphate moiety. In addition, for embodiments disclosed herein, when viewing the respective chains 5'→3', the reverse abasic residue is inserted so that the 3' position of deoxyribose is connected at the 3' end of the preceding monomer on the respective chains (see, e.g., Table 11). In addition, as the skilled artisan readily understands and appreciates, although the phosphorothioate chemical structures depicted herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., where the sulfur atom has a double bond and the anion is on the oxygen atom). Unless otherwise expressly indicated herein, such understanding of the skilled artisan is used when describing the SOD1 RNAi agents and compositions of SOD1 RNAi agents disclosed herein.

[0212] Some examples of PK / PD modulators and linkers for use with the SOD1 RNAi agents disclosed herein are contained in the chemical structures provided below in Table 11. Each sense strand and / or antisense strand can have any PK / PD modulator or linker listed herein, as well as other targeting groups, PK / PD modulators, linkers conjugated to the 5' and / or 3' end of the sequence.

[0213] Table 3. SOD1 RNAi agent antisense strand sequence

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223] Table 4. SOD1 agent sense strand sequences (not shown with linker, conjugate or capping moiety)

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232] (A 2N ) = 2-aminoadenosine nucleotide

[0233] Table 5. SOD1 agent sense strand sequences (shown with (NH2-C6) linker, (NAG37)s ligand or (invAb) end cap (see Table 11 for structural information.))

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246] Table 6. SOD1 agent sense strand sequences (shown together with the lipid portion.) The structure of the lipid portion is shown in Table 11.

[0247]

[0248]

[0249]

[0250]

[0251]

[0252] Table 6a. SOD1 agent sense strand sequences (shown together with the lipid portion.) The structure of the lipid portion is shown in Table 11.

[0253]

[0254]

[0255]

[0256]

[0257] The SOD1 RNAi agents disclosed herein are formed by annealing the antisense strand to the sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, Table 6 or Table 6a can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity within a continuous sequence of 16, 17, 18, 19, 20 or 21 nucleotides.

[0258] As shown in Table 5 above, certain exemplary SOD1 RNAi agent nucleotide sequences are shown as further comprising reactive linking groups at one or both of the 5' end and the 3' end of the sense strand. For example, many of the SOD1 RNAi agent sense strand sequences shown in Table 5 above have a (NH2-C6) linking group at the 5' end of the nucleotide sequence. In certain embodiments, other linking groups may also be present or alternatively present, such as a (6-SS-6) linking group or a (C6-SS-C6) linking group. Such reactive linking groups are placed to facilitate the attachment of targeting ligands, targeting groups, and / or PK / PD modulators to the SOD1 RNAi agents disclosed herein. Attachment or conjugation reactions are well known in the art and provide for the formation of a covalent link between two molecules or reactants. Suitable conjugation reactions for use within the scope of the invention herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, inverse-demand Diels-Alder cycloaddition reactions, oxime ligations, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.

[0259] In some embodiments, the targeting ligand can be synthesized as an activated ester, such as a tetrafluorophenyl (TFP) ester, which can be replaced by a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to a SOD1 RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl or DBCO group, for example, via a copper (I)-catalyzed or strain-promoted azide-alkyne cycloaddition reaction.

[0260] In addition, certain nucleotide sequences can be synthesized with a dT nucleotide followed by a (3'→5') linker (e.g., C6-SS-C6) at the 3' end of the sense strand. In some embodiments, the linker can facilitate attachment to additional components such as, for example, a lipid or one or more targeting ligands. As described herein, the disulfide bond of C6-SS-C6 is first reduced, the dT is removed from the molecule, and then the molecule can facilitate conjugation of the desired components. Thus, the terminal dT nucleotide is not part of a fully conjugated construct.

[0261] In some embodiments, the antisense strand of a SOD1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any antisense strand sequence in Table 3 or Table 10. In some embodiments, the sense strand of a SOD1 RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any sense strand sequence in Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0262] In some embodiments, the SOD1 RNAi agent antisense strand comprises the nucleotide sequence of any sequence in Table 2 or Table 3. In some embodiments, the SOD1 RNAi agent antisense strand comprises the nucleotide sequence of any sequence in Table 2, Table 3 or Table 10 (from 5' end → 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24 or 2-24. In certain embodiments, the SOD1 RNAi agent antisense strand comprises a modified sequence of any modified sequence in Table 3 or Table 10 or consists of a modified sequence of any modified sequence in Table 3 or Table 10.

[0263] In some embodiments, the sense strand of the SOD1 RNAi agent comprises the nucleotide sequence of any sequence in Table 2 or Table 4. In some embodiments, the sense strand of the SOD1 RNAi agent comprises the nucleotide sequence of any sequence in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10 (from 5' end → 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24. In certain embodiments, the sense strand of the SOD1 RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.

[0264] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) may be perfectly complementary to the SOD1 gene or may not be complementary to the SOD1 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) is U, A or dT (or a modified form of U, A or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (from the 5' end → 3' end) forms an A:U or U:A base pair with the sense strand.

[0265] In some embodiments, the SOD1 RNAi agent antisense strand comprises the nucleotide sequence (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2, Table 3, or Table 10. In some embodiments, the SOD1 RNAi sense strand comprises the nucleotide sequence (from 5' end → 3' end) 1-17 or 1-18 of any sense strand sequence in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0266] In some embodiments, the SOD1 RNAi agent comprises (i) an antisense strand comprising a nucleotide sequence (from 5' end → 3' end) 2-18 or 2-19 of any antisense strand sequence in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising a nucleotide sequence (from 5' end → 3' end) 1-17 or 1-18 of any sense strand sequence in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0267] A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity within a contiguous sequence of 16, 17, 18, 19, 20, or 21 nucleotides. In some embodiments, the SOD1 RNAi agent has a sense strand consisting of a modified sequence of any modified sequence in Table 4, Table 5, Table 6, Table 6a, or Table 10, and an antisense strand consisting of a modified sequence of any modified sequence in Table 3 or Table 10. Certain representative sequence pairs are exemplified by the duplex ID numbers shown in Tables 7A, 7B, 8, and 9A.

[0268] In some embodiments, the SOD1 RNAi agent comprises a duplex represented by any duplex ID number presented herein, is composed of a duplex represented by any duplex ID number presented herein, or is substantially composed of a duplex represented by any duplex ID number presented herein. In some embodiments, the SOD1 RNAi agent is composed of any duplex ID number presented herein. In some embodiments, the SOD1 RNAi agent comprises a sense strand and antisense strand nucleotide sequence of any duplex ID number presented herein. In some embodiments, the SOD1 RNAi agent comprises a sense strand and antisense strand nucleotide sequence of any duplex ID number presented herein and a targeting group, a linking group, a PK / PD regulator, and / or other non-nucleotide groups, wherein the targeting group, the linking group, the PK / PD regulator, and / or other non-nucleotide groups are covalently attached (i.e., conjugated) to a sense strand or antisense strand. In some embodiments, the SOD1 RNAi agent comprises a sense strand and antisense strand modified nucleotide sequence of any duplex ID number presented herein. In some embodiments, the SOD1 RNAi agent comprises a sense strand and an antisense strand modified nucleotide sequence of any duplex ID number presented herein and a targeting group, a linking group, and / or other non-nucleotide groups, wherein the targeting group, the linking group, the PK / PD modulator, and / or other non-nucleotide groups are covalently linked to the sense strand or the antisense strand.

[0269] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex in Table 2, 7A, 7B, 8, 9A, or 10, and comprises a PK / PD modulator. In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex in Table 2, 7A, 7B, 8, 9A, or 10, and comprises one or more lipid moieties.

[0270] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex in Table 2, 7A, 7B, 8, 9A, or 10, and comprises a lipid moiety. In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any antisense strand / sense strand duplex in Table 2, 7A, 7B, 8, 9A, or 10, and comprises one or more lipid moieties.

[0271] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 7A, 7B, 8, 9A, and 10.

[0272] In some embodiments, the SOD1 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any antisense strand / sense strand duplex in Tables 7A, 7B, 8, 9A, and 10, and comprises a lipid moiety.

[0273] In some embodiments, the SOD1 RNAi agent comprises, consists of, or consists essentially of any duplex in Tables 7A, 7B, 8, 9A, and 10.

[0274] Table 7A. SOD1 RNAi agent duplexes with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Not shown with linker or conjugate)

[0275]

[0276]

[0277]

[0278]

[0279]

[0280] Table 7B. SOD1 RNAi agent duplexes along with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences.

[0281]

[0282]

[0283]

[0284] Table 8. SOD1 RNAi agent duplexes with corresponding sense and antisense strand ID numbers and sequence ID numbers for modified and unmodified nucleotide sequences. (Shown with PK / PD modulators)

[0285]

[0286]

[0287]

[0288]

[0289] Table 9A. Conjugate duplex ID numbers referencing target locations of the SOD1 (SOD1) gene

[0290]

[0291]

[0292]

[0293] Table 10. Conjugate ID numbers along with chemically modified antisense and sense strands (including linkers and conjugates)

[0294]

[0295]

[0296]

[0297]

[0298]

[0299]

[0300]

[0301] In some embodiments, the SOD1 RNAi agent is prepared or provided as a salt, a mixed salt or a free acid. In some embodiments, the SOD1 RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the SOD1 RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. After delivery to cells expressing the SOD1 gene, the RNAi agents described herein inhibit or knock down the expression of one or more SOD1 genes in vivo and / or in vitro.

[0302] Targeting groups, linkers, lipid PK / PD moieties, and delivery vehicles

[0303] In some embodiments, the SOD1 RNAi agent contains one or more non-nucleotide groups or is conjugated to one or more non-nucleotide groups, the non-nucleotide groups including but not limited to targeting groups, linking groups, pharmacokinetic / pharmacodynamic (PK / PD) modulators, delivery polymers or delivery vehicles. The non-nucleotide groups can enhance the targeting, delivery or attachment of the RNAi agent. The non-nucleotide groups can be covalently linked to the 3' and / or 5' ends of the sense strand and / or antisense strand. In some embodiments, the SOD1 RNAi agent contains a non-nucleotide group connected to the 3' and / or 5' ends of the sense strand. In some embodiments, the non-nucleotide group is connected to the 5' end of the sense strand of the SOD1 RNAi agent. The non-nucleotide group can be directly or indirectly connected to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is connected to the RNAi agent via an unstable, cleavable or reversible bond or linker.

[0304] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached to improve the cell or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances the cellular endocytosis of the RNAi agent.

[0305] Targeting group or targeting moiety enhance the pharmacokinetics or biodistribution characteristics of the conjugate or RNAi agent to which they are attached, to improve the cell-specific (in some cases, including organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting group can be monovalent, divalent, trivalent, tetravalent, or for it to have a higher titer for the target. Representative targeting groups include but are not limited to compounds, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments and antibody mimics with affinity for cell surface molecules. In some embodiments, the targeting group is connected to the RNAi agent using a joint, such as a PEG joint or one, two or three abasic and / or ribitol (abasic ribose) residues (in some cases, it can serve as a joint).

[0306] A targeting group with or without a linker can be attached to the 5' or 3' end of any sense strand and / or antisense strand disclosed in Tables 2, 3, 4, 5, 6, and 10. A linker with or without a targeting group can be attached to the 5' or 3' end of any sense strand and / or antisense strand disclosed in Tables 2, 3, 4, 5, 6, and 10.

[0307] The SOD1 RNAi agents described herein can be synthesized with reactive groups at the 5' end and / or 3' end, such as amino groups (also referred to herein as amines). The reactive groups can then be used to attach targeting moieties using methods typical in the art.

[0308] For example, in some embodiments, the SOD1 RNAi agents disclosed herein are synthesized with an NH2-C6 group at the 5' end of the sense strand of the RNAi agent. The terminal amino group can then react to form a conjugate with, for example, a group comprising a lipid moiety. In some embodiments, the SOD1 RNAi agents disclosed herein are synthesized with one or more alkyne groups at the 5' end of the sense strand of the RNAi agent.

[0309] In some embodiments, the targeting group is connected to the SOD1 RNAi agent without the use of an additional linker. In some embodiments, the targeting group is designed to have a linker that is easy to exist to facilitate connection to the SOD1 RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents can be connected to their respective targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, the two or more RNAi agents are connected to their respective targeting groups using different linkers.

[0310] In some embodiments, the linking group is conjugated to the RNAi agent. The linking group promotes the covalent attachment of the agent to a targeting group, a pharmacokinetic modulator, a delivery polymer, or a delivery vehicle. The linking group can be connected to the 3' and / or 5' end of the sense strand or antisense strand of the RNAi agent. In some embodiments, the linking group is connected to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to: C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyls, abasic residues / nucleotides, amino acids, tri-alkyne functionalized groups, ribitols, and / or PEG groups. Examples of some linking groups are provided in Table 11.

[0311] A linker or connecting group is a connection between two atoms that connects a chemical group (e.g., an RNAi agent) or a segment of interest to another chemical group (e.g., a targeting group, a pharmacokinetic modulator, or a delivery polymer) or a segment of interest via one or more covalent bonds. An unstable connection contains an unstable bond. The connection may optionally include a spacer that increases the distance between the two connected atoms. The spacer may further increase the flexibility and / or length of the connection. The spacer includes, but is not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkyne; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacers are well known in the art, and the previous list is not meant to limit the scope of this specification. In some embodiments, the SOD1 RNAi agent is conjugated to a polyethylene glycol (PEG) moiety or to a hydrophobic group having 12 or more carbon atoms, such as cholesterol or palmitoyl.

[0312] In some embodiments, the SOD1 RNAi agent is linked to one or more lipid PK / PD moieties (referred to herein as "lipid moieties" or "PK / PD modulators"). The lipid PK / PD moieties can enhance the pharmacodynamic or pharmacokinetic properties of the RNAi agent. In some embodiments, the lipid moieties can be conjugated to a linker at the 3' or 5' end of the sense or antisense strand of the RNAi agent described herein. In some embodiments, the lipid moieties can be linked at the 3' or 5' end of the sense or antisense strand of the RNAi agent described herein.

[0313] In some embodiments, the lipid moiety can be conjugated to the SOD1 RNAi agent by reacting a SOD1 RNAi agent containing an amine linker, such as (NH2-C6) (see Table 11). In some embodiments, the amine-containing linker can be located at the 5' end of the sense strand or antisense strand of the SOD1 RNAi agent. In some embodiments, the amine-containing linker can be located at the 3' end of the sense strand or antisense strand of the RNAi agent.

[0314] In some embodiments, RNAi agents comprising an amine-containing linker such as (NH2-C6) or (NH2-C6)s can be reacted with lipids comprising an activated ester moiety. Exemplary lipids with activated ester moieties include LP183-p, LP 283-p, LP293-p, LP304-p, LP310-p, LP383-p, LP395-p, and LP396-p as shown in Table 11 below.

[0315] In some embodiments, the SOD1 RNAi agent can be conjugated to the lipid portion using phosphoramidite synthesis. The use of phosphoramidites to synthesize oligonucleotides is well known in the art. In some embodiments, the lipid portion can be conjugated to the 5' end of the sense strand or antisense strand of the SOD1 RNAi agent using phosphoramidites. In some embodiments, the lipid portion can be conjugated to the 3' end of the sense strand or antisense strand of the SOD1 RNAi agent using phosphoramidites. In some embodiments, phosphoramidites selected from (2C8C12)-p, (2C6C10)-p, LP429 phosphoramidites, HO-C16-p, C16-p or C22-p, all as shown in Table 11 below, can be used to conjugate the lipid portion to the SOD1 RNAi agent.

[0316] In some embodiments, the SOD1 RNAi agent may include a lipid moiety on an internal nucleotide (i.e., not on the 3' or 5' terminal nucleotide). In some embodiments, the internal nucleotide may be linked to the 2' position of the ribose. In some embodiments, the SOD1 RNAi agent may include aC16, uC16, cC16, or gC16 as shown in Table 11 below.

[0317] Any SOD1 RNAi agent nucleotide sequence listed in Tables 2, 3, 4, 5, 6 and 10, whether modified or unmodified, can contain 3' and / or 5' targeting groups, linking groups and / or lipid PK / PD moieties. Any SOD1 RNAi agent sequence listed in Tables 3, 4, 5, 6 and 10 or otherwise described herein that contains 3' or 5' targeting groups, linking groups and / or lipid PK / PD moieties may alternatively be free of 3' or 5' targeting groups, linking groups or lipid PK / PD moieties, or may contain different 3' or 5' targeting groups, linking groups or lipid PK / PD moieties, including but not limited to those depicted in Table 11. Any of the SOD1 RNAi agent duplexes listed in Tables 7A, 7B, 8, 9A and 10, whether modified or unmodified, may further comprise a targeting group, a linking group or a PK / PD moiety, including but not limited to those depicted in Table 11, and the targeting group, linking group or PK / PD moiety may be attached to the 3' or 5' end of the sense strand or antisense strand of the SOD1 RNAi agent duplex.

[0318] Examples of certain modified nucleotides, capping moieties, lipid moieties, and linking groups are provided in Table 11.

[0319] Table 11. Structures showing various modified nucleotides, capping moieties, lipid PK / PD moieties and linking groups (where Indicates the connection point)

[0320]

[0321]

[0322]

[0323]

[0324]

[0325]

[0326]

[0327]

[0328]

[0329]

[0330]

[0331]

[0332]

[0333]

[0334]

[0335]

[0336]

[0337]

[0338]

[0339]

[0340]

[0341]

[0342] Alternatively, other linking groups known in the art may be used. In many cases, the linking group may be commercially available or alternatively incorporated into commercially available nucleotide phosphoramidites. (See, for example, International Patent Application Publication No. WO 2019 / 161213, which is incorporated herein by reference in its entirety).

[0343] In some embodiments, the SOD1 RNAi agent is delivered without being conjugated to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as "naked" or "naked RNAi agent").

[0344] In some embodiments, the SOD1 RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the SOD1 RNAi agent to selected cells or tissues, such as to CNS cells in vivo. In some embodiments, the SOD1 RNAi agent is conjugated to a lipid moiety.

[0345] In some embodiments, delivery vehicles can be used to deliver RNAi agents to cells or tissues. Delivery vehicles are compounds that improve the delivery of RNAi agents to cells or tissues. Delivery vehicles can include or consist of: polymers, such as amphipathic polymers, membrane active polymers, peptides, melittin, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides or reversibly modified membrane active polyamines, but are not limited thereto.

[0346] In some embodiments, RNAi agent can be combined with lipid, nanoparticle, polymer, liposome, micelle, DPC or other delivery systems that can be used for nucleic acid delivery in this area.RNAi agent can also be chemically conjugated to targeting group, lipid (including but not limited to cholesterol group and cholesterol group derivative), encapsulated in nanoparticle, liposome, micelle, conjugated to polymer or DPC (see, for example, WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169 and WO 2012 / 083185, WO2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis or by incorporating other delivery vehicles or systems available in this area, such as hydrogel, cyclodextrin, biodegradable nanocapsule, bioadhesive microsphere or protein carrier.In some embodiments, RNAi agent can be conjugated to the antibody with affinity for CNS cells. In some embodiments, the RNAi agent can be linked to a targeting ligand that has affinity for a CNS cell or a receptor present on a CNS cell.

[0347] Pharmaceutical compositions and preparations

[0348] The SOD1 RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "drugs"). In some embodiments, the pharmaceutical composition comprises at least one SOD1 RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting the expression of SOD1 mRNA in target cells, cell populations, tissues or organisms. The pharmaceutical composition can be used to treat subjects suffering from a disease, disorder or condition that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. The pharmaceutical composition can be used to treat subjects at risk of developing a disease or disorder that would benefit from a reduction in target mRNA levels or inhibition of target gene expression. In one embodiment, the method comprises administering a SOD1 RNAi agent connected to a PK / PD regulator as described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents and / or delivery polymers) are added to a pharmaceutical composition comprising a SOD1 RNAi agent to form a pharmaceutical formulation or drug suitable for in vivo delivery to a subject including a human.

[0349] Pharmaceutical compositions comprising SOD1 RNAi agents and methods disclosed herein reduce target mRNA levels in cells, cell populations, cell populations, tissues, organs or subjects, including by administering to the subject a therapeutically effective amount of a SOD1 RNAi agent described herein, thereby inhibiting SOD1 mRNA expression in the subject. In some embodiments, the subject has been previously identified or diagnosed as having a disease or condition that can be mediated at least in part by reducing SOD1 gene expression. In some embodiments, the subject has been previously diagnosed as having one or more neurodegenerative diseases, such as ALS and Alzheimer's disease. In some embodiments, the neurodegenerative disease is ALS.

[0350] In some embodiments, the subject has been previously diagnosed with a neurodegenerative disease.

[0351] Embodiments of the present disclosure include pharmaceutical compositions for delivering a SOD1 RNAi agent to CNS cells in vivo.Such pharmaceutical compositions may include, for example, a SOD1 RNAi agent conjugated to a lipid moiety.

[0352] In some embodiments, the pharmaceutical compositions described comprising SOD1 RNAi agents are used to treat or manage clinical manifestations of subjects who would benefit from inhibition of the expression of SOD1. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any disclosed SOD1 RNAi agent can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0353] In some embodiments, the described SOD1 RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent can be another SOD1 RNAi agent (e.g., a SOD1 RNAi agent that targets a different sequence within the SOD1 gene). In some embodiments, the second therapeutic agent can be an RNAi agent that targets the SOD1 gene. The additional therapeutic agent can also be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The SOD1 RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0354] The described pharmaceutical compositions comprising SOD1 RNAi agents can be used to treat at least one symptom of a subject suffering from a disease or condition that would benefit from a reduction or inhibition of SOD1 mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising SOD1 RNAi agents is administered to a subject, thereby treating the symptom. In other embodiments, a prophylactically effective amount of one or more SOD1 RNAi agents is administered to a subject, thereby preventing or inhibiting at least one symptom.

[0355] In some embodiments, one or more of the described SOD1 RNAi agents in a pharmaceutically acceptable carrier or diluent is administered to a mammal. In some embodiments, the mammal is a human.

[0356] The route of administration is the path by which the SOD1 RNAi agent is contacted with the body. In general, methods for administering drugs, oligonucleotides and nucleic acids (including CNS) for treating mammals are well known in the art and can be applied to the administration of the compositions described herein. The SOD1 RNAi agent disclosed herein can be administered via any suitable route with a formulation appropriately customized for a particular route. Therefore, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal inhalation administration. In some embodiments, the pharmaceutical composition can be administered by injection, such as intravenously, intramuscularly, intradermally, subcutaneously, intraventricularly, intraarticularly, intraocularly, or intraperitoneally or topically.

[0357] The pharmaceutical compositions comprising SOD1 RNAi agents described herein can be delivered to cells, cell groups, tissues or subjects using oligonucleotide delivery techniques known in the art. In general, any suitable method (in vitro or in vivo) for delivering nucleic acid molecules recognized in the art can be applicable to the compositions described herein. For example, delivery can be by topical administration (e.g., direct injection, implantation or topical administration), systemic administration or subcutaneous, intravenous, intraperitoneal or parenteral routes, including intracranial (e.g., intraventricular / intraventricular, intracerebral parenchyma and intrathecal), intraventricular, intramuscular, transdermal, airway (aerosol), nasal, oral, rectal or local (including buccal and sublingual) administration. In some embodiments, the composition is administered via inhalation, intranasal administration, oropharyngeal inhalation administration or intratracheal administration. For example, in some embodiments, it is desirable that the SOD1 RNAi agent described herein inhibits the expression of the SOD1 gene in the CNS.

[0358] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients.The pharmaceutical compositions described herein are formulated for administration to a subject.

[0359] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance intended to be included in a drug delivery system in addition to an active pharmaceutical ingredient (API, therapeutic product, such as a SOD1 RNAi agent). The excipient does not exert or is not intended to exert a therapeutic effect at the intended dose. The excipient may act to: a) aid in the processing of the drug delivery system during manufacturing, b) protect, support or enhance the stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other properties of the overall safety and effectiveness of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may be an inert substance or may not be an inert substance.

[0360] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, tonicity agents, vehicles, hydrophobic agents, and wetting agents.

[0361] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, In some embodiments, the present invention provides the composition of the present invention. The composition of the present invention can be ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). It should be stable under manufacturing and storage conditions, and should be preserved for the contamination of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol) and suitable mixtures thereof. Suitable fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by using a surfactant. In many cases, it is preferred to include isotonic agents in the composition, such as sugars, polyols such as mannitol, sorbitol and sodium chloride. By including in the composition an agent such as aluminum monostearate and gelatin that delays absorption, the extended absorption of the injectable composition can be achieved.

[0362] Sterile injectable solutions can be prepared by mixing the required amount of active compound with one or a combination of the ingredients listed above (as needed) in an appropriate solvent, followed by filtration sterilization. Generally speaking, dispersions are prepared by mixing the active compound into a sterile vehicle containing a basic dispersion medium and other ingredients required from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preparation methods include vacuum drying and freeze drying, which produce powders thereof from a previously sterile filtered solution of the active ingredient plus any additional required ingredients.

[0363] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to provide the drug for both intra-articular and ophthalmic administration.

[0364] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable biocompatible polymers such as ethylene-vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such preparations are apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as described in U.S. Patent No. 4,522,811.

[0365] For ease of administration and consistency of dosage, SOD1 RNAi agents can be formulated into compositions in dosage unit form. Dosage unit form refers to physically discrete units suitable as unit dosages for subjects to be treated; each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect in combination with the required pharmaceutical carrier. The specification for dosage unit forms of the present disclosure is dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the art of synthesizing such active compounds for treating individuals.

[0366] The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs expressing or comprising RNAi agents defined herein can be used as "pharmaceutical compositions". As used herein, "pharmacologically effective amount", "therapeutically effective amount", or simply "effective amount" refers to the amount of RNAi agents that produce a pharmacological, therapeutic, or preventive result.

[0367] In some embodiments, the SOD1 RNAi agent pharmaceutical composition may contain a salt, such as sodium chloride, calcium chloride, magnesium chloride, potassium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0368] In some embodiments, in addition to administering the RNAi agents disclosed herein, the methods disclosed herein further include the step of administering a second therapeutic agent or treatment. In some embodiments, the second therapeutic agent is another SOD1 RNAi agent (e.g., a SOD1 RNAi agent targeting a different sequence within the SOD1 target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment and / or an aptamer.

[0369] In some embodiments, described herein are compositions comprising a combination or mixture of at least two SOD1 RNAi agents having different sequences. In some embodiments, two or more SOD1 RNAi agents are each separately and independently attached to a lipid.

[0370] Described herein are compositions for delivering SOD1 RNAi agents to central nervous system (CNS) cells. In addition, generally described herein are compositions for delivering SOD1 RNAi agents to cells, including neurons, astrocytes, microglia, and endothelial cells.

[0371] In general, the effective amount of the SOD1 RNAi agent disclosed herein is within the range of about 0.0001 to about 20 mg / kg body weight dosage, for example, within the range of about 0.001 to about 5 mg / kg body weight dosage. In some embodiments, the effective amount of the SOD1 RNAi agent will be within the range of about 0.01 mg / kg to about 3.0 mg / kg body weight / dose. In some embodiments, the effective amount of the SOD1 RNAi agent will be within the range of about 0.03 mg / kg to about 2.0 mg / kg body weight / dose. In some embodiments, the effective amount of the SOD1 RNAi agent will be within the range of about 0.01 to about 1.0 mg / kg. In some embodiments, the effective amount of the SOD1 RNAi agent will be within the range of about 0.50 to about 1.0 mg / kg. In some embodiments, a fixed dose of SOD1 RNAi agent is administered to a subject. In some embodiments, the dosage administered to a human subject is about 1.0 mg to about 750 mg. In some embodiments, the dosage of the SOD1 RNAi agent administered to a human subject is about 10 mg to about 450 mg. In some embodiments, the dosage of the SOD1 RNAi agent applied to a human subject is about 25 mg to about 450 mg. In some embodiments, the dosage of the SOD1 RNAi agent applied to a human subject is about 50 mg, about 75 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg or about 450 mg. The amount applied may also depend on such variables as the overall health of the patient, the relative biological efficacy of the compound delivered, the preparation of the drug, the presence and type of excipients in the preparation, and the route of administration. In addition, it should be understood that the initial dose applied can be increased to exceed the upper limit level above to quickly reach the required blood level or tissue level, or the initial dose can be less than optimal. In some embodiments, the dose is applied daily. In some embodiments, the dose is applied weekly. In other embodiments, the dose is applied every two weeks, every three weeks, once a month, or once a quarter (i.e., once every three months).

[0372] In order to treat a disease or form a medicament or composition for treating a disease, the pharmaceutical composition comprising a SOD1 RNAi agent described herein can be combined with an excipient or with a second therapeutic agent or treatment, which includes but is not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0373] When the described SOD1 RNAi agent is added to a pharmaceutically acceptable excipient or adjuvant, the described SOD1 RNAi agent can be packaged into a kit, container, package or dispenser.

[0374] Methods of treating and inhibiting SOD1 gene expression

[0375] The SOD1 RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) suffering from diseases or conditions that would benefit from the administration of RNAi agents. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) that would benefit from the reduction and / or inhibition of SOD1 mRNA expression and / or the reduction of SOD1 protein and / or enzyme levels.

[0376] In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) suffering from diseases or conditions for which the subject would benefit from a reduction in mutant SOD1 enzymes, including but not limited to ALS and Alzheimer's disease. Treatment of the subject may include therapeutic and / or prophylactic treatment. A therapeutically effective amount of any one or more SOD1 RNAi agents described herein is administered to the subject. The subject may be a human, a patient, or a human patient. The subject may be an adult, a teenager, a child, or an infant. Administration of the pharmaceutical compositions described herein may be to humans or animals.

[0377] Mutant SOD1 activity is known to promote neurodegenerative disorders. In some embodiments, the described SOD1 RNAi agent is used to treat at least one symptom of a subject, the symptom being mediated at least in part by a reduction in mutant SOD1 enzyme levels. A therapeutically effective amount of any one or more of the described SOD1 RNAi agents is administered to the subject. In some embodiments, a preventive effective amount of any one or more of the described RNAi agents is administered to the subject, thereby treating the subject by preventing or inhibiting at least one symptom.

[0378] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by expression of a SOD1 gene in a patient in need thereof, wherein the method comprises administering to the patient any of the SOD1 RNAi agents described herein.

[0379] In some embodiments, the SOD1 RNAi agent is used to treat or manage a clinical manifestation or pathological state of a subject, wherein the clinical manifestation or pathological state is mediated at least in part by a decrease in SOD1 gene expression. A therapeutically effective amount of one or more SOD1 RNAi agents described herein or a composition containing a SOD1 RNAi agent is administered to the subject. In some embodiments, the method comprises administering a composition comprising a SOD1 RNAi agent described herein to the subject to be treated.

[0380] In additional aspects, the disclosure features methods of treatment (including prophylactic or preventative treatment) of a disease or symptom that can be addressed by a reduction in SOD1 protein and / or enzyme levels, the method comprising administering to a subject in need thereof a SOD1 RNAi agent comprising an antisense strand comprising a sequence of any of the sequences in Table 2, Table 3, or Table 10. Compositions for use in such methods are also described herein.

[0381] The described SOD1 RNAi agents and / or compositions comprising SOD1 RNAi agents can be used in methods for therapeutic treatment of diseases or conditions caused by enhanced or elevated levels of SOD1 protein and / or enzyme activity. Such methods include administering a SOD1 RNAi agent as described herein to a subject, such as a human or animal subject.

[0382] In another aspect, the present disclosure provides a method for treating (including prophylactic treatment) a pathological state (e.g., a condition or disease) mediated at least in part by SOD1 gene expression, wherein the method comprises administering to a subject a therapeutically effective amount of a RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2, Table 3, or Table 10.

[0383] In some embodiments, disclosed herein are methods for inhibiting the expression of a SOD1 gene, wherein the method comprises administering to a cell a RNAi agent comprising an antisense strand comprising a sequence of any sequence in Table 2, Table 3, or Table 10.

[0384] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment) a pathological state mediated at least in part by SOD1 gene expression, wherein the method comprises administering to a subject a therapeutically effective amount of a RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0385] In some embodiments, disclosed herein are methods for inhibiting SOD1 gene expression, wherein the method comprises administering to a cell a RNAi agent comprising a sense strand comprising a sequence of any sequence in Table 2, Table 4, Table 5, Table 6, Table 6a, or Table 10.

[0386] In some embodiments, disclosed herein is a method for treating (including prophylactic treatment) a pathological state mediated at least in part by SOD1 gene expression, wherein the method comprises administering to a subject a therapeutically effective amount of a RNAi agent comprising a sense strand and an antisense strand, wherein the sense strand comprises a sequence of any sequence in Table 4, Table 5, Table 6, Table 6a, or Table 10, and the antisense strand comprises a sequence of any sequence in Table 3 or Table 10.

[0387] In some embodiments, disclosed herein is a method for inhibiting the expression of a SOD1 gene, wherein the method comprises administering to a cell a RNAi agent comprising a sense strand and an antisense strand, the sense strand comprising a sequence of any sequence in Table 4, Table 5, Table 6, Table 6a, or Table 10, and the antisense strand comprising a sequence of any sequence in Table 3 or Table 10.

[0388] In some embodiments, disclosed herein are methods of inhibiting SOD1 gene expression, wherein the method comprises administering to a subject a SOD1 RNAi agent comprising a sense strand and an antisense strand, the sense strand consisting of a nucleobase sequence of any sequence in Table 4, Table 5, Table 6, Table 6a, or Table 10, and the antisense strand consisting of a nucleobase sequence of any sequence in Table 3 or Table 10. In other embodiments, disclosed herein are methods of inhibiting SOD1 gene expression, wherein the method comprises administering to a subject a SOD1 RNAi agent comprising a sense strand and an antisense strand, the sense strand consisting of a modified sequence of any modified sequence in Table 4, Table 5, Table 6, Table 6a, or Table 10, and the antisense strand consisting of a modified sequence of any modified sequence in Table 3 or Table 10.

[0389] In some embodiments, disclosed herein are methods for inhibiting SOD1 gene expression in a cell, wherein the method comprises administering one or more SOD1 RNAi agents comprising a duplex structure of one of the duplexes shown in Tables 7A, 7B, 8, 9A, and 10.

[0390] In some embodiments, gene expression levels and / or mRNA levels of a SOD1 gene in certain CNS cells of a subject to whom a described SOD1 RNAi agent is administered are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject before administration of the SOD1 RNAi agent or relative to a subject that did not receive the SOD1 RNAi agent. In some embodiments, the SOD1 protein and / or enzyme levels in certain CNS cells of a subject to whom a described SOD1 RNAi agent is administered are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater than 99% relative to the subject before administration of the SOD1 RNAi agent or relative to a subject who did not receive the SOD1 RNAi agent. The gene expression level, protein level and / or mRNA level of the subject may be reduced in the subject's cells, cell populations and / or tissues. In some embodiments, SOD1 mRNA levels in certain CNS cells of a subject to whom a described SOD1 RNAi agent is administered are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% relative to the subject before administration of the SOD1 RNAi agent or relative to a subject that did not receive the SOD1 RNAi agent.

[0391] The reduction of gene expression, mRNA and protein levels can be evaluated by any method known in the art. The reduction or decrease of SOD1 protein and / or enzyme levels is collectively referred to as reduction, reduction or inhibition of SOD1 expression in this article. The examples described herein illustrate known methods for evaluating inhibition of SOD1 gene expression, including but not limited to measuring SOD1 enzyme levels.

[0392] Cells, tissues, organs and non-human organisms

[0393] Cells, tissues, organs, and non-human organisms comprising at least one SOD1 RNAi agent described herein are contemplated. Cells, tissues, organs, or non-human organisms are prepared by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.

[0394] Additional Illustrative Embodiments

[0395] Certain additional illustrative embodiments of the disclosed technology are provided herein. These embodiments are merely illustrative and do not limit the scope of the present disclosure or the scope of the appended claims.

[0396] Embodiment 1. A RNAi agent for inhibiting superoxide dismutase 1 (SOD1) gene expression, comprising:

[0397] An antisense strand comprising at least 17 consecutive nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 3; and

[0398] The sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand.

[0399] Embodiment 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2-18 of any one sequence provided in Table 2 or Table 3.

[0400] Embodiment 3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides that differs from any one of the sequences provided in Table 2 or Table 4 by 0 or 1 nucleotide, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand within 17 consecutive nucleotides.

[0401] Embodiment 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the SOD1 RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

[0402] Embodiment 5. The RNAi agent of any one of embodiments 1-4, wherein all or substantially all nucleotides are modified nucleotides.

[0403] Embodiment 6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-split ring nucleotide mimetics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides and 3'O-methyl nucleotides.

[0404] Embodiment 7. The RNAi agent of embodiment 5, wherein all or substantially all nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

[0405] Embodiment 8. The RNAi agent of any one of embodiments 1-7, wherein the antisense strand comprises a nucleotide sequence of any one modified sequence provided in Table 3.

[0406] Embodiment 9. The RNAi agent of any one of embodiments 1-8, wherein the sense strand comprises a nucleotide sequence of any one modified sequence provided in Table 4.

[0407] Embodiment 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises a nucleotide sequence of any one modified sequence provided in Table 3, and the sense strand comprises a nucleotide sequence of any one modified sequence provided in Table 4.

[0408] Embodiment 11. The RNAi agent of any one of embodiments 1-10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.

[0409] Embodiment 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.

[0410] Embodiment 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.

[0411] Embodiment 14. The RNAi agent of Embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

[0412] Embodiment 15. The RNAi agent of Embodiment 14, wherein the RNAi agent has two blunt ends.

[0413] Embodiment 16. The RNAi agent of any one of embodiments 1-15, wherein the sense strand comprises one or two terminal caps.

[0414] Embodiment 17. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues.

[0415] Embodiment 18. The RNAi agent of embodiment 1, wherein the RNAi agent comprises a sense strand and an antisense strand, and the sense strand and the antisense strand form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, or Table 10.

[0416] Embodiment 19. The RNAi agent of embodiment 18, wherein all or substantially all nucleotides are modified nucleotides.

[0417] Embodiment 20. The RNAi agent of embodiment 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0418] UGAUAGAGGAUUAAAGUGA (SEQ ID NO:54);

[0419] UAGGAUAACAGAUGAGUUA (SEQ ID NO:59);

[0420] UGAGAUCACAGAAUCUUCA (SEQ ID NO: 64);

[0421] UGAUAGAGGAUUAAAGUGAGG (SEQ ID NO: 1084);

[0422] UAGGAUAACAGAUGAGUUAAG (SEQ ID NO: 1090); or

[0423] UGAGAUCACAGAAUCUUCAAC (SEQ ID NO: 1105).

[0424] Embodiment 21. The RNAi agent of embodiment 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0425] UCACUUUAAUCCUCUAUCA(SEQ ID NO:288);

[0426] UAACUCAUCUGUUAUCCUA(SEQ ID NO:293);

[0427] GUUGAGAUUCUGUGAUCU(SEQ ID NO:298);

[0428] CCUCACUUUAAUCCUCUAUCA(SEQ ID NO:1151);

[0429] CUUAACUCAUCUGUUAUCCUA (SEQ ID NO: 1157); or

[0430] GUUGAGAUUCUGUGAUCUCA (SEQ ID NO: 1172).

[0431] Embodiment 22. The RNAi agent of embodiment 20 or 21, wherein all or substantially all nucleotides are modified nucleotides.

[0432] Embodiment 23. The RNAi agent of embodiment 1, comprising an antisense strand, said antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence, said modified nucleotide sequence differing by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0433] cPrpusGfsasuagAfggAfuUfaAfaGfugagsg (SEQ ID NO: 578);

[0434] cPrpusGfsasuagA UNA ggAfuUfaAfaGfugagsg (SEQ ID NO: 613);

[0435] cPrpuAfgGfauaacagAfuGfaGfuuaassg(SEQ ID NO:589); or

[0436] cPrpusGfsaGfaucacagAfaUfcUfucasasc (SEQ ID NO: 646);

[0437] wherein a, c, g and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine and 2'-O-methyluridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine and 2'-fluorouridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; s represents a phosphorothioate linkage; A UNA represents 2',3'-cleaved-adenosine-3'-phosphate; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

[0438] Embodiment 24. The RNAi agent of embodiment 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'):

[0439] ccucacuuUfAfAfuccucuauca(SEQ ID NO:685);

[0440] cuuaacucAfUfCfuguuauccua (SEQ ID NO: 691); or

[0441] guugaagaUfuCfuGfugaucuca (SEQ ID NO:771);

[0442] wherein a, c, g, i and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine and 2'-O-methyluridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine and 2'-fluorouridine, respectively; and s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

[0443] Embodiment 25. The RNAi agent of any one of embodiments 20-24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.

[0444] Embodiment 26. The RNAi agent of any one of embodiments 1-25, wherein the RNAi agent is linked to a lipid moiety.

[0445] Embodiment 27. The RNAi agent of embodiment 26, wherein the lipid moiety is selected from the group consisting of:

[0446]

[0447]

[0448]

[0449]

[0450]

[0451]

[0452]

[0453]

[0454]

[0455] in The point of attachment to the RNAi agent is indicated.

[0456] Embodiment 28. The RNAi agent of embodiment 26 or embodiment 27, wherein the lipid moiety is conjugated to the sense strand.

[0457] Embodiment 29. The RNAi agent of Embodiment 28, wherein the lipid moiety is conjugated to the 5' end of the sense strand.

[0458] Embodiment 30. A composition comprising the RNAi agent of any one of embodiments 1-29, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0459] Embodiment 31. The composition of embodiment 30, further comprising a second RNAi agent capable of inhibiting the expression of the superoxide dismutase 1 gene.

[0460] Embodiment 32. The composition of any one of Embodiments 30-31, further comprising one or more additional therapeutic agents.

[0461] Embodiment 33. The composition of any one of Embodiments 30-32, wherein the RNAi agent is a sodium salt.

[0462] Embodiment 34. The composition of any one of Embodiments 30-33, wherein the pharmaceutically acceptable excipient is water for injection.

[0463] Embodiment 35. The composition of any one of Embodiments 30-33, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

[0464] Embodiment 36. The composition of any one of Embodiments 30-35, wherein the pharmaceutically acceptable excipient comprises sodium chloride, calcium chloride, magnesium chloride, potassium chloride, disodium hydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0465] Embodiment 37. A method for inhibiting SOD1 gene expression in a cell, the method comprising introducing an effective amount of the RNAi agent of any one of embodiments 1-29 or the composition of any one of embodiments 30-36 into the cell.

[0466] Embodiment 38. The method of Embodiment 37, wherein the cell is within a subject.

[0467] Embodiment 39. The method of embodiment 38, wherein the subject is a human subject.

[0468] Embodiment 40. The method of any one of embodiments 37-39, wherein following administration of the RNAi agent, the superoxide dismutase 1 (SOD1) gene expression is inhibited by at least about 30%.

[0469] Embodiment 41. A method of treating one or more symptoms or diseases associated with enhanced or elevated levels of mutant SOD1 activity, the method comprising administering to a human subject in need thereof a therapeutically effective amount of a composition of any one of Embodiments 30-36.

[0470] Embodiment 42. The method of embodiment 39, wherein the disease is a neurodegenerative disease.

[0471] Embodiment 43. The method of embodiment 40, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or Alzheimer's disease.

[0472] Embodiment 44. The method of Embodiment 41, wherein the disease is ALS.

[0473] Embodiment 45. The method of embodiment 42, wherein the disease is SOD1-related familial ALS.

[0474] Embodiment 46. The method of any one of Embodiments 37-45, wherein the RNAi agent is administered at a dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

[0475] Embodiment 47. The method of any one of Embodiments 37-46, wherein the RNAi agent is administered at a dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

[0476] Embodiment 48. The method of any one of Embodiments 37-45, wherein the RNAi agent is administered at a fixed dose of about 25 mg to about 450 mg.

[0477] Embodiment 49. The method of Embodiment 48, wherein the RNAi agent is administered at a dose of about 25 mg, about 50 mg, about 150 mg, or about 450 mg.

[0478] Embodiment 50. The method of any one of Embodiments 37-49, wherein the RNAi agent is administered in two or more doses.

[0479] Embodiment 51. Use of the RNAi agent of any one of embodiments 1-29 for treating a disease, disorder or symptom mediated at least in part by mutant SOD1 activity and / or SOD1 gene expression.

[0480] Embodiment 52. Use of a composition according to any one of embodiments 30-36 for treating a disease, disorder or symptom mediated at least in part by superoxide dismutase 1 (SOD1) activity and / or superoxide dismutase 1 (SOD1) gene expression.

[0481] Embodiment 53. Use of a composition according to any one of embodiments 30-36 for the manufacture of a medicament for treating a disease, disorder or symptom mediated at least in part by superoxide dismutase 1 (SOD1) and / or superoxide dismutase 1 (SOD1) gene expression.

[0482] Embodiment 54. The use of any one of embodiments 51-53, wherein the disease is a neurodegenerative disease.

[0483] Embodiment 55. A method of preparing the RNAi agent of any one of embodiments 1-29, comprising annealing the sense strand and the antisense strand to form a double-stranded ribonucleic acid molecule.

[0484] Embodiment 56. The method of Embodiment 55, wherein the sense strand comprises a lipid moiety.

[0485] Embodiment 57. The method of embodiment 55, comprising conjugating a lipid moiety to the sense strand. Example

[0486] Example 1. Synthesis of SOD1 RNAi Agents.

[0487] The SOD1 RNAi agent duplex disclosed herein was synthesized as follows:

[0488] A. Synthesis. The sense and antisense strands of the SOD1 RNAi agent were synthesized using the phosphoramidite technique on a solid phase for oligonucleotide synthesis. Depending on the scale, (Bioautomation), (Bioautomation) or OP Pilot 100 (GE Healthcare). or The results were performed on solid supports made from RNA (Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5'-O-dimethoxytrityl-N 2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2'-Deoxy-2'-fluoro-phosphoramidite carries the same protecting group as 2'-O-methyl RNA amidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was purchased from Glen Research (Virginia). Reverse abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)-2',3'-cleaved-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-cleaved -cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-sec-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 5'-(4,4'-dimethoxytrityl)-2',3'-sec-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. TFA aminolink phosphoramidite (aminolink phosphoramidite) is also commercially available (ThermoFisher). Linker L6 is purchased from BroadPharm (article number #BP-20907) as propargyl-PEG5-NHS, and is coupled to the NH2-C6 group from the amino-linked phosphoramidite using standard coupling conditions to form -L6-C6-. Linker Alk-cyHex is similarly commercially available from Lumiprobe (alkyne phosphoramidite, 5'-end) as a propargyl-containing compound phosphoramidite compound to form a linker -Alk-cyHex-. In various cases, the conditions described herein are used to introduce thiophosphates as specified. Cyclopropylphosphonate phosphoramidites are synthesized according to International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57 (55): 6808-6811 (July 2021)).

[0489] The trialkyne-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves were added. 5-Benzylthio-1H-tetrazolyl (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazolyl (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling time was 10 min (RNA), 90 sec (2'O-Me) and 60 sec (2'F). To introduce the phosphorothioate linkage, a 100 mM solution of 3-phenyl 1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0490] Alternatively, the trialkyne moiety is introduced post-synthesis (see Section E below). For this approach, the sense strand is functionalized with a 5' and / or 3' terminal nucleotide containing a primary amine. TFA amino-linked phosphoramidite was dissolved in anhydrous acetonitrile (50 mM) and molecular sieves were added. 5-Benzylthio-1H-tetrazolyl (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazolyl (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling time was 10 min (RNA), 90 sec (2'O-Me) and 60 sec (2'F). To introduce the phosphorothioate linkage, a 100 mM solution of 3-phenyl 1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.

[0491] B. Cleavage and deprotection of support-bound oligomers. After termination of solid phase synthesis, the dried solid support was treated with a 1:1 volume of a 40 wt % solution of methylamine in water and a 28% to 31% ammonium hydroxide solution (Aldrich) at 30° C. for 1.5 hours. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0492] C. Purification. Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, and contained 20% acetonitrile, and buffer B was the same as buffer A with 1.5 M sodium chloride added. UV traces were recorded at 260 nm. Appropriate fractions were combined and then run on a size exclusion HPLC using a GE Healthcare XK 16 / 40 column equipped with Sephadex G-25fine and a running buffer of 100 mM ammonium bicarbonate, pH 6.7 and 20% acetonitrile or filtered water. Alternatively, the combined fractions were desalted and exchanged into an appropriate buffer or solvent system via tangential flow filtration.

[0493] D. Annealing. Complementary strands were mixed to form RNAi agents by combining equimolar RNA solutions (sense and antisense) in 1×PBS (phosphate buffered saline, 1×, Corning, Cellgro). Some RNAi agents were freeze-dried and stored at -15°C to -25°C. The duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1×PBS. The solution absorbance at 260nm was then multiplied by the conversion factor (0.050mg / (mL·cm)) and the dilution factor to determine the duplex concentration.

[0494] E. Lipid Synthesis

[0495] If a lipid described herein is not included in Example IE, it is assumed that the compound is commercially available or can be readily obtained by contracting with a standard commercial manufacturer. For example, LP395p and LP396p are commercially available.

[0496] Synthesis of LP-183 Phosphoramidite

[0497]

[0498] To a solution of compound 2 (2.00 g) in DCM was added TEA (2.27 mL) at room temperature, followed by dropwise addition of compound 1 (4.931 g). The mixture was then stirred at room temperature for 2 hours. The mixture was then filtered. The white solid was dried overnight. The product was a white solid, yield, 4.267 g, 74%. LC-MS: calculated [M+H] 356.35, found 356.63.

[0499]

[0500] At room temperature, compound 3 (0.61g) was added to the mixture of compound 1 (2.54g) in 120mL DCM, followed by dropwise addition of compound 2 (5.37g). The mixture was then stirred at room temperature overnight. 5mL TEA was added followed by diatomaceous earth. After removing the solvent in a vacuum, the residue was loaded onto a 40g column by a dry method. Hexane (2% TEA) to 50% ethyl acetate (2% TEA) in hexane (2% TEA) was used as a gradient for purifying the product. The product was a white waxy solid, yield 3.462g, 87%. LC-MS: calculated [M+H] 556.46, measured 556.64.

[0501] Synthesis of LP-183r-p

[0502]

[0503] Compound 2 (299 mg) and EDC (498 mg) were added to a solution of compound 1 (312 mg) in 10 mL DCM at room temperature. The reaction mixture was stirred at room temperature for 1 hour. After removing the solvent in vacuo, the residue was dry loaded onto a 12 g column. Hexane to ethyl acetate was used as the mobile phase. The product was a clear oil, 408 mg, 75% yield. LC-MS: Calculated [M+H] 230.10, found 230.34.

[0504]

[0505] Compound 2 (516 mg) and TEA (0.745 mL) were added to a solution of compound 1 (408 mg) in 20 mL DCM at room temperature. The reaction mixture was stirred at room temperature overnight. After removing the solvent in vacuo, the residue was recrystallized in MeOH. The product was a white solid, 555 mg, 88% yield. LC-MS: Calculated [M+H] 356.35, found 356.45.

[0506]

[0507] To a mixture of compound 1 (200 mg) in 10 mL of DCM was added compound 3 (33.2 mg) followed by dropwise addition of compound 2 (339 mg) at room temperature. The mixture was then stirred overnight at room temperature. 1 mL of TEA was added followed by some After removing the solvent in vacuo, the residue was dry loaded onto a 4 g column. Hexane (2% TEA) to 50% ethyl acetate (2% TEA) in hexane (2% TEA) was used as a gradient as the mobile phase. The product was a white waxy solid, 95 mg, 30% yield. LC-MS: Calculated [M+H] 556.46, found 556.82.

[0508] Synthesis of LP232-p

[0509]

[0510] Palmitoyl chloride (100mg) is stirred in the solution of cis-4-(tert-butyloxycarbonyl-amino) cyclohexylamine (0.0819g) in 5mL DCM.After the suspension is stirred overnight, water is added and organic matter is extracted with DCM and through Na2SO4 is dried.After filtration, the solvent is concentrated to dryness and by post (hexane to ethyl acetate) purification of crude product.Product is 52mg, 31%.

[0511]

[0512] 2mL dioxane:HCl (4N) is added to 1 (0.0520g) until the deprotection of tert-butyloxycarbonyl (boc) is complete. After removing the solvent in a vacuum, the residue is stirred in a solution of 2 (0.0316g), DIPEA (0.0445g) and COMU (0.0620g) in 5mL DCM. After the suspension is stirred overnight, water is added and the organic matter is extracted with DCM and dried over Na2SO4. After filtering, the solvent is concentrated to dryness, and the crude product is purified by post (DCM to 20% MeOH / DCM). The product is 45mg, 65%.

[0513]

[0514] In 1 (0.0449g), add 2mL dioxane: HCl (4N) until the deprotection of tert-butyl ester group (OtBu) is completed. After removing solvent in vacuum, resistates is stirred in the solution of 2 (0.0217g), DIPEA (0.039mL) and COMU (0.0425g) in 5mL DCM. After the suspension is stirred overnight, add water and organic matter is extracted with DCM and through Na SO Dry. After filtering, solvent is concentrated to dryness, and by post (DCM to 20% MeOH / DCM) purification of crude product. Product is 30mg, 58%.

[0515] Synthesis of LP233-p

[0516]

[0517] Palmitic acid 1 (0.100g) is stirred in a solution of 2 (0.0693g), COMU (0.166g), DIPEA (0.16mL) in 5mL DCM. After the suspension was stirred overnight (heating at 40 ℃), water was added and organic matter was extracted with DCM and dried over Na2SO4. After filtering, the solvent was concentrated to dryness, and the crude product was purified by post (hexane to ethyl acetate). The product was 96mg, 69%.

[0518]

[0519] 2mL dioxane:HCl (4N) is added to 1 (0.0955g) until the deprotection of tert-butyloxycarbonyl is complete. After removing the solvent in a vacuum, the residue is stirred in a solution of 2 (0.0581g), DIPEA (0.11mL) and COMU (0.114g) in 5mL DCM. After the suspension is stirred overnight, water is added and the organic matter is extracted with DCM and dried over Na2SO4. After filtering, the solvent is concentrated to dryness, and the crude product is purified by post (DCM to 20% MeOH / DCM). The product is 68mg, 54%.

[0520]

[0521] In 1 (0.068g), add 2mL dioxane: HCl (4N), until the tert-butyl ester group deprotection is completed. After removing solvent in a vacuum, resistates is stirred in a solution of tetrafluorophenol (0.021g), DIPEA (0.059mL) and COMU (0.064g) in 5mL DCM. After the suspension is stirred overnight, add water and organic matter is extracted with DCM and through Na SO Drying. After filtering, solvent is concentrated to dryness, and by post (DCM to 20% MeOH / DCM) purification of crude product. Product is 22mg, 28%.

[0522] Synthesis of LP242-p

[0523]

[0524] Palmitic acid (0.100 g) was stirred in a solution of tBu-3,9 diazaspiro [5,5] undecane-3-carboxylate HCl (0.073 g), COMU (0.166 g), DIPEA (0.16 mL) in 5 mL DCM. After the suspension was stirred overnight (heated at 40 ° C), water was added and the organic matter was extracted with DCM and dried over Na2SO4. After filtering, the solvent was concentrated to dryness and the crude product was purified by flash chromatography.

[0525]

[0526] 1 (0.017g) is processed with HCl: dioxane, and after 1 hour, the crude reaction is vacuum dried. Add 2 (0.0095g), COMU (0.0186g), DIPEA (0.0134g) in 5mL DCM solution thereto. After the suspension is stirred, add water and organic matter is extracted with DCM and through Na SO Dry. After filtering, the solvent is concentrated to dryness, and by flash chromatography purification crude product.

[0527]

[0528] In 1 (0.121 g), add 2 mL of dioxane: HCl (4 N), until the deprotection of the tert-butyl ester group is completed. After removing the solvent in a vacuum, the crude product 1 is stirred in a solution of tetrafluorophenol (0.0585 g), DIPEA (0.11 mL) and COMU (0.115 g) in 5 mL of DCM. After the suspension is stirred overnight, water is added and the organic matter is extracted with DCM and through Na SO Drying. After filtration, the solvent is concentrated to dryness, and the crude product is purified by flash chromatography.

[0529] Synthesis of LP243-p

[0530]

[0531] Palmitic acid (0.100 g) was stirred in a solution of tBu-3,9 diazaspiro [5,5] undecane-3-carboxylate HCl (0.0732 g), COMU (0.166 g), DIPEA (0.161 mL) in 5 mL DCM. After the suspension was stirred overnight (heated at 40 ° C), water was added and the organic matter was extracted with DCM and dried over Na2SO4. After filtering, the solvent was concentrated to dryness and the crude product was purified by flash chromatography.

[0532]

[0533] 1 (0.0200g) is processed with HCl: dioxane, and after 1 hour, the crude reaction is vacuum dried. Add 2 (0.0119g), COMU (0.0232g), DIPEA (0.022mL) in 5mL DCM solution thereto. After the suspension is stirred, add water and organic matter is extracted with DCM and through Na SO Dry. After filtering, the solvent is concentrated to dryness, and by flash chromatography purification crude product.

[0534]

[0535] In 1 (0.121g), add 2mL dioxane: HCl (4N), until the tert-butyl ester group deprotection is completed. After removing solvent in a vacuum, the crude product 1 is stirred in a solution of tetrafluorophenol (0.0363g), DIPEA (0.104mL) and COMU (0.112g) in 5mL DCM. After the suspension is stirred overnight, add water and organic matter is extracted with DCM and through Na SO Drying. After filtration, the solvent is concentrated to dryness, and by flash chromatography purification crude product.

[0536] Synthesis of LP245-p

[0537]

[0538] At room temperature, TEA was added to a mixture of 1 (2.08 g) and 2 (1.98 g) in 50 mL of toluene. The reaction mixture was stirred overnight at 90 ° C. After cooling to room temperature, ethyl acetate and water were added for post-treatment. Purification was performed on a 40 g column. Hexane to 30% ethyl acetate in hexane was used as a gradient for purification. The product was a light yellow oil, 1388 mg, 51%. LC-MS: Calculated [M+H] 339.21, found 339.62.

[0539]

[0540] At room temperature, 1N NaOH (6mL) was added to a mixture of 1 (0.241g) in MeOH / THF (4mL / 4mL). The reaction mixture was stirred at 60°C for 1 hour. After removing the organic solvent in vacuo, 1N HCl was added to adjust the mixture to pH~1. NaHCO3 was then added to adjust the pH to 7~8. DCM was added for post-treatment. After removing DCM in vacuo, the residue was placed in high vacuum for 2 hours. The residue was diluted with DCM, and then DIPEA (0.248mL), COMU (0.336g) and 2 (0.166g) were added. The reaction mixture was stirred at room temperature for 2 hours. The reaction mixture was washed with 1N HCl, NaHCO3 and brine. Purification was performed on a 12g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a brown oil, 285mg, 74%. LC-MS: [M+H] 540.34 calculated, 541.07 found.

[0541]

[0542] To a mixture of 1 (0.0740 g) and Pd / C in ethyl acetate was charged with H2 (1 atm) at room temperature. The reaction mixture was stirred at room temperature for 4 hours. The reaction mixture was filtered through a pad of 4% MeOH. After removing ethyl acetate in vacuo, the residue was under high vacuum for 1 hour. The residue was dissolved in 3 mL of DCM and 2 (0.166 mL) and TEA (0.115 mL) were added at room temperature. The mixture was stirred at room temperature for 2 hours. Water was added for post-treatment. Purification was performed on a 12 g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was a clear oil, 43 mg, 37%. LC-MS: calculated [M+H] 836.71, found 837.68.

[0543]

[0544] A solution of 1 (0.0430 g) in 4N HCl / dioxane (3 mL) was stirred at room temperature overnight. After removing the solvent in a vacuum, the residue was placed in a high vacuum for 3 hours. The residue was dissolved in 3 mL DMF, then DIPEA (0.027 g), COMU (0.0660 g) and 2 (0.017 g) were added. The mixture was stirred at room temperature for 2 hours. After removing the solvent in a vacuum, the residue was loaded onto a 4 g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was a light yellow oil, 34 mg, 37%. LC-MS: calculated [M+H] 928.64, found 929.59.

[0545] Synthesis of LP249-p

[0546]

[0547] To a mixture of 1 (0.0600 g) and 2 (0.161 mL) in 4 mL DCM was added TEA (0.111 mL) at room temperature. The reaction mixture was stirred at room temperature for 2 hours. Water was added for post-treatment. Purification was performed on a 4 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 74 mg, 60%. LC-MS: Calculated [M+H] 465.41, found 465.91.

[0548]

[0549] To a solution of 1 (0.0740 g) in DCM was added TFA (50% in DCM) at room temperature. The reaction mixture was stirred at room temperature for 0.5 hours. The solvent was removed in vacuo, and the residue was placed in high vacuum for 2 hours. The residue was dissolved in DMF, and 2 (0.0420 g), DIPEA (0.084 mL) and COMU (0.102 g) were added at room temperature. The mixture was stirred at room temperature for 2 hours. The solvent was removed in vacuo. Purification was performed on a 12 g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was a white solid, 56 mg, 58%. LC-MS: Calculated [M+H] 609.48, found 610.29.

[0550]

[0551] A solution of 1 (0.0560 g) in 4N HCl / dioxane (3 mL) was stirred at room temperature overnight. After removing the solvent in a vacuum, the residue was placed in a high vacuum for 3 hours. The residue was dissolved in 2 mL DMF, then DIPEA (0.048 mL), COMU (0.118 g) and 2 (0.031 g) were added. The mixture was stirred at room temperature for 2 hours. After removing the solvent in a vacuum, the residue was loaded onto a 4 g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was an off-white solid, 16 mg, 25%. LC-MS: calculated [M+H] 701.42, found 702.20.

[0552] Synthesis of LP257-p

[0553]

[0554] At room temperature, 2 (0.331 mL) and TEA (0.304 mL) were added to a solution of 1 (0.100 g) in 3 mL DCM. The reaction was stirred at room temperature for 1 hour. Ethyl acetate was added to dilute, and the mixture was then washed with 1N HCl, NaHCO3 and brine. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 134 mg, 58%. LC-MS: Calculated [M+H]: 422.36, found 422.79.

[0555]

[0556] A solution of 1 (0.134 g) in 4N HCl / dioxane (8 mL) was stirred at room temperature overnight. After removal of the solvent in vacuo, the residue was placed in high vacuum for 3 hours. The product was a white solid, 118 mg, which was used in the next step without further purification. LC-MS: Calculated [M+H] 366.30, found 366.62.

[0557]

[0558] At room temperature, COMU (0.086 g), DIPEA (0.047 mL) and 2 (0.045 g) were added to a solution of 1 (0.0490 g) in 3 mL DMF. The mixture was stirred at room temperature for 1 hour. The reaction mixture was diluted with ethyl acetate, then washed with 1 N HCl, NaHCO3 and brine. After removing the solvent in a vacuum, the residue was loaded onto a 4 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 23 mg, 33%. LC-MS: calculated [M+H] 514.29, found 514.79.

[0559] Synthesis of LP259-p

[0560]

[0561] To a solution of 1 (0.100 g) in 3 mL DCM was added 2 (0.366 mL) and TEA (0.337 mL) at room temperature. The reaction was stirred at room temperature for 1 hour. The reaction mixture was loaded onto a 12 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 183 mg, 82%. LC-MS: Calculated [M+H]: 368.32, found 368.60.

[0562]

[0563] A solution of 1 (0.0900 g) in MeOH / THF / 1 N NaOH (3 mL / 3 mL / 3 mL) was stirred at 60 ° C for 1 hour. After cooling to room temperature, MeOH / THF was removed in vacuo. The pH was adjusted to ~1 with 1 N HCl. Ethyl acetate and water were added for post-treatment. After removing ethyl acetate in vacuo, the residue was placed in high vacuum for 3 hours. The residue was dissolved in 3 mL DMF, and COMU (0.136 g), DIPEA (0.085 mL) and 2 (0.053 g) were added at room temperature. The reaction was stirred at room temperature for 1 hour. Ethyl acetate was added to dilute the reaction mixture. The reaction mixture was washed with 1 N HCl, NaHCO3 and brine. After removing ethyl acetate in vacuo, the residue was loaded on a 12 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 87 mg, 71%. LC-MS: Calculated [M+H]: 502.29, found 502.72.

[0564] Synthesis of LP260-p

[0565]

[0566] To a solution of 1 (0.100 g) in DDC was added 2 (0.354 mL) and TEA (0.326 mL) at room temperature. The reaction was stirred at room temperature for 1 hour. The reaction mixture was loaded onto a 12 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 208 mg, 87%. LC-MS: Calculated [M+H]: 410.36, found 410.73.

[0567]

[0568] A solution of 1 (0.208 g) in 4N HCl / dioxane (8 mL) was stirred at room temperature overnight. After removal of the solvent in vacuo, the residue was placed in high vacuum for 3 hours. The product was a white solid, 179 mg, which was used in the next step without further purification. LC-MS: Calculated [M+H] 354.30, found 354.65.

[0569]

[0570] At room temperature, COMU (0.120 g), DIPEA (0.072 mL) and 2 (0.0460 g) were added to a solution of 1 (0.0760 g) in 3 mL DMF. The mixture was stirred at room temperature for 1 hour. The reaction mixture was diluted with ethyl acetate, then washed with 1N HCl, NaHCO3 and brine. After removing the solvent in vacuo, the residue was loaded onto a 12 g column. Hexane to ethyl acetate was used as a gradient for purification. The product was a white solid, 55 mg, 51%. LC-MS: calculated [M+H] 502.29, found 502.72.

[0571] Synthesis of LP262-p

[0572]

[0573] COMU (0.0240 g) was added to a solution of 1 (0.0220 g) and 2 (0.100 g) and DIPEA (0.017 mL) in 2 mL DMF at room temperature. The mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with DCM. Then, it was washed with 1N HCl, saturated NaHCO3 and brine. Purification was performed on a 4 g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was a transparent solid, 77 mg, 65%. LC-MS: Calculated [M+2H]+H2O: 1294.76, found 1295.29; Calculated [M+3H]+H2O: 869.51, found 869.45; Calculated [M+4H]: 638.88, found 638.54.

[0574]

[0575] A solution of 1 (0.077 g) in DMF / piperidine (0.8 mL / 0.2 mL) was stirred at room temperature for 1 hour. After removing the solvent in vacuo, the residue was placed in high vacuum for 3 hours. The residue was dissolved in 3 mL DMF, and then 2 (0.016 g) and TEA (0.013 mL) were added at room temperature. The reaction was stirred at room temperature for 1.5 hours. After removing the solvent in vacuo, the residue was loaded onto a 4 g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was a white solid, 61 mg, 78%. LC-MS: Calculated [M+2H]+H2O: 1302.84, found 1303.81; Calculated [M+4H]: 642.92, found 642.62.

[0576]

[0577] A solution of 1 (0.0610 g) in 4N HCl / dioxane (5 mL) was stirred at room temperature overnight. After removing the solvent in vacuo, the residue was placed in high vacuum for 3 hours. The residue was dissolved in 3 mL DMF, and then COMU (0.0152 g), DIPEA (0.009 mL) and 2 (0.0060 g) were added at room temperature. The reaction was stirred at room temperature for 1.5 hours. After removing the solvent in vacuo, the residue was loaded onto a 4g column. DCM to 20% MeOH / DCM was used as a gradient for purification. The product was a white solid, 13 mg, 21%. LC-MS: Calculated [M+2H]+H2O: 1348.80, found 1348.94; Calculated [M+3H]+H2O: 905.54, found 905.09.

[0578] Synthesis of LP269-p

[0579]

[0580] To a solution of 1 (88.6 mg, 0.500 mmol, 1.0 equiv) and 2 (93.7 mg, 0.600 mmol, 1.20 equiv) in 20 mL of DCM was added TEA (0.418 mL, 3.000 mmol, 6.0 equiv) at ambient conditions. The reaction was stirred at room temperature for 3 hours, followed by the addition of COMU (257 mg, 0.600 mmol, 1.20 equiv) and then 4-nitrophenol (166.1 mg, 1.000 mmol, 2.0 equiv). The reaction was stirred at room temperature overnight. The reaction mixture was washed with 1N HCl and then brine. The mixture was then dried with Na2SO4 and concentrated. The residue was purified by Purification was performed using silica gel as stationary phase and a gradient of EA to Hex 0-100%. 72 mg of product were obtained (19% yield).

[0581] Synthesis of LP273-p

[0582]

[0583] Under ambient conditions, compound 1 (0.200 g), NEt 3( To a solution of 2 (0.152 g) and COMU (0.255 mL) in DCM was added 2 (0.152 g). The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was directly concentrated for isolation. The residue was purified by Purification was performed via DCM liquid loading onto a 12-g column and a gradient of hexanes to 100% ethyl acetate with the product eluting at 28% B. The product was concentrated in vacuo to afford a clear and light yellow oil. MS m / z: Calculated [M+H]+ 477.23 m / z, found 477.52 m / z.

[0584] Synthesis of LP274-p

[0585]

[0586] To a solution of EPA 1 (60.5 mg, 0.200 mmol, 1 eq.) and 2 (36.5 mg, 0.220 mmol, 1.10 eq.) in 20 mL DCM was added COMU (94.2 mg, 0.220 mmol, 1.10 eq.) and then TEA (0.084 mL, 0.600 mmol, 3.0 eq.) at ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1 N HCl and then brine. The mixture was then dried over Na2SO4 and concentrated. The reaction mixture was purified by Purification was performed using silica gel as stationary phase and a gradient of EA to Hex 0-50%. 69 mg of product were obtained (76% yield).

[0587] Synthesis of LP283-p

[0588]

[0589] Compound 2 (29.8 mg) was added to a solution of compound 1 (49 mg), NEt (0.068 mL) and COMU (76.8 mg) in DMF under ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. Conversion was not clearly observed by LC-MS, but instead, the reaction was allowed to stir for 30 minutes until the bright yellow (before adding compound 2) turned into a honey orange color, and it was observed that all materials were mostly dissolved. The reaction mixture was washed with water, extracted with DCM, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by Purification was performed via DCM liquid loading onto a 12-g column and a gradient of hexanes to 100% ethyl acetate with the product eluting at 31% B. The product was concentrated in vacuo to afford a white solid residue and confirmed by 1H NMR in CDCl 3 .

[0590] Synthesis of LP286-p

[0591]

[0592] To a solution of 1 (78.5 mg, 0.200 mmol, 1 eq.) and 2 (36.5 mg, 0.220 mmol, 1.10 eq.) in 20 mL of DCM was added COMU (94.2 mg, 0.220 mmol, 1.10 eq.) and then TEA (0.084 mL, 0.600 mmol, 3.0 eq.) at ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1 N HCl and then brine. The mixture was dried over Na2SO4 and concentrated. The reaction mixture was purified by Purification was performed using silica gel as stationary phase and a gradient of EA to Hex 0-50%. 69 mg of product were obtained (57% yield).

[0593] Synthesis of LP287-p

[0594]

[0595] To a solution of 1 (43.3 mg, 0.200 mmol, 1 eq.) and 2 (36.5 mg, 0.220 mmol, 1.10 eq.) in 20 mL of DCM was added COMU (94.2 mg, 0.220 mmol, 1.10 eq.) and then TEA (0.084 mL, 0.600 mmol, 3.0 eq.) at ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1N HCl and then brine. The mixture was dried over Na2SO4 and concentrated. The reaction mixture was purified by Purification was performed using silica gel as stationary phase and a gradient of EA to Hex 0-50%. 52 mg of product were obtained (71% yield).

[0596] Synthesis of LP290-p

[0597]

[0598] Under ambient conditions, compound 1 (0.0540 g), NEt 3( To a solution of 2 (0.075 mL) and COMU (0.084 g) in DMF was added 2 (0.0327 g). The reaction was stirred for 30 minutes until the bright yellow (before the addition of 2) turned to honey orange and all materials were observed to be mostly dissolved. The reaction mixture was washed with water, extracted with DCM, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by Purification was performed via DCM liquid loading onto a 12-g column and a gradient of hexanes to 100% ethyl acetate with the product eluting at 31% B. The product was concentrated in vacuo to afford a white solid residue and confirmed by 1H NMR in CDCl3. LC-MS: Calculated [M+H]+ 428.14 m / z, found 428.46 m / z.

[0599] Synthesis of LP293-p

[0600]

[0601] Compound 2 (48.9 mg) was added to a solution of compound 1 (73 mg), NEt (0.112 mL) and COMU (126 mg) in DMF under ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. Conversion could not be clearly observed by LC-MS, but instead the reaction was allowed to stir for 30 minutes until the bright yellow (before adding compound 2) turned into honey orange, and it was observed that all materials were mostly dissolved. The reaction mixture was then washed with water, extracted with DCM, dried over Na2SO4, filtered and concentrated in vacuo. The residue was purified by Purification was performed via DCM liquid loading onto a 12-g column and a gradient of hexanes to 100% ethyl acetate with the product eluting at 30% B. The product was concentrated in vacuo to afford a white solid residue and confirmed by 1H NMR in CDCl 3 .

[0602] Synthesis of LP296-p

[0603]

[0604] Under ambient conditions, compound 1 (0.0344 g), NEt 3( To a solution of 2 (0.0117 g) and COMU (0.0182 g) in DCM was added 2 (0.0071 g). The reaction was allowed to stir for 30 minutes until the bright yellow (before the addition of 2) turned to honey orange and all materials were observed to be mostly dissolved. The reaction mixture was directly concentrated for isolation. The residue was purified by Purification was performed via DCM liquid loading onto a 4-g column and a gradient of DCM to 20% MeOH / DCM (0% B to 20% B, to 40% B, to 50% B, then to 100% B), with the product eluting at 23% B. The product was concentrated in vacuo to afford a clear, colorless oil and confirmed by 1H NMR in CDCl3. MS m / z: Calculated [M+H]+ 1039.67 m / z; Found 1040.36, 671.78 m / z.

[0605] Synthesis of LP300-p

[0606]

[0607] At room temperature, TEA (8.4 mL) was added to a solution of 2 (5.29 g) in 100 mL toluene, and then 1 (5.20 g) was added dropwise. The reaction mixture was stirred at 90 ° C for 16 hours. After cooling to room temperature, ethyl acetate and water were added for post-treatment. Purification was carried out on a 120 g column. Hexane to 30% ethyl acetate / hexane was used as a gradient for purification. The product was a light yellow oil, 3658 mg, 54%. LC-MS: calculated [M+H] 339.21, found 339.17.

[0608]

[0609] A mixture of 1 (0.113 g) and 10% Pd / C (0.0036 g) in 10 mL of ethyl acetate was charged with H2 (~45 psi). The reaction mixture was stirred at room temperature for 4 hours. After filtration, the solvent was removed in vacuo. The residue was then placed in high vacuum for 1 hour. The residue was dissolved in 10 mL of DCM, and TEA (0.279 mL) and 2 (0.405 mL) were then added at room temperature. The reaction mixture was stirred at room temperature for 1 hour. Purification was performed on a 12 g column. Hexane to 50% ethyl acetate / hexane was used as a gradient for purification. The product was a white solid, 141 mg, 66%. LC-MS: Calculated [M+H] 635.57, found 635.95.

[0610]

[0611] At room temperature, 1N NaOH (3mL) was added to a solution of 1 (0.141g) in MeOH / THF (3mL / 3mL). The mixture was stirred at room temperature for 2 hours. After removing the organic solvent in vacuo, the residue was acidified to pH~1 with concentrated HCl. Ethyl acetate was added to extract the product. After removing the solvent in vacuo, the residue was placed in high vacuum for 3 hours. The residue was dissolved in DMF / DCM (5mL / 5mL), and then DIPEA (0.077mL), COMU (0.143g) and 2 (0.074g) were added. The mixture was stirred at room temperature for 2 hours. The reaction mixture was diluted with ethyl acetate and then washed with 1N HCl and brine. After removing the solvent in vacuo, the residue was loaded onto a 12g column. Hexane to 30% ethyl acetate / hexane was used as a gradient for purification. The product was a white solid, 80mg, 47%. LC-MS: calculated [M+H] 769.55, found 769.98.

[0612] Synthesis of LP303-p

[0613]

[0614] To a solution of vitamin D1 (185 mg, 0.500 mmol, 1 eq.) and 2 (111 mg, 0.550 mmol, 1.10 eq.) in 30 mL of DCM was added TEA (0.139 mL, 1.00 mmol, 2.0 eq.) at ambient conditions. The reaction was stirred at room temperature for 8 hours. The reaction mixture was washed with 1N HCl and then brine. The mixture was dried over Na2SO4 and concentrated. The residue was purified by Purification was performed using silica gel as stationary phase and a gradient of EA to Hex 0-100%. 95 mg of product were obtained (35% yield).

[0615] Synthesis of LP304-p

[0616]

[0617] 1 (200 mg, 0.377 mmol, 1.0 eq.) was hydrolyzed with a solution of LiOH (151 mg, 3.77 mmol, 10.0 eq.) in MeOH / TFH / H2O (1:1:1, 90 mL). After removing all organic solvents, the aqueous phase was acidified to pH=3 with 1N HCl. The reaction mixture was extracted with ethyl acetate (100 mL x3). The organic phases were combined, dried over Na2SO4 and concentrated to give the crude acid.

[0618] To a solution of the crude acid above and tetrafluorophenol 4 (68.9 mg, 0.415 mmol, 1.10 equiv) in 30 mL DCM was added COMU (194 mg, 0.453 mmol, 1.20 equiv) and then TEA (0.158 mL, 1.13 mmol, 3.0 equiv) at ambient conditions. The reaction was stirred until complete conversion was observed by LC-MS. The reaction mixture was washed with 1 N HCl and then brine. It was dried over Na2SO4 and concentrated. The reaction mixture was purified by Purification was performed using silica gel as stationary phase and a gradient of EA to Hex 0-100%. 170 mg of product were obtained (85% yield).

[0619] Synthesis of LP310-p

[0620]

[0621] To a solution of 1 in DCM was added DIPEA (0.057 mL), COMU (0.077 g) and 2 (0.0300 g) at room temperature. After stirring at room temperature for 2 hours, the reaction was quenched with 0.1 N HCl. The organic layer was washed with brine. After removal of the solvent, the residue was loaded onto a 4 g column. Hexane to 50% hexane / ethyl acetate was used as a gradient for purification. The product was a white solid, 46 mg, 44%. LC-MS: Calculated [M+H] 422.36, found 422.61.

[0622]

[0623] A solution of 1 (0.046 g) in 4N HCl / dioxane (2 mL) was stirred at room temperature overnight. After removing the solvent in vacuo, the residue was placed in high vacuum for 3 hours. Then at room temperature, the residue was dissolved in DCM, and COMU (0.0700 g), DIPEA (0.038 mL) and 2 (0.036 g) were then added at room temperature. After stirring at room temperature for 2 hours, the solvent was removed in vacuo. The residue was loaded onto a 4g column. Hexane to 50% hexane / ethyl acetate was used as a gradient for purification. The product was a white solid, 21 mg, 38%. LC-MS: Calculated [M+H] 514.29, found 514.61.

[0624] Synthesis of LP383-p

[0625]

[0626] Compound 2 (0.023 g) and EDC (0.039 g) were added to a solution of compound 1 (0.050 g) in 5 mL DCM at room temperature. The mixture was stirred at room temperature for 1 hour. After removing the solvent in vacuo, the residue was loaded onto a 4 g column by dry method. Hexane to 50% ethyl acetate / hexane was used to purify the product. The product (Pdt) was a white solid, yield, 29 mg. LC-MS: Calculated [M+H+H2O] 388.27, found 388.03.

[0627] Synthesis of LP409-p

[0628]

[0629] Compounds 1 (1.40 g) and 2 (0.613 g) were dissolved in 100 mL of THF, and TEA (2.01 mL) was then added. The reaction was stirred at 60 °C until complete conversion was confirmed via LC-MS (2-3 hours). The reaction was cooled to room temperature. The product was obtained as a white precipitate, which was filtered and washed with acetone (20 mL). 1 H and13 P NMR confirmed the structure of the compound.

[0630]

[0631] Compound 1 (1.9 g), 2 (0.846 g) and 3 (2.98 g) were dissolved in 100 mL DCM and then heated to 40 ° C. The reaction was stirred until the solution became transparent. The reaction was cooled to room temperature and stirred overnight. After removing all DCM, the product was dry loaded onto a 24 g column. 0-50% (EA / Hex, 1% TEA was added) was used as a mobile phase to obtain a product as a white solid.

[0632] Synthesis of LP429-p

[0633]

[0634] 17-hydroxyhexadecanoic acid (6) (3.53g, 12.3mmol) is added in 500mL RBF. The flask is purged with nitrogen, then DCM (150mL) is added followed by acetic anhydride (18.6mL, 197mmol) and pyridine (30.8mL, 382mmol). The reaction is stirred overnight. The reaction mixture is concentrated and azeotroped with toluene 3 times to remove residual pyridine, acetic acid, acetic anhydride. The residue is then stirred in a 100mL 1:1THF / NaHCO3 aqueous solution mixture for 24 hours. About half of THF is removed via a rotary evaporator, and the mixture is diluted with water and acidified with 3M HCl until pH is 1. The mixture becomes very foamy during acidification. The product is collected by filtration and vacuum dried to produce 3.22g (80% yield) of compound 5 as a white solid. The product is not further purified.

[0635]

[0636] Compound 5 (3.47 g, 10.6 mmol) is dissolved in THF (55 mL), and cooled to -15 ° C to -20 ° C in methanol / ice bath. Once cooled, N-methylmorpholine (1.4 mL, 12.7 mmol) and ethyl chloroformate (1.2 mL, 12.7 mmol) are added. The reaction is stirred for 30 minutes at -15 ° C. After 30 minutes, a solution of sodium azide (1.72 grams, 26.4 mmol) in water (6.6 mL) is added, and the reaction is stirred for 30 minutes in water / salt / ice bath at -5 ° -0 ° C. The reaction mixture is diluted with ethyl acetate (20 mL) and water (20 mL). Each layer is separated and the aqueous layer is extracted with ethyl acetate (2x 50 mL), and the organic layer combined is washed with water (50 mL), brine (50 mL), dried over sodium sulfate and concentrated into a white solid. Proton NMR shows no remaining starting material based on the proton at the α position of the carbonyl. The solid was dissolved in toluene (55 mL) and heated to 65 ° C until gas evolution ceased (about 30 minutes). The reaction was cooled to room temperature and N-hydroxysuccinimide (1.22 g, 10.5 mmol) was added, followed by pyridine ((0.85 mL, 10.5 mmol). Proton NMR indicated that after 2 hours, not all of the isocyanate was consumed, and an additional 2 equivalents of N-hydroxysuccinimide (2.43 g, 21.1 mmol) were added. The reaction was stirred overnight. After stirring overnight, no isocyanate remained by proton NMR. The reaction mixture was concentrated and the resulting white powder was dissolved The product was dissolved in ethyl acetate (100 mL) and poured into 300 mL hexane. The precipitate was collected by filtration. The proton NMR of the product showed residual N-hydroxysuccinimide. The product was dissolved in DCM and purified by silica gel chromatography 65:35 hexane: ethyl acetate to 0:100 hexane: ethyl acetate. The product began to elute under 50% ethyl acetate and was dragged on the column. The fractions containing the product were merged to produce 2.25 g (48% yield) of compound 7 as a white solid.

[0637]

[0638] Compound 7 (1.00 g, 2.27 mmol) is added to a solution of 6-amino-1-hexanol (0.266 g, 2.27 mmol) and NEt (0.95 mL, 6.81 mmol) in DCM (50 mL). A white precipitate (ppt) is formed. After 18 hours, no SM remains by LC-MS. The reaction is concentrated by a rotary evaporator, and the residue is dissolved in about 8 mL of ethyl acetate, and is cooled to -20 ° C in a refrigerator. The precipitate is formed and deposited at the bottom of the flask. Ethyl acetate is decanted twice, and the precipitate is collected and vacuum dried to produce 0.95 grams (94% yield) of compound 8 as a white powder.

[0639]

[0640] In 100mL RBF, compound 8 (0.95g, 2.14mmol) is dried by 3 continuous evaporations of toluene. Diisopropylammonium tetrazole (0.146g, 0.86mmol) and 4 angstrom molecular sieves are added to the flask. The flask is purged with nitrogen and backfilled 3 times, and the solid is dissolved in DCM (50mL). The mixture is stirred for 30 minutes. After 30 minutes, 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (0.98g, 3.25mmol) is added, and the reaction is stirred for 18 hours. After 18 hours, LC-MS indicates that there is no starting alcohol remaining. The reaction is transferred to a separating funnel, with saturated NaHCO3 aqueous solution (2x 40mL), water (40mL), brine (40mL) washing, dried over magnesium sulfate and concentrated to dryness. Hexane is added to the flask, and the residue is stirred 2 hours in hexane, to produce a white precipitate. The white solid was collected by filtration, washed with hexanes ((2 x 20 mL), and dried under vacuum to yield 1.2 g (87% yield) of compound 9 as a white solid.

[0641] Synthesis of LP430-p

[0642]

[0643] To a round bottom flask with a solution of hexadecyl isocyanate (1 eq) in DCM (5 mL) was added a solution of 1,6-hexanediol (1 eq) and TEA (2 eq) in DCM (5 mL). This mixture was stirred at room temperature for 2 hours. The mixture was then concentrated under reduced pressure and purified via CombiFlash chromatography using 2% MeOH / DCM to give 20% yield of compound 1 as an off-white solid. LC-MS [M+H] + 386.3634m / z, measured 386.3642m / z.

[0644] Compound 1 (1 equivalent) is dried by two evaporations of toluene. Then, it is dissolved in anhydrous DCM (10 mL), and diisopropylammonium tetrazolium (1.4 equivalents) is added, followed by activated molecular sieves (100 mg). The mixture is stirred at room temperature for 30 minutes under N2 gas. Then, 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.6 equivalents) is added, and stirring is continued at room temperature for 12 hours. Afterwards, 0.3 mL of TEA is added to quench the reaction, and the mixture is directly loaded onto diatomaceous earth. CombiFlash chromatography using hexane: ethyl acetate + 1% TEA (70: 30) is performed to obtain a 41.7% yield of pure product as a waxy off-white solid. LC-MS [M + H] + 586.4713m / z, measured 586.4720m / z.

[0645] Synthesis of LP431-p

[0646]

[0647] To a round-bottom flask containing 6-amino-1-hexanol (1.2 eq.) and TEA (2 eq.) / DCM (5 mL), a solution of hexadecyl chloroformate (1 eq.) in DCM (5 mL) was added. The reaction mixture was stirred at room temperature for 2 hours. The mixture was then concentrated under reduced pressure and purified via CombiFlash chromatography using 2% MeOH / DCM to obtain 20% yield of compound 1 as an off-white solid. LC-MS [M+H] + 386.3634m / z, measured 386.3638m / z.

[0648] Compound 1 (1 equivalent) is dried by two evaporations of toluene. Then, it is dissolved in anhydrous DCM (10 mL), and diisopropylammonium tetrazolium (1.4 equivalents) is added, followed by activated molecular sieves (100 mg). The mixture is stirred at room temperature for 30 minutes under N2 gas. Then, 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.6 equivalents) is added, and stirring is continued at room temperature for 12 hours. Afterwards, 0.3 mL of TEA is added to quench the reaction, and the mixture is directly loaded onto diatomaceous earth. CombiFlash chromatography using hexane: ethyl acetate + 1% TEA (70: 30) obtains 82.3% yield of pure product as a waxy off-white solid. LC-MS [M + H] + 586.4713m / z, measured 586.4705m / z.

[0649] Synthesis of LP435-p

[0650]

[0651] Undecanoic acid (2.0 g, 10.7 mmol) was dissolved in toluene (30 mL), and triethylamine (3.0 mL, 21.5 mmol) and diphenylphosphoryl azide (3.84 g, 14.0 mmol) were added. The reaction was stirred overnight. Acyl azide was observed by mass spectrometry under alkaline conditions. The mixture was concentrated, and the crude product was purified by silica gel chromatography (0: 100 ethyl acetate: hexane to 20: 80 ethyl acetate: hexane), and the product was eluted at 10% ethyl acetate. The fraction containing the product was concentrated to produce 0.975 g (43% yield) of compound 21 as a clear liquid.

[0652]

[0653] Compound 21 (0.975, 5.2mmol) is dissolved in toluene (40mL), and is heated to 65 ℃ for 1 hour. Gas precipitation is observed when reaching 65 ℃, and stops after about 30 minutes. The reaction mixture is cooled to room temperature. In a separate flask, 1-amino-12-dodecanol (1.05g, 5.2mmol) is dissolved in THF (20mL) and pyridine (0.85mL, 10.5mmol). Toluene solution is added to THF solution, and white precipitate is formed quickly. The reaction is stirred overnight. The reaction mixture is concentrated, and the crude product is recrystallized from isopropanol to produce 1.5558g (77% yield) of compound 22 as a white solid.

[0654]

[0655] In 100mL RBF, compound 22 (1.55g, 4.0mmol) is dried by 2 continuous evaporations of toluene. Diisopropylammonium tetrazolium (0.277g, 1.6mmol) and 4 angstrom molecular sieves are added to the flask. The flask is purged with nitrogen and backfilled 3 times, and the solid is suspended in DCM (20mL). The solid is only partially dissolved. 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.88g, 6.2mmol) is added to the mixture, and the reaction is stirred for 18 hours. LC-MS indicates that there is no starting alcohol remaining. The reaction is transferred to a separating funnel, washed with saturated NaHCO3 aqueous solution (2x 40mL), water (40mL), brine (40mL), dried over sodium sulfate and concentrated to dryness. Hexane is added to the flask, and the residue is stirred 1 hour in hexane, to produce a white precipitate. The white solid was collected by filtration, washed with hexanes ((2 x 20 mL) and dried in vacuo to yield 1.103 g of a white powder. Proton NMR indicated a large amount of water remaining and a significant amount of material was insoluble in chloroform and DCM. The mixture was suspended in DCM, dried over magnesium sulfate, filtered through an additional pad of magnesium sulfate, and concentrated to yield 0.46 g (19% yield) of compound LP435-p as an off-white powder.

[0656] Synthesis of LP439-p

[0657]

[0658] (3-aminobicyclo[1.1.1]pentane-1-yl)methanol (2) (0.20g, 1.77mmol) and 2,5-dioxopyrrolidin-1-yl hexadecylcarbamate (3) (0.67g, 1.75mmol) were dissolved in DCM (40mL), followed by the addition of triethylamine (0.72mL, 5.3mmol). The reaction was stirred overnight. Precipitate was observed after 18 hours. The precipitate was collected by filtration and washed with DCM (2x 10mL). The precipitate was vacuum dried to produce 0.325g (48% yield) of white solid. Proton NMR analysis was consistent with the product, and the crude material had an acceptable purity to proceed to the next step.

[0659]

[0660] Compound 1 (0.3 gram, 0.79mmol) is dried by 4 continuous evaporations carried out with toluene, then diisopropylammonium salt tetrazolium (0.054g, 0.315mmol) is added in flask.Flask is purged with nitrogen and backfilled 3 times, solid is suspended in DCM (20mL), and 2-cyanoethyl N, N, N ', N '-tetraisopropyl phosphorodiamidite (0.39mL, 1.214mmol) is added, and reaction is stirred 18 hours.After 18 hours, LC-MS analysis indicates that there is no starting alcohol remaining.Reaction is transferred in separating funnel, with saturated NaHCO the aqueous solution (2x 40mL), water (40mL) are washed and concentrated into drying.Hexane is added in residue, and mixture is stirred 1 hour, to produce white precipitate. The precipitate was collected by filtration, washed with hexanes, and dried in vacuo to yield 0.395 g (86% yield) of LP439-p as a white solid.

[0661] Synthesis of LP440-p

[0662]

[0663] Anhydrous MeOH (8mL) was cooled to 0°C, potassium hydroxide (3 equivalents) was added, and the solution was stirred for 30 minutes. A solution of 16-bromohexadecanoic acid (1 equivalent) in anhydrous MeOH (7mL) was then added via a syringe. The reaction mixture was heated to reflux temperature and stirred overnight. After cooling to room temperature, MeOH was removed in a vacuum, and the resulting crude mixture was redissolved in 1NHCl (25mL) and diethyl ether (5mL). The crude product was extracted with diethyl ether (4x 30mL), the combined organic layers were washed with brine (30mL) and dried over Na2SO4, and then the solvent was removed in a vacuum. The product was then purified on silica gel using hexane: ethyl acetate (85:15) via column chromatography to obtain 86% yield of compound 1 as an oil. LC-MS[M+H] + 287.2586m / z, measured 287.2590.

[0664] To a solution of compound 1 (1 eq.) in DCM (50 mL) was added COMU (1.2 eq.) and DIPEA (2 eq.). The mixture was stirred at room temperature for 30 minutes. Then, 6-amino-1-hexanol (1.2 eq.) was added, and the reaction mixture was stirred at room temperature for 12 hours. Then, the mixture was washed three times with 1MHCl (3x 50 mL), washed once with brine (50 mL), dried over Na2SO4, and concentrated under reduced pressure. ACN (100 mL) was added to the crude product, and heated carefully with a heat gun until all solids dissolved. The mixture was then placed at room temperature, which allowed white crystals to form. The precipitate was then collected via vacuum filtration, and washed several times with ACN to remove the remaining pink. A 74% yield of compound 2 was obtained as a white solid. LC-MS[M+H] + 386.3634m / z, measured 386.3626.

[0665] Compound 3 (1 equivalent) is dried by two evaporations of toluene. Then, it is dissolved in anhydrous DCM (10mL), and diisopropylammonium tetrazolium (0.4 equivalent) is added, followed by activated molecular sieves (100mg). The mixture is stirred at room temperature for 30 minutes under N2 gas. Then, 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.5 equivalents) is added, and stirring is continued at room temperature for 12 hours. Afterwards, 0.3mL of TEA is added to quench the reaction, and the mixture is directly loaded onto diatomaceous earth. CombiFlash chromatography is carried out using hexane: ethyl acetate + 1% TEA (70: 30) to obtain a pure product of a waxy off-white solid in 86% yield. LC-MS [M+H] + 586.4713m / z, measured 586.4705.

[0666] Synthesis of LP441-p

[0667]

[0668] 1-Bromohexadecane (1 eq.) and TEA (1.1 eq.) were added to a round-bottom flask containing a solution of 6-amino-1-hexanol (2 eq.) in EtOH (20 mL). This mixture was refluxed for 12 hours. The solution was then allowed to cool to room temperature and the solvent was removed in vacuo. Next, the crude product was dissolved in H2O (20 mL) and extracted three times with CH3Cl (3 x 25 mL). The combined organics were washed once with brine (20 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude mixture was purified by CombiFlash chromatography using 10% MeOH / DCM+1% TEA to obtain 44% yield of compound 1 as an oil. LC-MS[M+H] + 342.3736m / z, measured 342.3728.

[0669] In a round bottom flask containing compound 1 (1 eq.) / MeOH (25 mL) was added ethyl trifluoroacetate (5 eq.) and DIPEA (2 eq.). The reaction mixture was stirred at 40 °C for 12 hours. Afterwards, the solvent was removed under reduced pressure and the crude was purified via CombiFlash chromatography using 4%-6% MeOH / DCM to give compound 2 in 73% yield as an oil. LC-MS [M+H] + 438.3559m / z, measured 438.3551.

[0670] Compound 2 (1 equivalent) is dried by two evaporations of toluene. Then, it is dissolved in anhydrous DCM (10mL), and diisopropylammonium tetrazolium (0.4 equivalent) is added, followed by activated molecular sieves (100mg). The mixture is stirred at room temperature for 30 minutes under N2 gas. Then, 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.5 equivalents) is added, and stirring is continued at room temperature for 12 hours. Afterwards, 0.3mL of TEA is added to quench the reaction, and the mixture is directly loaded onto diatomaceous earth. CombiFlash chromatography is carried out using hexane: ethyl acetate + 1% TEA (70: 30) to obtain a 56% yield of pure product as a waxy off-white solid. LC-MS [M+H] + 638.4637m / z, measured 638.4629.

[0671] Synthesis of LP456-p

[0672]

[0673] A 1 M solution of borane-tetrahydrofuran complex in tetrahydrofuran (1.5 eq) was added dropwise to a solution of 16(tert-r (1 eq) in dry tetrahydrofuran (20 mL) at 0°C under nitrogen. The resulting solution was stirred at 0°C for 2 hours, then the cooling bath was removed and the mixture was stirred at room temperature overnight. A saturated aqueous solution of sodium bicarbonate (50 mL) was added to quench the reaction. The mixture was then diluted with water (50 mL) and extracted three times with DCM (3 x 50 mL). The combined organics were dried over Na2SO4 and concentrated under reduced pressure. The crude product was purified via CombiFlash chromatography using hexane:ethyl acetate (80:20) to give 82% yield of compound 1 as an oil. LC-MS [M+H] + 329.3056m / z, measured 329.5060.

[0674] A mixture of compound 1 (1 eq.), silver carbonate (3 eq.) and a catalytic amount of iodine in DCM (5 mL) was stirred with molecular sieves for 15 minutes. 2,3,4,6-tetra-O-acetyl-α-D-pyranose glucopyranose bromide (1.5 eq.) / DCM (5 mL) was added to the mixture (also stirred with molecular sieves for 15 minutes). The resulting mixture was covered with aluminum foil and stirred at room temperature for 48 hours, then filtered through diatomaceous earth with ethyl acetate washing. The filtrate was concentrated, and the crude product was purified via CombiFlash column chromatography using hexane: ethyl acetate (80:20) to obtain 33% yield of compound 2 as an oil. LC-MS: [M+H2O] + 676.4034m / z, measured 676.4041.

[0675] TFA (15 mL) was added to a solution of compound 2 in DCM (5 mL). The solution was stirred at room temperature for 2 hours. Afterwards, the mixture was carefully poured into 100 mL of saturated NaHCO3 (water) solution. Once neutralized, the aqueous phase was extracted three times with DCM (3x100 mL). The combined organics were dried over Na2SO4 and concentrated under reduced pressure to give 97% yield of compound 3 as a white solid. LC-MS: [M+H] + 603.3381m / z, measured 603.3388.

[0676] To a solution of compound 3 (1 eq.) in DCM (10 mL) was added COMU (1.2 eq.) and DIPEA (2 eq.). The mixture was stirred at room temperature for 30 minutes. Then, 6-amino-1-hexanol (1.2 eq.) was added, and the reaction mixture was stirred at room temperature for 12 hours. Then, the mixture was washed three times with 1M HCl (3 x 10 mL), once with brine (10 mL), dried over Na2SO4, and concentrated under reduced pressure. The crude product was purified via CombiFlash chromatography using 0-100% hexane: ethyl acetate over 40 minutes to obtain 83% yield of compound 4 as an oil. LC-MS [M+H] + 702.4429m / z, measured 702.4421.

[0677] Compound 4 (1 equivalent) was concentrated twice with toluene by a rotary evaporator, and then anhydrous DCM (10 mL) was loaded into a reaction flask. The suspension was stirred at 900RPM with molecular sieves under N2 at ambient temperature. 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.5 equivalents) was added to the suspension, followed by diisopropylammonium tetrazolium salt (0.4 equivalents). After 12 hours, TEA (300uL) was added, and the reaction mixture was dry loaded onto diatomite. The product was purified using hexane: ethyl acetate + 1% TEA (60: 40) to obtain LP-456p, which is an oil, in a 64% yield. LC-MS [M+H] + 902.5507m / z, measured 902.5517.

[0678] Synthesis of LP462-p

[0679]

[0680] Anhydrous THF (30 mL) was added to a round-bottom flask containing 2099-117 (1 equivalent), and the solution was cooled to -20 ° C. Ethyl chloroformate (1.2) and N-methylmorpholine (1.2 equivalents) were added to the solution and stirred at -20 ° C to -10 ° C for 30 minutes. A solution of sodium azide (2.5 equivalents) in 1.5 mL of water was added to the reaction, and the reaction was stirred at -7 ° C for 90 minutes. The reaction was diluted with ethyl acetate. The water layer was separated and extracted with ethyl acetate for an additional 2 times. The combined organic layer was washed with brine, dried over Na2SO4, and concentrated into a transparent liquid. The liquid was dissolved in toluene (30 mL) and heated to 65 ° C for 1 hour, and no additional nitrogen formation was observed at this time. Next, the solution was concentrated under reduced pressure and then dissolved in 30 mL of anhydrous DCM. 6-amino-1-hexanol (3 equivalents) and pyridine (1 equivalent) were added to the reaction mixture and stirring continued for 12 hours. The mixture was concentrated under reduced pressure onto celite and purified via CombiFlash chromatography using 5% methanol / 95% DCM to give 51% yield of compound 1 as an oil. LC-MS [M+H2O] + 717.4538m / z, measured 717.4530.

[0681] Compound 1 (1 equivalent) was rotovap'd twice with toluene, and then anhydrous DCM (10 mL) was loaded into a reaction flask. The suspension was stirred at 900RPM with molecular sieves at ambient temperature under N2. 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.5 equivalents) was added to the suspension, followed by diisopropylammonium tetrazolium salt (0.4 equivalent). After 12 hours, TEA (300 uL) was added, and the reaction mixture was dry loaded onto diatomite. The product was purified using hexane: ethyl acetate + 1% TEA (60: 40) to obtain LP462-p, which is oily, in a 64% yield. LC-MS [M+H] + 916.5538m / z, measured 916.5543.

[0682] Synthesis of LP463-p

[0683]

[0684] To a solution of 16-hydroxyhexadecanoic acid (1.5 g, 5.5 mmol) in DCM (60 mL) was added acetic anhydride (8.3 mL, 88 mmol) followed by pyridine (13.75 mL, 171 mmol) at room temperature. The mixture was stirred overnight at room temperature. After removal of the solvent in vacuo, the residue was redissolved in DCM and dry loaded onto an 80 g column. Hexane to 50% ethyl acetate / hexane was used for purification. Compound 24 was obtained as a white solid, 1.22 g, 62%. LC-MS: Calculated [M+H+H2O] 375.27, found 374.80.

[0685]

[0686] A suspension of compound 24 (1.22 g, 3.4 mmol) in ACN (40 mL) and saturated aqueous NaHCO3 (10 mL) was stirred at room temperature overnight. The pH was adjusted to 1 with 1N HCl. The precipitate was collected by suction filtration and washed with H2O and air-dried to give 1.15 g (107% yield) of compound 25 as a white solid. The yield was greater than 100% due to residual water, as shown by 1 Determined by H NMR. LC-MS: calcd. [M+H] 315.25, found 315.59.

[0687]

[0688] At room temperature, COMU (1.8 g, 4.4 mmol) and tert-butyl 3-aminobicyclo [1.1.1] pentane-1-carboxylate (0.81 g, 4.4 mmol) were added to a solution of compound 25 (1.15 g, 3.66 mmol) and diisopropylethylamine (1.28 mL, 7.3 mmol) in DCM (40 mL). The mixture was stirred at room temperature for 2 hours. The reaction mixture was concentrated onto silica gel and purified by column chromatography, 100% hexane: 0% ethyl acetate to 0% hexane: 100% ethyl acetate. The fractions containing the product were combined and the solvent was removed via a rotary evaporator to produce 1.66 g (94% yield) of compound 26 as a brown solid. LC-MS: [M+H] 480.37 calculated, 480.76 found.

[0689]

[0690] TFA (10 mL) was added to a solution of compound 26 in DCM (10 mL), and the reaction was stirred at room temperature for 1.5 hours. After removing the solvent in a vacuum, the residue was dried in a high vacuum for 2 hours. The residue was dissolved in DCM (30 mL) and diisopropylethylamine (1.2 mL, 6.9 mmol). After the residue was dissolved, COMU (1.77 g, 4.1 mmol) and 6-amino-1-hexanol (0.49 g, 4.1 mmol) were added at room temperature. The mixture was stirred at room temperature for 2.5 hours. After removing part of the solvent in a vacuum, the residue was recrystallized with ACN. The product was collected by suction filtration and vacuum dried to produce 1.48 grams (82% yield) of compound 27 as an off-white solid. LC-MS: calculated [M+H] 523.41, measured 524.06.

[0691]

[0692] At room temperature, diisopropylammonium tetrazole (0.039 g, 0.23 mmol) was added to a mixture of compound 27 (0.3 g, 0.57 mmol) in DCM (20 mL), followed by dropwise addition of 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (0.277 g, 0.92 mmol). The mixture was then refluxed for 2 hours. After cooling to room temperature, the mixture was washed twice with saturated NaHCO (aqueous solution), followed by H2O washing. After removing almost all solvents in vacuo, the residue was added to the stirred hexane, and a white gel precipitate was formed. After filtration, the white solid was collected by suction filtration and washed twice with hexane. The white solid was dried in a high vacuum to produce 0.305 g (73% yield) of compound LP463-p as a white solid. LC-MS: calculated [M+H] 723.52, measured 724.23.

[0693] Synthesis of LP464-p

[0694]

[0695] To a solution of 16-amino-hexadecanoic acid (1 eq.) in anhydrous MeOH (20 mL) was added ethyl trifluoroacetate (1.5 eq.) and TEA (1.1 eq.). The reaction was stirred at 50 °C for 12 hours under a nitrogen atmosphere. The mixture was then concentrated under reduced pressure, diluted with ethyl acetate (30 mL), and washed twice with saturated KHSO4 (15 mL), once with brine (15 mL), dried over Na2SO4, and concentrated under reduced pressure to give 79% yield of compound 1 as a white solid. LC-MS [M+H] + 368.2412m / z, measured 368.2419.

[0696] To a solution of compound 1 (1 eq.) in DCM (30 mL) was added COMU (1.2 eq.) and DIPEA (2 eq.). The mixture was stirred at room temperature for 30 minutes. Then, 6-amino-1-hexanol (1.2 eq.) was added, and the reaction mixture was stirred at room temperature for 12 hours. Then, the mixture was washed three times with 1MHCl (3x 15 mL), washed once with brine (15 mL), dried over Na2SO4, and concentrated under reduced pressure. ACN (100 mL) was added to the crude product, and heated carefully using a heat gun until all solids dissolved. The mixture was then placed at room temperature, which allowed white crystals to form. The precipitate was then collected via vacuum filtration, and washed several times with ACN to remove the remaining pink. 82% yield of compound 2 as a white solid was obtained. LC-MS[M+H] + 467.3461m / z, measured 467.3457.

[0697] Compound 2 (1 equivalent) was concentrated twice with toluene on a rotary evaporator, and then anhydrous DCM (10 mL) was loaded into a reaction flask. The suspension was stirred at 900RPM with molecular sieves at ambient temperature under N2. 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (1.5 equivalents) was added to the suspension, followed by diisopropylammonium tetrazolium salt (0.4 equivalent). After 12 hours, TEA (300 uL) was added, and the reaction mixture was dry loaded onto diatomite. The product was purified using hexane: ethyl acetate + 1% TEA (60: 40) to obtain LP464-p as a waxy solid in a 77% yield. LC-MS [M + H] + 667.4539m / z, measured 667.4544.

[0698] Synthesis of LP465-p

[0699]

[0700] 17-methoxy-17-oxohexadecanoic acid (1.0 g, 3.2 mmol) was dissolved in THF (50 mL), and triethylamine (0.89 mL, 6.4 mmol) and DPPA (0.75 mL, 3.5 mmol) were added. The reaction was stirred overnight. The reaction mixture was concentrated and the crude product was purified by silica gel chromatography (20:80 ethyl acetate: hexane to 100:0 ethyl acetate: hexane). The product was eluted at 10% ethyl acetate. It was found that fractions 1-4 contained product, which was concentrated to produce 0.60 g (56% yield) of compound 17 as a white solid.

[0701]

[0702] Compound 17 (0.58 g, 1.7 mmol) was dissolved in toluene (20 mL) and heated to 65 ° C until no longer observed gas evolution (30 minutes). The solution was cooled to room temperature and then added into 6-amino-1-hexanol (0.2 g, 1.7 mmol) and pyridine (0.14, 1.7 mmol) / THF (20 mL). The reaction mixture was diluted with acetonitrile, and the precipitate was collected by suction filtration, rinsed with acetonitrile, hexane, and vacuum dried to produce 0.614 g (84% yield) of compound 19 as a white solid.

[0703]

[0704] In 100mL RBF, compound 19 (0.60g, 1.4mmol) is dried by 3 continuous evaporations of toluene. Diisopropylammonium salt tetrazolium (0.096g, 0.56mmol) and 4 angstrom molecular sieves are added in flask. Flask is purged with nitrogen and backfilled 3 times, and solid is suspended in DCM (40mL). Solid is only partially dissolved. 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (0.65g, 2.2mmol) is added to the mixture, and the reaction is stirred for 18 hours. LC-MS after 18 hours indicates that there is no starting alcohol remaining. The reaction is transferred to a separating funnel, with saturated NaHCO3 aqueous solution (2x 40mL), water (40mL) washing, and concentrated to dryness. Hexane is added in a flask, and residue is stirred 2 hours in hexane, to produce a white precipitate. The white solid was collected by filtration, washed with hexanes ((2 x 20 mL), and dried under vacuum to yield 0.678 g (77% yield) of LP465-p as a white solid.

[0705] Synthesis of LP466-p

[0706]

[0707] Compound 7 (0.22g, 0.50mmol) and 3-aminobicyclo [1.1.1] pentane-1-carboxylic acid tert-butyl ester (0.0915g, 0.50mmol) are dissolved in DCM (10mL), and triethylamine (0.21mL, 1.5mmol) is added. After 18 hours, by LC-MS, <2% of the starting NHS ester remains. The reaction mixture is concentrated and directly loaded onto a silica gel column for purification. The product is purified by column chromatography of 0% ethyl acetate / 100% hexane to 50% ethyl acetate 50% hexane. Fractions 3-5 are merged to produce 0.23g (89% yield) of compound 10 as a white solid.

[0708]

[0709] Compound 10 (0.23 g, 0.45 mmol) was dissolved in DCM (3 mL) and trifluoroacetic acid (3 mL) was added. The solution was stirred overnight. After 18 hours, there was no SM by LC-MS. The reaction mixture was concentrated and residual TFA was removed by coevaporation with toluene 2 times to produce 0.189 mg (93%) of compound 11 as a white solid.

[0710]

[0711] Compound 11 (0.189g, 0.48mmol) and COMU (0.215g, 0.5mmol) are dissolved in DCM (10mL), and triethylamine (0.333mL, 2.4mmol) is added. The reaction was stirred for about 5 minutes, and then 6-amino-1-hexanol (0.059g, .5mmol) was added. After 1 hour, by LC-MS, no starting material remained. The reaction mixture was concentrated, and water was added to the residue. The mixture was subjected to ultrasonication until all materials were suspended in water, and the precipitate was collected by filtration and washed with water 3 times. The precipitate was vacuum dried to produce 0.166g (70% yield) of compound 12 as a white solid.

[0712]

[0713] In 100mL RBF, compound 12 (0.166g, 0.3mmol) is dried by 2 continuous evaporations of toluene. Diisopropylammonium tetrazolium (0.02g, 0.12mmol) and 4 angstrom molecular sieves are added to the flask. The flask is purged with nitrogen and backfilled 3 times, and the solid is suspended in DCM (20mL). The solid is only partially dissolved. 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (0.14g, 0.46mmol) is added to the mixture, and the reaction is stirred for 18 hours. After 18 hours, LC-MS indicates that there is no starting alcohol remaining. The reaction is transferred to a separating funnel, with saturated NaHCO3 aqueous solution (2x 40mL), water (40mL), brine (40mL) washing, dried over magnesium sulfate and concentrated to dryness. Hexane is added to the flask, and the residue is stirred in hexane for 1 hour, to produce a white precipitate. The white solid was collected by filtration, washed with hexanes ((2 x 20 mL), and dried under vacuum to yield 0.116 g (51% yield) of LP-466p as a white waxy solid.

[0714] Synthesis of LP493-p (shown as LP493-p uridine)

[0715]

[0716] Triethylamine (2.9mL, 20.5mmol) is added to a solution of 1-bromohexadecane-16-alcohol (6.0g, 18.7mmol) in DCM (90mL). The resulting solution is cooled to 0°C in an ice / water bath. After cooling, acetyl chloride (1.46mL, 20.5mmol) is added dropwise. After the addition is complete, the reaction is stirred at 0°C for 1 hour, then allowed to warm to room temperature and stirred overnight. After about 18 hours, the reaction mixture is washed with saturated NaHCO (20mL), water, 1M HCl (20mL), water (2x 20mL), brine (20mL), dried over sodium sulfate and concentrated into a white solid. The crude product is purified by silica gel chromatography (0: 100 ethyl acetate: hexane to 20: 80 ethyl acetate: hexane). The product is eluted at 10% ethyl acetate. Fraction 5-12 is concentrated to produce 6.02g (89% yield) of compound 29 as a white powder.

[0717]

[0718] Compound 31 was prepared according to literature procedures. Compound 31 (1.0 g, 2.1 mmol), compound 29 (1.53 g, 4.2 mmol) and tetrabutylammonium iodide (1.6 g, 0.42 mmol) were placed in a dried flask. The flask was evacuated and purged three times with nitrogen, and then dry DMF (10 mL) was added to the flask. The solution was heated to 110 ° C for 18 hours. After 18 hours, the reaction was cooled to room temperature, and the solvent was removed in a vacuum. The residue was resuspended in DCM / MeOH and concentrated onto silica gel for purification. 3% MeOH / 97% DCM was used to elute the column to 20% MeOH / 80% DCM. The fractions containing 2' and 3' addition products were combined and concentrated to produce 0.236 g (21% yield) of compound 30 plus 3' addition products.

[0719]

[0720] Compound 30+3' addition product (0.23 g, 0.44 mmol) was dried by continuous evaporation of toluene and anhydrous pyridine using a rotary evaporator. DMAP (0.003 g, 0.022 mmol) and dimethoxytrityl chloride (0.165 g, 0.49 mmol) were added to a flask, and the flask was evacuated and purged with nitrogen 3 times. The solid was dissolved in pyridine (10 mL). The reaction was stirred overnight at room temperature. All volatiles were removed and residual pyridine was removed by co-distillation with toluene. The residue was divided between DCM (20 mL) and NaHCO3 aqueous solution (20 mL). The organic phases were separated, the aqueous phase was extracted with DCM (20 mL), and the combined organic phases were dried (Na2SO4) and concentrated. The crude product was purified by silica gel chromatography. Silica was pretreated with a 50:50 mixture of hexane / ethyl acetate + 2% by volume triethylamine. The product was separated on CombiFlash using a 40 g column, eluent: hexane-ethyl acetate + 1% Et3N, 20-60% compound eluted at 60% ethyl acetate. The later fractions were contaminated with 3' alkylated product. The fractions containing pure 2' alkylated product were combined and concentrated to yield 0.107 g (27% yield) of compound 32 as a white solid.

[0721]

[0722] In 25mL RBF, compound 32 (0.150g, 0.18mmol) and diisopropylammonium salt tetrazolium (0.043g, 0.25mmol) and 4 angstrom molecular sieves were placed, and the flask was evacuated and purged with nitrogen 3 times. DCM (5mL) was added, followed by dropwise addition of 2-cyanoethyl N, N, N', N'-tetraisopropylphosphorodiamidite (0.092mL, 0.29mmol). The reaction was stirred overnight. The reaction mixture was quenched with ~2mL saturated NaHCO3, filtered into a separating funnel, each layer was separated and the NaHCO3 layer was extracted with DCM (10mL) for an additional 1 time. The combined organic layer was dried over Na2SO4 and concentrated into a viscous liquid. The crude product was purified by silica gel chromatography (0:100 ethyl acetate: hexane to 100:0 ethyl acetate: hexane). The silica was pretreated with a 50:50 mixture of hexane / ethyl acetate + 2% volume ratio triethylamine. The product eluted at 45% ethyl acetate. Fractions 15-35 were found to contain product with little contamination of oxidation products and were combined to produce 0.088 g (47% yield) of compound 33 as a sticky colorless solid. Fractions 36-50 were combined to produce 44 mg of a sticky colorless solid and contained product with more oxidation material.

[0723] Synthesis of (2C8C12)phosphoramidite

[0724]

[0725] 2-octyl-1-decanol (1.00 grams, 3.35mmol) and diisopropylammonium salt tetrazolium (0.2868 grams, 1.68mmol) are placed in a flask, and the flask is purged with nitrogen. DCM (50mL) is added to the mixture, and 2-cyanoethyl N, N, N ', N '-tetraisopropyl phosphorodiamidite (2.66mL, 8.37mmol) is added dropwise. After the reaction is complete, 3mL of triethylamine is added to the reaction, and the reaction is directly concentrated onto diatomaceous earth for purification. Purify the crude product by silica gel chromatography (0: 100 ethyl acetate: hexane + 2% triethylamine to 100: 0 ethyl acetate: hexane + 2% triethylamine). The product is eluted with 100% hexane. The fraction containing the product is concentrated into a transparent liquid of 1.268g (76% yield).

[0726] Synthesis of (2C6C10)phosphoramidite

[0727]

[0728] 2-hexyl-1-decanol (1.00g, 4.13mmol) and diisopropylammonium salt tetrazolium (0.353g, 2.06mmol) are placed in a flask, and the flask is purged with nitrogen. DCM (50mL) is added to the mixture, and 2-cyanoethyl N, N, N ', N '-tetraisopropyl phosphorodiamidite (3.27mL, 10.3mmol) is added dropwise. After the reaction is completed, 3mL of triethylamine is added to the reaction, and the reaction is directly concentrated onto diatomaceous earth for purification. Purify the crude product by silica gel chromatography (0: 100 ethyl acetate: hexane + 2% triethylamine to 100: 0 ethyl acetate: hexane + 2% triethylamine). The product is eluted with 100% hexane. The fraction containing the product is concentrated into a transparent liquid of 1.32g (72% yield).

[0729] Synthesis of HO-C16 Phosphoramidite

[0730]

[0731] 1,16-hexadecanediol, N,N-diisopropylethylamine (0.100 g) were dissolved in 2 mL THF. 4,4'-dimethoxytrityl chloride (2.2 g, 6.6 mmol) was slowly added as a solid. After 2 hours, the reaction was concentrated by rotary evaporation and the product was purified by column chromatography (25% ethyl acetate / 75% hexanes).

[0732] At room temperature, DMT-OC 16-OH (0.200 g), bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.227 mL) and bis(diisopropylammonium tetrazolium salt) (0.0611 g) were dissolved in anhydrous DCM. The reaction was capped and stirred overnight. Conversion was determined by LC-MS (0.25 M NH4HCO3:H2O buffer system). was added to the reaction mixture and it was concentrated in vacuo until a white powder remained. The mixture was dry loaded onto a silica column (12 g) using an ethyl acetate / hexane (1% triethylamine) solvent system to prevent hydrolysis from the silica gel. [1] pass 31 PNMR, 1 The product was characterized by HNMR and LC-MS.

[0733] Synthesis of C16 Phosphoramidite

[0734]

[0735] Cetyl alcohol (1.10 g), bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.88 mL) and bis(diisopropylammonium tetrazolium salt) (0.778 g) were dissolved in a solution of DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined via LC-MS (0.25 M NH4HCO3:H2O buffer system). Add to the reaction mixture, and it is concentrated in vacuo until a residual white powder remains. The mixture is dry loaded onto a silica column (12 g) using an ethyl acetate / hexane (1% triethylamine) solvent system to prevent hydrolysis from the silica gel. The desired product is not retained on the column and comes out shortly after loading. It is then analyzed by LC-MS, 1 HNMR and 31 The isolated product was characterized by PNMR. Final yield: 856.5 mg (93.8%).

[0736] Synthesis of C22 Phosphoramidite

[0737]

[0738] Docosanol (1.10 g), bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.1 mL) and bis(diisopropylammonium tetrazolium salt) (0.577 g) were dissolved in a solution of DCM at room temperature. The reaction was capped and stirred overnight. Conversion was determined by LC-MS (0.25 M NH4HCO3:H2O buffer system). Add to the reaction mixture, and it is concentrated in vacuo until a white powder remains. The mixture is dry loaded onto a silica column (12 g) pretreated with 3 mL of triethylamine, using an ethyl acetate / hexane (1% triethylamine) solvent system to prevent hydrolysis from the silica gel. The column is then analyzed by LC-MS, 1 HNMR and 31 The isolated product was characterized by PNMR. Final yield: 2.1085 g (118.8%).

[0739] Conjugation of lipid PK / PD modulator precursors

[0740] One or more lipid PK / PD modulator precursors can be linked to the RNAi agents disclosed herein before annealing or after annealing. The following describes a general conjugation method for linking lipid PK / PD modulator precursors to the constructs set forth in the Examples depicted herein.

[0741] A. Conjugation of Activated Ester PK / PD Modulators

[0742] The following procedure is used to conjugate a PK / PD modulator with an activated ester moiety, such as TFP (tetrafluorophenoxy) or PNP (p-nitrophenol), to an RNAi agent with an amine-functionalized sense strand, such as C6-NH2, NH2-C6, or (NH2-C6). The annealed RNAi agent dried by freeze drying was dissolved in DMSO and 10% water (volume %) at 25 mg / mL. Then 50-100 equivalents of TEA and 3 equivalents of the activated ester PK / PD modulator were added to the solution. The solution was allowed to react for 1-2 hours while being analyzed by RP-HPLC-MS (mobile phase A 100 mM HFIP, 14 mM TEA; mobile phase B: Waters TM Acetonitrile on XBridge C18 column, Waters Corp.)

[0743] The product was then precipitated by adding 12 mL of acetonitrile and 0.4 mL of PBS and centrifuging the solid into a pellet. The pellet was then redissolved in 0.4 mL of 1XPBS and 12 mL of acetonitrile. The pellet was dried in a high vacuum for one hour.

[0744] B. Conjugation of Phosphoramidite PK / PD Modulators

[0745] PK / PD modulators having phosphoramidite moieties can be attached to the resin using typical oligonucleotide manufacturing conditions.

[0746] C. Hydrolysis of PK / PD Modulators

[0747] Certain PK / PD modulators are hydrolyzed under the cleavage and deprotection conditions described above in Example 1. For example, LP-429p, LP-456p, LP-462p, LP-463p, LP-464p, LP-466p, LP-493p, and HO-C16 phosphoramidite all include moieties that hydrolyze under the cleavage and deprotection conditions.

[0748] LP-465p was hydrolyzed after conjugation to the oligonucleotide chain in a solution of 0.5-1 M potassium carbonate in 1:1 methanol / water and heated to 50-60°C for approximately 4 hours.

[0749] Example 2. In vivo knockdown of SOD1 in transgenic B6.Cg-Tg (SOD1*G93A) mice

[0750] On study day 1, B6.Cg-Tg (SOD1*G93A) mice were injected with 10 μL of phosphate buffered saline (PBS), or 10 μL of a compound formulation at a concentration of 5 mg / mL in PBS for Groups 2, 4, and 6, or 10 μL of a compound formulation at a concentration of 20 mg / mL in PBS for Groups 3, 5, and 7, according to Table 12 below:

[0751] Table 12: Dosage groups of mice in Example 2.

[0752]

[0753]

[0754] Four (n=4) mice in each group were dosed. On day 1, mice were injected intracerebroventricularly. On day 12, mice were euthanized, and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR. The average results for each group are shown in Table 13 below:

[0755] Table 13. For each administration group in Example 2, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0756]

[0757]

[0758] As shown in Table 13, SOD1 RNAi agents AC001455 and AC001465 showed dose-dependent improvement in mRNA knockdown compared to the PBS-administered group in each tissue analyzed.

[0759] Example 3. In vivo knockdown of SOD1 in transgenic B6.Cg-Tg (SOD1*G93A) mice

[0760] On study day 1, B6.Cg-Tg (SOD1*G93A) mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 7 mg / mL in aCSF according to Table 14 below:

[0761] Table 14: Dosage groups for mice in Example 3.

[0762] Group ID Animals Administered AC duplex numbering Group 1 (aCSF) n＝3 not applicable Group 2 (70 μg LP183-AD09381) n＝3 AC001451 Group 3 (70 μg LP183-AD09382) n＝3 AC001452 Group 4 (70 μg LP183-AD09384) n＝3 AC001454 Group 5 (70 μg LP183-AD09385) n＝3 AC001455 Group 6 (70 μg LP183-AD09386) n＝3 AC001456 Group 7 (70 μg LP183-AD09388) n＝3 AC001458 Group 8 (70 μg LP183-AD09389) n＝3 AC001459 Group 9 (70 μg LP183-AD09390) n＝3 AC001460 Group 10 (70 μg LP183-AD09391) n＝3 AC001461 Group 11 (70 μg LP183-AD09392) n＝3 AC001462 Group 12 (70 μg LP183-AD09393) n＝3 AC001463 Group 13 (70 μg LP183-AD09396) n＝3 AC001466 Group 14 (70 μg LP183-AD09397) n＝3 AC001467 Group 15 (70 μg LP183-AD09400) n＝3 AC001470 Group 16 (70 μg LP183-AD09401) n＝3 AC001471 Group 17 (70 μg LP183-AD09402) n＝3 AC001472 Group 18 (70 μg LP183-AD09403) n＝3 AC001473

[0763] On day 1, mice were injected intracerebroventricularly. On day 12, mice were euthanized and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR. The average results of each group in the thoracic spinal cord are shown in Table 15 below:

[0764] Table 15. Relative expression of SOD1 mRNA in the thoracic spinal cord of mice analyzed by qPCR for each dosing group in Example 3.

[0765]

[0766] As shown in Table 15, a few dosing groups showed significant improvement in mRNA knockdown compared to the aCSF administration group. For example, SOD1 RNAi agent AC001455 showed a decrease of about 32% (0.680), and SOD1 RNAi agent AD001461 showed a decrease of about 35% (0.643).

[0767] Example 4. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0768] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 10 mg / mL in aCSF according to Table 16 below:

[0769] Table 16: Dosage groups of mice in Example 4.

[0770]

[0771]

[0772] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0773] The mean results for each group are shown in Table 17 below:

[0774] Table 17. For each administration group in Example 4, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0775]

[0776] As shown in Table 17, each dosing group demonstrated numerical improvement in mRNA knockdown compared to the aCSF-administered group in every tissue analyzed, with AC001455, AC001461, and AC001623 showing particularly potent inhibition across several different tissue types.

[0777] Example 5. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0778] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 10 mg / mL in aCSF according to Table 18 below:

[0779] Table 18: Dosing groups of mice in Example 5.

[0780] Group ID Animals Administered AC duplex numbering Group 1 (aCSF) n＝3 not applicable Group 2 (100 μg LP183-AD09385) n＝3 AC001455 Group 3 (100 μg LP183-AD10055) n＝3 AC001809 Group 4 (100 μg LP183-AD10056) n＝3 AC001810 Group 5 (100 μg LP183-AD10057) n＝3 AC001811 Group 6 (100 μg LP183-AD10058) n＝3 AC001812 Group 7 (100 μg LP183-AD10059) n＝3 AC001813 Group 8 (100 μg LP183-AD10061) n＝3 AC001814 Group 9 (100 μg LP183-AD10066) n＝3 AC001815 Group 10 (100 μg LP183-AD10067) n＝3 AC001816 Group 11 (100 μg LP183-AD10068) n＝3 AC001817 Group 12 (100 μg LP183-AD10069) n＝3 AC001818 Group 13 (100 μg LP183-AD10070) n＝3 AC001819 Group 14 (100 μg LP183-AD10071) n＝3 AC001820 Group 15 (100 μg LP183-AD10072) n＝3 AC001821 Group 16 (100 μg LP183-AD10073) n＝3 AC001822

[0781] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0782] The mean results for each group are shown in Table 19 below:

[0783] Table 19. For each administration group in Example 5, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0784]

[0785]

[0786]

[0787] As shown in Table 19, each dosing group showed numerical improvements in mRNA knockdown compared to the aCSF administration group in various tissues analyzed. Notably, AC001813, AC001814, and AC001818 showed particularly potent inhibition of SOD1 gene expression across all tissues examined.

[0788] Example 6. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0789] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 10 mg / mL in aCSF according to Table 20 below:

[0790] Table 20: Dosage groups of mice in Example 6.

[0791] Group ID Animals Administered AC duplex numbering Group 1 (aCSF) n＝3 not applicable Group 2 (100 μg LP183-AD09391) n＝3 AC001461 Group 3 (100 μg LP183-AD10077) n＝3 AC001801 Group 4 (100 μg LP183-AD10078) n＝3 AC001802 Group 5 (100 μg LP183-AD10079) n＝3 AC001803 Group 6 (100 μg LP183-AD10080) n＝3 AC001804 Group 7 (100 μg LP183-AD10081) n＝3 AC001805 Group 8 (100 μg LP183-AD10082) n＝3 AC001806 Group 9 (100 μg LP183-AD10083) n＝3 AC001807 Group 10 (100 μg LP183-AD10084) n＝3 AC001808

[0792] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0793] The mean results for each group are shown in Table 21 below:

[0794] Table 21. For each dosing group in Example 6, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0795]

[0796]

[0797] As shown in Table 21, nearly every dosing group showed improved mRNA knockdown compared to the aCSF administration group in most tissues analyzed.

[0798] Example 7. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0799] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF) or 10 μL of compound formulations at a concentration of 5 mg / mL in aCSF according to Table 22 below:

[0800] Table 22: Dosing groups of mice in Example 7.

[0801]

[0802]

[0803] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0804] The mean results for each group are shown in Table 23 below:

[0805] Table 23. For each dosing group in Example 7, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0806]

[0807]

[0808] As shown in Table 23, each dosing group showed improved mRNA knockdown compared to the aCSF administration group in the various tissues analyzed.

[0809] Example 8. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0810] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 5 mg / mL in aCSF according to Table 24 below:

[0811] Table 24: Dosing groups of mice in Example 8.

[0812] Group ID Animals Administered AC duplex numbering Group 1 (aCSF) n＝4 not applicable Group 2 (50 μg LP183-AD10082) n＝4 AC001806 Group 3 (50 μg LP183-AD10083) n＝4 AC001807 Group 4 (50 μg LP183-AD10573) n＝4 AC002102 Group 5 (50 μg LP183-AD10574) n＝4 AC002103 Group 6 (50 μg LP183-AD10575) n＝4 AC002104 Group 7 (50 μg LP183-AD10576) n＝4 AC002105 Group 8 (50 μg LP183-AD10577) n＝4 AC002106 Group 9 (50 μg LP183-AD10578) n＝4 AC002107 Group 10 (50 μg LP183-AD10579) n＝4 AC002108 Group 11 (50 μg LP183-AD10580) n＝4 AC002109 Group 12 (50 μg LP183-AD10581) n＝4 AC002110

[0813] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0814] The mean results for each group are shown in Table 25 below:

[0815] Table 25. For each dosing group in Example 8, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0816]

[0817] As shown in Table 25, each dosing group showed improvement in mRNA knockdown in the thoracic spinal cord, cerebellum, and brainstem compared to the aCSF administration group.

[0818] Example 9. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0819] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 3 mg / mL in aCSF according to Table 26 below:

[0820] Table 26: Dosage groups of mice in Example 9.

[0821] Group ID Animals Administered AD duplex numbering Group 1 (aCSF) n＝3 not applicable Group 2 (30 μg LP183-AD11196) n＝3 AD11196 Group 3 (30 μg LP183-AD11384) n＝3 AD11384 Group 4 (30 μg LP183-AD11385) n＝3 AD11385 Group 5 (30 μg LP183-AD11386) n＝3 AD11386 Group 6 (30 μg LP183-AD11387) n＝3 AD11387 Group 7 (30 μg LP183-AD11388) n＝3 AD11388 Group 8 (30 μg LP183-AD11389) n＝3 AD11389 Group 9 (30 μg LP183-AD11390) n＝3 AD11390 Group 10 (30 μg LP183-AD11391) n＝3 AD11391

[0822] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0823] The mean results for each group are shown in Table 27 below:

[0824] Table 27. For each dosing group in Example 9, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0825]

[0826]

[0827] As shown in Table 27, nearly every dosing group showed significant improvements in mRNA knockdown compared to the aCSF-administered group in every tissue analyzed.

[0828] Example 10. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0829] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 3 mg / mL in aCSF according to Table 28 below:

[0830] Table 28: Dosing groups of mice in Example 10.

[0831]

[0832]

[0833] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0834] The mean results for each group are shown in Table 29 below:

[0835] Table 29. For each dosing group in Example 10, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0836]

[0837]

[0838] Example 11. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A mice

[0839] On study day 1, Tg SOD1 G93A mice were injected with 10 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or 10 μL of compound formulations at a concentration of 1 mg / mL in aCSF for Groups 2-4, 10 μL of compound formulations at a concentration of 3 mg / mL in aCSF for Groups 5-7, and 10 μL of compound formulations at a concentration of 10 mg / mL in aCSF for Groups 8-10 according to Table 30 below:

[0840] Table 30: Dosing groups of mice in Example 11.

[0841] Group ID Animals Administered AC duplex numbering Group 1 (aCSF) n＝3 not applicable Group 2 (10 μg LP183-AD10083) n＝3 AC001807 Group 3 (10 μg LP183-AD11556) n＝3 AC002478 Group 4 (10 μg LP293-AD11556) n＝3 AC002479 Group 5 (30 μg LP183-AD10083) n＝3 AC001807 Group 6 (30 μg LP183-AD11556) n＝3 AC002478 Group 7 (30 μg LP293-AD11556) n＝3 AC002479 Group 8 (100 μg LP183-AD10083) n＝3 AC001807 Group 9 (100 μg LP293-AD11556) n＝3 AC002478 Group 10 (100 μg LP293-AD11556) n＝3 AC002479

[0842] On day 1, mice were injected intracerebroventricularly. On day 8, mice were euthanized and the left hemibrain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right hemibrain, thoracic spinal cord, cortex, cerebellum, and brainstem. Samples were analyzed for SOD1 mRNA knockdown by qPCR.

[0843] The mean results for each group are shown in Table 31 below:

[0844] Table 31. For each dosing group in Example 11, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0845]

[0846] As shown in Table 31, nearly every dosing group showed improved mRNA knockdown compared to the aCSF-administered group in every tissue analyzed.

[0847] Example 12. In vivo knockdown of SOD1 in transgenic Tg SOD1 G93A rats

[0848] On study day 1, Tg SOD1 G93A rats were injected with 30 μL of artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or, for Groups 2-6, 30 μL of compound formulations at concentrations of 0.33, 1.0, 3.33, 10 and 30 mg / mL in aCSF, respectively, according to Table 32 below:

[0849] Table 32: Dosage groups of rats in Example 12.

[0850] Group ID Animals Administered Group 1 (aCSF) n＝4 Group 2 (10 μg AD12261) n＝4 Group 3 (30 μg AD12261) n＝4 Group 4 (100 μg AD12261) n＝4 Group 5 (300 μg AD12261) n＝4 Group 6 (900 μg AD12261) n＝4

[0851] On day 1, rats were injected intrathecally. On day 85, CSF was collected from each animal, and then the rats were euthanized, and the left half of the brain and thoracic spinal cord were collected and stored in 10% NBF. Tissue samples were collected from the right half of the brain, thoracic spinal cord, cortex, cerebellum, and brainstem. The samples were analyzed for SOD1 mRNA knockdown by qPCR. The average results for each group are shown in Table 33 below:

[0852] Table 33. For each dosing group in Example 12, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0853]

[0854]

[0855] As shown in Table 33 above, a dose-dependent reduction in SOD1 mRNA expression was observed for transgenic rats treated with AD12261 (also referred to as AC910358). In fact, at the highest dose of 900 μg SOD1 RNAi agent, AD12261 was able to achieve an approximately 27% reduction in the cortex (0.733); an approximately 69% reduction in the cerebellum (0.316); an approximately 79% reduction in the thoracic spinal cord (0.217); and an approximately 40% reduction in the brainstem (0.605).

[0856] Example 13. In vivo knockdown of SOD1 in cynomolgus monkeys

[0857] On study day 1, cynomolgus monkeys were injected with artificial cerebrospinal fluid (aCSF, obtained from a commercial supplier) or compound formulations containing 45 mg of AD12261 in aCSF according to Table 34 below:

[0858] Table 34: Dosing groups for non-human primates of Example 13.

[0859] Group ID Animals Administered Group 1 (aCSF) n＝4 Group 2 (45 mg AD12261) - Day 29 n＝5 Group 3 (45 mg AD12261) - Day 85 n＝5 Group 4 (45 mg AD12261) - Day 168 n＝5

[0860] Four (n=4) monkeys were dosed in Group 1 (control), and five (n=5) monkeys were dosed in Groups 2, 3, and 4 (trigger-treated). On Day 1, monkeys were injected intrathecally. On Study Day 29, animals from Groups 1 and 2 were euthanized, and brain and spinal cord tissues were collected from each animal. On Study Day 85, animals from Group 3 were euthanized, and brain and spinal cord tissues were collected from each animal. On Study Day 168, animals from Group 4 were euthanized, and brain and spinal cord tissues were collected from each animal. Samples were analyzed for SOD1 mRNA knockdown by qPCR. The average results for each group relative to Group 1 are shown in Table 35 below:

[0861] Table 35. For each dosing group in Example 13, the relative expression of SOD1 mRNA in various tissues was analyzed by qPCR.

[0862]

[0863]

[0864]

[0865] As shown in Table 35 above, a persistent (up to 168 days after a single intrathecal injection) reduction in SOD1 mRNA expression was observed in multiple tissues of non-human primates treated with AD12261.

[0866] Other Implementations

[0867] It should be understood that although the invention has been described in conjunction with its detailed description, the foregoing description is intended to illustrate rather than limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages and modifications fall within the scope of the appended claims.

Claims

1. An RNAi agent for inhibiting superoxide dismutase 1 (SOD1) gene expression, comprising: An antisense strand comprising at least 17 consecutive nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 3; and The sense strand comprises a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one sequence provided in Table 2 or Table 3.

3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Table 2 or Table 4, and wherein the sense strand has a region that is at least 85% complementary to the antisense strand within 17 consecutive nucleotides.

4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the SOD1 RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.

5. The RNAi agent of any one of claims 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.

6. The RNAi agent of any one of claims 4-5, wherein the modified nucleotide is selected from: 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-split ring nucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

7. The RNAi agent of claim 5, wherein all or substantially all nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.

8. The RNAi agent of any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence of any one modified sequence provided in Table 3.

9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises a nucleotide sequence of any one modified sequence provided in Table 4.

10. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence of any one modified sequence provided in Table 3, and the sense strand comprises a nucleotide sequence of any one modified sequence provided in Table 4.

11. The RNAi agent of any one of claims 1-10, wherein the sense strand is 18 to 30 nucleotides in length, and the antisense strand is 18 to 30 nucleotides in length.

12. The RNAi agent of claim 11, wherein the sense strand and antisense strand are each 18 to 27 nucleotides in length.

13. The RNAi agent of claim 12, wherein the sense strand and antisense strand are each 18 to 24 nucleotides in length.

14. The RNAi agent of claim 13, wherein the sense strand and antisense strand are each 21 nucleotides in length.

15. The RNAi agent of claim 14, wherein the RNAi agent has two blunt ends.

16. The RNAi agent of any one of claims 1-15, wherein the sense strand comprises one or two end caps.

17. The RNAi agent of any one of claims 1-16, wherein the sense strand comprises one or two inverted abasic residues.

18. The RNAi agent of claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9A, or Table 10.

19. The RNAi agent of claim 18, wherein all or substantially all of the nucleotides are modified nucleotides.

20. The RNAi agent of claim 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'): UGAUAGAGGAUUAAAGUGA (SEQ ID NO:54); UAGGAUAACAGAUGAGUUA (SEQ ID NO:59); UGAGAUCACAGAAUCUUCA (SEQ ID NO: 64); UGAUAGAGGAUUAAAGUGAGG (SEQ ID NO: 1084); UAGGAUAACAGAUGAGUUAAG (SEQ ID NO: 1090); or UGAGAUCACAGAAUCUUCAAC (SEQ ID NO: 1105).

21. The RNAi agent of claim 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'): UCACUUUAAUCCUCUAUCA(SEQ ID NO:288); UAACUCAUCUGUUAUCCUA(SEQ ID NO:293); GUUGAAGAUUCUGUGAUCU(SEQ ID NO:298); CCUCACUUUAAUCCUCUAUCA(SEQ ID NO:1151); CUUAACUCAUCUGUUAUCCUA (SEQ ID NO: 1157); or GUUGAGAUUCUGUGAUCUCA (SEQ ID NO: 1172).

22. The RNAi agent of claim 20 or 21, wherein all or substantially all nucleotides are modified nucleotides.

23. The RNAi agent of claim 1, comprising an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence, wherein the modified nucleotide sequence differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'): cPrpusGfsasuagAfggAfuUfaAfaGfugagsg (SEQ ID NO: 578); cPrpusGfsasuagA UNA ggAfuUfaAfaGfugagsg(SEQ ID NO:613); cPrpuAfgGfauaacagAfuGfaGfuuaassg(SEQ ID NO:589); or cPrpusGfsaGfaucacagAfaUfcUfucasasc (SEQ ID NO: 646); wherein a, c, g and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine and 2'-O-methyluridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine and 2'-fluorouridine, respectively; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyluridine; s represents a phosphorothioate linkage; A UNA represents 2',3'-cleaved-adenosine-3'-phosphate; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

24. The RNAi agent of claim 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5'→3'): ccucacuuUfAfAfuccucuauca(SEQ ID NO:685); cuuaacucAfUfCfuguuauccua (SEQ ID NO: 691); or guugaagaUfuCfuGfugaucuca (SEQ ID NO:771); wherein a, c, g, i and u represent 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine and 2'-O-methyluridine, respectively; Af, Cf, Gf and Uf represent 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine and 2'-fluorouridine, respectively; and s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

25. The RNAi agent of any one of claims 20-24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.

26. The RNAi agent of any one of claims 1-25, wherein the RNAi agent is linked to a lipid moiety.

27. The RNAi agent of claim 26, wherein the lipid moiety is selected from: in The point of attachment to the RNAi agent is indicated.

28. The RNAi agent of claim 26 or 27, wherein the lipid moiety is conjugated to the sense strand.

29. The RNAi agent of claim 28, wherein the lipid moiety is conjugated to the 5' end of the sense strand.

30. A composition comprising the RNAi agent of any one of claims 1-29, wherein the composition further comprises a pharmaceutically acceptable excipient.

31. The composition of claim 30, further comprising a second RNAi agent capable of inhibiting the expression of superoxide dismutase 1 gene.

32. The composition of any one of claims 30-31, further comprising one or more additional therapeutic agents.

33. The composition of any one of claims 30-32, wherein the RNAi agent is a sodium salt.

34. A composition according to any one of claims 30-33, wherein the pharmaceutically acceptable excipient is water for injection.

35. The composition of any one of claims 30-33, wherein the pharmaceutically acceptable excipient is a buffered saline solution.

36. A method for inhibiting SOD1 gene expression in a cell, the method comprising introducing an effective amount of the RNAi agent according to any one of claims 1 to 29 or the composition according to any one of claims 30 to 35 into the cell.

37. The method of claim 36, wherein the cell is within a subject.

38. The method of claim 37, wherein the subject is a human subject.

39. The method of any one of claims 36-38, wherein following administration of the RNAi agent, the superoxide dismutase 1 (SOD1) gene expression is inhibited by at least about 30%.

40. A method of treating one or more symptoms or diseases associated with enhanced or elevated mutant SOD1 activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of a composition according to any one of claims 30-35.

41. The method of claim 40, wherein the disease is a neurodegenerative disease.

42. The method of claim 41, wherein the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or Alzheimer's disease.

43. The method of claim 40, wherein the disease is ALS.

44. The method of claim 43, wherein the disease is SOD1-related familial ALS.

45. The method of any one of claims 36-44, wherein the RNAi agent is administered at a dose of about 0.01 mg / kg to about 5.0 mg / kg of the subject's body weight.

46. ​​The method of any one of claims 36-45, wherein the RNAi agent is administered at a dose of about 0.03 mg / kg to about 2.0 mg / kg of the subject's body weight.

47. The method of any one of claims 36-44, wherein the RNAi agent is administered at a fixed dose of about 25 mg to about 450 mg.

48. The method of claim 47, wherein the RNAi agent is administered at a dose of about 25 mg, about 50 mg, about 150 mg, or about 450 mg.

49. The method of any one of claims 36-48, wherein the RNAi agent is administered in two or more doses.

50. Use of the RNAi agent of any one of claims 1-29 for treating a disease, disorder or symptom mediated at least in part by mutant SOD1 activity and / or SOD1 gene expression.

51. Use of a composition according to any one of claims 30-35 for treating a disease, disorder or symptom mediated at least in part by superoxide dismutase 1 (SOD1) activity and / or superoxide dismutase 1 (SOD1) gene expression.

52. Use of a composition according to any one of claims 30-35 for the manufacture of a medicament for treating a disease, disorder or symptom mediated at least in part by superoxide dismutase 1 (SOD1) and / or superoxide dismutase 1 (SOD1) gene expression.

53. The use according to any one of claims 50-52, wherein the disease is a neurodegenerative disease.

54. A method of preparing a RNAi agent according to any one of claims 1-29, the method comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.

55. The method of claim 54, wherein the sense strand comprises a lipid moiety.

56. The method of claim 54, comprising conjugating a lipid moiety to the sense strand.

Images