Detection composition and protein capture detection method

Abstract

Relates to the technical field of biology, in particular to a detection composition and a protein capture detection method. A detection composition is provided, comprising a nucleic acid array probe and a protein-nucleic acid conjugate; the nucleic acid array probe comprises a capture sequence, and the capture sequence is used for capturing the protein-nucleic acid conjugate. And the simultaneous detection of the ultrahigh and heavy antibodies can be carried out on the same tissue slice. As space reduction is carried out on the antibody position by depending on a sequencing technology, the problem of background staining caused by traditional immunohistochemistry and immunofluorescence color developing agents can be solved. Besides, negative control, positive control and to-be-detected antibody detection can be carried out on the same tissue slice, detection results can be judged more accurately, and false negative or false positive results caused by a traditional staining technology are eliminated.

Description

Detection composition and protein capture detection method Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a detection composition and a protein capture detection method. Background Art

[0002] Currently, at the tissue level, antibody screening for immunohistochemistry or immunofluorescence mainly uses tissue microarrays. Different tissue specimens are arranged in a regular pattern on a slide and stained with antibodies to observe whether the antibody can be applied to various tissues.

[0003] Although tissue microarrays can achieve high-throughput screening of tissue types, due to the species origin of antibodies, screening can generally only be performed on one (immunohistochemistry) or one to four (immunofluorescence) antibodies, resulting in a very low antibody throughput.

[0004] Strictly speaking, negative and positive controls should be stained using the same tissue microarray for each antibody screening process, ideally using adjacent sections of the same tissue. However, as the number of antibodies screened increases, the sections used for negative and positive controls may be separated significantly from the sections used for each antibody staining. This can lead to significant differences in the cell composition or antigen types within the sections. This can result in false-negative or false-positive results, compromising the accuracy of screening results.

[0005] On tissue microarrays, immunofluorescence or immunohistochemistry techniques rely on chromogens or fluorescent dyes to image the location of the primary antibody, thereby identifying the location of the corresponding antigen bound to the primary antibody. However, these dyes and fluorescent dyes can introduce background staining, affecting the interpretation of positive results. Furthermore, in some tissues, the presence of autofluorescence can also affect the interpretation of positive staining results.

[0006] Summary of the Invention

[0007] In view of this, the present invention provides a detection composition and a protein capture detection method, and specifically provides a high-throughput antibody screening method based on a nucleic acid array.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] In a first aspect, the present invention provides a detection composition comprising a nucleic acid array probe and a protein-nucleic acid conjugate;

[0010] The nucleic acid array probe comprises a capture sequence, and the capture sequence is used to capture the protein-nucleic acid conjugate.

[0011] In some embodiments of the present invention, the nucleic acid array probe further comprises one or more combinations of an excision region, an amplification linker B sequence, a spatial positioning sequence, or a UMI sequence;

[0012] The excision region is used to release the amplified product from the carrier;

[0013] The amplification linker B sequence is used for amplification;

[0014] The spatial positioning sequence is used for spatial positioning of the nucleic acid array;

[0015] The UMI sequences are used to quantify and remove repetitive sequences introduced by amplification.

[0016] In some specific embodiments of the present invention, the nucleic acid array probe comprises, from the 5' end to the 3' end, an excision region, an amplification linker B sequence, a spatial positioning sequence, a UMI sequence, and the capture sequence.

[0017] In some embodiments of the present invention, the protein-nucleic acid conjugate comprises a protein and a nucleic acid sequence;

[0018] The nucleic acid sequence includes a capture complementary sequence; the capture complementary sequence is complementary to the capture sequence and is used to capture protein.

[0019] In some specific embodiments of the present invention, the nucleic acid sequence further comprises one or a combination of the amplification linker A sequence or the protein sequence;

[0020] The amplification linker A sequence is used for amplification;

[0021] The protein sequence has a unique and definite corresponding relationship with a known nucleic acid sequence and is used to label the protein.

[0022] In some specific embodiments of the present invention, the nucleic acid sequence comprises, from the 5' end to the 3' end, an amplification linker A sequence, a protein sequence, and a capture complementary sequence.

[0023] In some specific embodiments of the present invention, the length of the capture complementary sequence is no greater than the length of the capture sequence.

[0024] Based on the above research, the present invention also provides the use of the detection composition in protein detection.

[0025] In addition, the present invention also provides the use of the detection composition in preparing a product for detecting protein.

[0026] In some specific embodiments of the present invention, the product includes but is not limited to one or more of a reagent, a kit, a chip or a device.

[0027] In some embodiments of the invention, the detecting comprises capturing and sequencing.

[0028] In some specific embodiments of the present invention, the detection comprises performing high-throughput detection on the same tissue section.

[0029] In some specific embodiments of the present invention, as long as tissue sections can be obtained, any tissue, any fixation method, and any method of obtaining tissue sections are within the scope of protection of the present invention, and the present invention is not limited thereto.

[0030] In the present invention, any slice or any tissue, including but not limited to tissue, cultured cells, organoids, etc. can also be used. Lysed cell tissue lysate can also be used. As long as the substance to be detected can be covered and fixed on the chip, theoretically, any substance can be detected.

[0031] In the present invention, any fixation method includes but is not limited to methanol fixation, PFA fixation, formaldehyde fixation, formalin fixation and paraffin embedding (FFPE). In some cases, different antigen retrieval steps need to be taken according to the different fixation methods.

[0032] In the present invention, the method of obtaining tissue slices includes but is not limited to obtaining slices through various slice instruments, including freezing microtome, paraffin microtome, vibrating microtome, etc.

[0033] In some embodiments of the present invention, the high-throughput detection includes detection of a negative control, a positive control, or one or more of the proteins.

[0034] In a second aspect, based on the above research, the present invention also provides a reagent for capturing or detecting proteins, including the detection composition of the present invention and an acceptable auxiliary agent.

[0035] In a third aspect, the present invention further provides a chip for capturing or detecting proteins, wherein the chip is fixed with the detection composition and an acceptable carrier.

[0036] In a fourth aspect, the present invention further provides a test strip for capturing or detecting proteins, wherein the test strip is fixed with the detection composition and an acceptable carrier.

[0037] In some specific embodiments of the present invention, in the chip, the detection composition provided by the present invention can be fixed to the carrier in any manner. Any connection method that can fix the detection composition to the carrier is within the scope of protection of the present invention, and the present invention does not limit this.

[0038] For example, the antibody-conjugated nucleic acid can be directly hybridized to the capture sequence on the chip; the antibody-conjugated nucleic acid and probe can also be hybridized to a SPLINT oligo and then connected using a ligase. The antibody-conjugated nucleic acid can also be directly connected to the probe through other methods.

[0039] In a fifth aspect, the present invention also provides a kit for capturing or detecting proteins, comprising the detection composition, the reagent, the chip or the test strip, and acceptable excipients, adjuvants or carriers.

[0040] In some specific embodiments of the present invention, the acceptable excipients and adjuvants include a blocking solution; the blocking solution includes a combination of one or more of serum, salmon sperm DNA, 32nt PolyA or WB.

[0041] In some specific embodiments of the present invention, the volume ratio of the serum, the salmon sperm DNA, the 32nt PolyA and the WB is 5:5:5:35.

[0042] In some specific embodiments of the present invention, in the kit, the blocking solution, calculated on a 50 μL basis, comprises:

[0043]

[0044] In a sixth aspect, the present invention also provides a device for capturing or detecting proteins, comprising the detection composition, the reagent, the chip, the test strip or the components in the kit, and other acceptable parts.

[0045] In a seventh aspect, the present invention further provides a method for capturing a protein, comprising: mixing a sample to be tested with any of the following items and reacting the mixture to capture the protein;

[0046] (I), the detection composition; and / or

[0047] (II), the reagent; and / or

[0048] (III), the chip; and / or

[0049] (IV), the test strip; and / or

[0050] (V) components, test strips or chips in the kit.

[0051] In an eighth aspect, the present invention further provides a method for protein detection, comprising: mixing a sample to be tested with any of the following items, reacting the mixture, capturing the protein, and detecting the protein;

[0052] (I), the detection composition; and / or

[0053] (II), the reagent; and / or

[0054] (III), the chip; and / or

[0055] (IV), the test strip; and / or

[0056] (V) components, test strips or chips in the kit.

[0057] In some specific embodiments of the present invention, the method comprises the steps of:

[0058] Step 1: taking the detection composition, the reagent, the chip, the test strip or the protein-nucleic acid conjugate in the kit and specifically binding it to the components in the sample to be tested;

[0059] Step 2: The capture sequence in the nucleic acid array probe is hybridized with the protein-nucleic acid conjugate, and the complementary sequence of the antibody sequence and the complementary sequence of the amplification linker A sequence are extended on the nucleic acid array probe by nucleic acid amplification to obtain a nucleic acid having spatial information and antibody information;

[0060] Step 3: Release the nucleic acid and recover it.

[0061] In some specific embodiments of the present invention, the method further comprises a sequencing step to obtain the type and quantity of the sample to be tested.

[0062] In some embodiments of the present invention, the nucleic acid includes one or more of the spatial localization sequence, the protein sequence, or the UMI sequence.

[0063] In some specific embodiments of the present invention, the binding and hybridization in step 2 of the method includes but is not limited to permeabilizing tissue to allow the capture sequence in the nucleic acid array probe to bind and hybridize with the protein-nucleic acid conjugate.

[0064] In some specific embodiments of the present invention, any method that enables the capture sequence in the nucleic acid array probe to bind and hybridize with the protein-nucleic acid conjugate is within the scope of protection of the present invention. For example, using a certain device and a nucleic acid array chip from the top of a tissue slice without the addition of a permeabilizing agent can also achieve capture. Any device, component, or method that can achieve the above functions is within the scope of protection of the present invention and is not limited herein.

[0065] In some specific embodiments of the present invention, the extension in step 2 of the method further includes: when the length of the capture complementary sequence is not greater than the length of the capture sequence, the protein-nucleic acid conjugate is extended to obtain a nucleic acid having spatial information and antibody information.

[0066] In some specific embodiments of the present invention, the length of the capture complementary sequence is designed to be equal to or shorter than the length of the capture sequence. After the probe extension reaction, the protein-nucleic acid conjugate can also extend spatial information and UMI information. This portion of the product can be collected using a melting reagent to achieve similar results. Any method that can produce extension products is within the scope of the present invention and is not limited herein.

[0067] For example, after the chip capture probe is extended with antibody information and converted to a single strand by a denaturing agent, it can be extended by adding any type of extension primer. This can also produce a product with spatial information, antibody information, and UMI information.

[0068] In some specific embodiments of the present invention, the method further includes a step between step 1 and step 2 to detect whether the protein-nucleic acid conjugate specifically binds to a component in the sample to be tested.

[0069] In some specific embodiments of the present invention, the method further comprises the step of taking the sample to be tested and making a tissue section before step 1.

[0070] In some specific embodiments of the present invention, as long as tissue sections can be obtained, any tissue, any fixation method, and any method of obtaining tissue sections are within the scope of protection of the present invention, and the present invention is not limited thereto.

[0071] In the present invention, any slice or any tissue, including but not limited to tissue, cultured cells, organoids, etc. can also be used. Lysed cell tissue lysate can also be used. As long as the substance to be detected can be covered and fixed on the chip, theoretically, any substance can be detected.

[0072] In the present invention, any fixation method includes but is not limited to methanol fixation, PFA fixation, formaldehyde fixation, formalin fixation and paraffin embedding (FFPE). In some cases, different antigen retrieval steps need to be taken according to the different fixation methods.

[0073] In the present invention, the method of obtaining tissue slices includes but is not limited to obtaining slices through various slice instruments, including freezing microtome, paraffin microtome, vibrating microtome, etc.

[0074] In the above-described detection composition, application, reagent, chip, test strip, kit, device, or method, the protein includes, but is not limited to, an antibody. Any protein that can be detected by a specific binding method is within the scope of protection of the present invention. The present invention does not limit the specific binding method; any protein that can be detected by combining with the nucleic acid detection agent provided by the present invention is protected by the present invention.

[0075] The beneficial effects of the present invention include but are not limited to:

[0076] The present invention enables ultra-high-throughput screening of antibody species, enabling simultaneous screening of at least dozens of antibodies. It also allows for the simultaneous detection of negative and positive controls and multiple antibodies on the same tissue section. This avoids false-negative and false-positive results in antibody screening due to varying slice locations. The present invention uses a chip-based approach to capture antibody-coupled nucleic acid information and amplify and sequence to determine the location of the antibody. This approach avoids background issues associated with current imaging schemes and prevents interference with imaging caused by the tissue itself. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0078] Figure 1 shows the structure of antibody-nucleic acid conjugate;

[0079] Figure 2 shows the structure of nucleic acid array probes;

[0080] FIG3 shows the experimental process of the present invention;

[0081] Figure 4 is a schematic diagram showing reverse transcription reaction to obtain antibody information;

[0082] Figure 5 shows the visualization results of 35 antibodies in the same PFA-fixed spleen section;

[0083] FIG6 shows a comparison of the results of isotype antibody detection using the technology of the present invention and traditional immunofluorescence technology. DETAILED DESCRIPTION

[0084] The present invention discloses a detection composition and a protein capture detection method. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It should be noted in particular that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0085] The present invention first requires the preparation / purchase of an antibody-nucleic acid conjugate with a nucleic acid coding sequence, as shown in Figure 1. The nucleic acid sequence can be divided into three parts: the first part is the amplification linker A sequence, which is used for subsequent PCR amplification; the second part is the antibody-specific antibody sequence, which corresponds to a known nucleic acid sequence for each antibody and is used for antibody identification; and the third part is the capture complementary sequence, which is complementary to the chip capture sequence and is used for antibody capture.

[0086] The structure of the nucleic acid array probe used in the present invention is shown in Figure 2. From the 5' end to the 3' end, it comprises: a resection region for subsequent release of information from the solid phase carrier; an amplification linker B sequence for subsequent PCR amplification; a spatial positioning sequence for spatial positioning of the nucleic acid array; a UMI sequence for quantification and removal of repetitive sequences introduced by subsequent PCR; and a capture sequence for capturing the antibody-nucleic acid conjugate.

[0087] The specific technical route is shown in Figure 3. After attaching the tissue sections to the nucleic acid array, different tissue processing methods are used for different tissue types. FFPE tissues require baking to prevent detachment, deparaffinization, hydration, sectioning, and cross-linking removal; PFA tissues require baking to prevent detachment and cross-linking removal; and frozen tissues require methanol fixation. Subsequently, the same operational procedures are followed for different sample types. During the blocking step, nonspecific binding of the antibody and conjugated nucleic acid to the tissue and array is blocked. During the primary antibody incubation step, an antibody-nucleic acid conjugate and a corresponding negative control antibody-nucleic acid conjugate are added. A series of wash steps are then performed to retain the antibody-nucleic acid conjugate bound to the specific antigen. To confirm successful binding of the antibody-nucleic acid conjugate, a secondary antibody incubation is optionally performed for fluorescence visualization and imaging. After tissue permeabilization, the antibody-conjugated nucleic acid sequence is hybridized to the probes on the array. Subsequently, through DNA synthesis reactions such as reverse transcription (Figure 4), the complementary sequences of the antibody sequence and amplification adapter A are extended onto the probes, thereby generating cDNA containing both spatial and antibody information. The cDNA is then released from the chip and recovered via magnetic bead purification for sequencing library preparation. Sequencing of the spatial mapping sequence, antibody sequence, and UMI sequence allows for the identification of the type and quantity of antibodies bound to a specific location.

[0088] The present invention enables simultaneous detection of ultra-high-density antibodies on the same tissue section. Because it relies on sequencing technology to spatially restore antibody positions, it eliminates the background staining issues associated with traditional immunohistochemistry and immunofluorescence developers. Furthermore, it enables the testing of negative controls, positive controls, and the antibody being tested on the same tissue section, enabling more accurate assessment of test results and eliminating false-negative or false-positive results associated with traditional staining techniques.

[0089] The raw materials and reagents used in the detection composition and protein capture detection method provided by the present invention can all be purchased from the market. The present invention is further described below with reference to the following examples:

[0090] Example 1 Antibody Screening for Spleen PFA Samples

[0091] 1. Antibody-Nucleic Acid Conjugate Structure In this example, the antibody-nucleic acid conjugate is the TotalseqA antibody from Biolegend, which contains 35 antibodies that recognize different antigens (see Table 1 for specific types).

[0092] The amplification linker A sequences of different antibodies are all: CCTTGGCACCCGAGAATTCCA (as shown in SEQ ID No. 1), the antibody sequences are shown in Table 1, and the capture sequence complementary sequences are all BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (32nt poly A sequence, * represents thio modification, as shown in SEQ ID No. 2).

[0093] Table 1: Input antibodies and corresponding antibody sequences

[0094]

[0095]

[0096]

[0097] 2. Capture nucleic acid array structure. In this example, the probe sequence is: CTGCTGACGTACTGAGAGGCATGGCGACCTTATCAGNNNNNNNNNNNNNNNNNNNNNNNNNTTGTCTTCCTAAGACNNNNNNNNNNTTTTTTTTTTTTTTTTTTTV (shown in SEQ ID No. 38). The amplification linker B sequence is: CTGCTGACGTACTGAGAGGCATGGCGACCTTATCAG (shown in SEQ ID No. 39); the spatial anchor sequence is a 25 nt random sequence, determined by sequencing during nucleic acid array preparation; the UMI is a 10 nt random sequence; and the capture sequence is TTTTTTTTTTTTTTTTTTTTTV (shown in SEQ ID No. 40).

[0098] 3. Reagent Preparation

[0099] Washing buffer (WB): 1% Triton X-100 dissolved in PBS. The blocking buffer for a single reaction is shown in Table 2. The primary antibody dilution is the same as the blocking buffer.

[0100] Table 2: Preparation of blocking solution for a single reaction system

[0101]

[0102]

[0103] 4. Specific experimental steps

[0104] 1) Mouse PFA spleen tissue, sliced ​​using a freezing microtome to a thickness of 10 μm. After the slices were attached to the chip surface, the chip was dried at 37°C for 3 minutes.

[0105] 2) Wash tissue sections three times with 50 μL WB, incubating for 1 min each time;

[0106] 3) Transfer the tissue-attached chip to a 24-well plate, add 400 μL of 4% PFA, and fix at room temperature for 5 minutes;

[0107] 4) Aspirate the liquid and wash the tissue three times with 50 μL WB, 1 min each time;

[0108] 5) Add 50 μl of blocking solution to each chip and incubate at room temperature for 30 minutes;

[0109] 6) Aspirate the blocking solution and add 0.5 μL of each of the 35 antibodies to the primary antibody diluent. Bring the total volume to 50 μL. Add the solution to the tissue section and incubate at room temperature for 40 minutes.

[0110] 7) Aspirate and discard the primary antibody incubation solution, and wash three times with 50 μL of Western Blot, each time for 1 minute;

[0111] 8) (Optional step) Add fluorescent secondary antibody and react at room temperature for 30 minutes;

[0112] 9) (Optional step) Aspirate and discard the secondary antibody reaction solution, and wash with 50 μL WB three times, 1 min each time;

[0113] 10) (Optional step) Air-dry the chip. After the tissue is dry, add 4 μl of glycerol to seal the chip and collect fluorescence images.

[0114] 11) (Optional step) Remove the coverslip and place the chip in 5× SSC solution for 5 min to wash away the glycerol.

[0115] 12) Remove the chip, wash it once with 0.1× SSC, add permeabilization reagent, and react at 37°C for 8 minutes;

[0116] 13) Wash the chip once with RT mix, add RT mix, and react at 42°C for 2 hours;

[0117] 14) Add 400 μL tissue removal solution, incubate at 55°C for 30 min, remove the tissue removal solution, add 400 μL cDNA release reagent, and react at 55°C for 3 hr;

[0118] 15) Collect the released product, purify the cDNA using 2.0X magnetic beads, and perform PCR amplification for 18-20 cycles. The forward primer is: 5'-phosphorylated-CTGCTGACGTACTGAG*A*G*G*C*A*T (as shown in SEQ ID No. 41), where * indicates a thiolation modification. The reverse primer is: GAGACGTTCTCGACTCAGCAGACCTTGGCACCCGAGAATTCCA (as shown in SEQ ID No. 42);

[0119] 16) The amplified product was sequenced using an MGI-2000 sequencer. The sequencing protocol was as follows: read 1: 25 bp of spatial positioning sequence + 10 bp of UMI; read 2: 15 bp of antibody nucleic acid sequence.

[0120] 17) The protein detection results were obtained through the analysis and visualization system developed by BGI.

[0121] 5. Experimental Results

[0122] 1) A total of 35 antibodies were used in this example, and 35 antibodies were detected through sequencing and data analysis. The specific visualization results of each antibody are shown in Figure 5. Among them, the antibodies that can obtain obvious staining patterns are CD44, TER119, CD5, F4 / 80, CD71, CD3, CD90-2, CD38, CD106, CD45R, CD21 / 35, IgD, CD4, IgM, CD19 and CD169, a total of 16 antibodies, which proves that these antibodies can be applied to PFA-fixed spleen tissue. The antibody with a certain pattern is CD140a, which may be applicable to PFA-fixed spleen tissue. There is no obvious difference between the other antibodies and the negative control antibody IgG2a, which proves that these antibodies are not suitable for PFA-fixed spleen tissue.

[0123] 2) The 16 antibodies screened above were validated using conventional immunofluorescence staining. Antibodies against F4 / 80, CD38, CD4, CD90-2, and IgD were selected and stained on PFA-fixed spleen tissue. The results demonstrated that these antibodies can indeed be used in PFA-fixed spleen tissue (see Figure 6). Each antibody exhibited a specific staining pattern, and upon magnification, staining of single cell membrane structures was observed. Furthermore, this technique demonstrated a higher signal-to-noise ratio than conventional immunofluorescence for the detection of certain antibodies, such as CD4 and IgD.

[0124] The above is a detailed introduction to the detection composition and protein capture detection method provided by the present invention. This article uses specific examples to illustrate the principles and implementation methods of the present invention. The description of the above examples is only used to help understand the method of the present invention and its core ideas. It should be pointed out that for those skilled in the art, without departing from the principles of the present invention, the present invention can also be improved and modified in a number of ways, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

[0125] Sequence Listing

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

Claims

1. A detection composition, characterized in that including nucleic acid array probes and protein-nucleic acid conjugates; The nucleic acid array probe comprises a capture sequence, and the capture sequence is used to capture the protein-nucleic acid conjugate.

2. The detection composition according to claim 1, characterized in that The nucleic acid array probe further includes one or more combinations of an excision region, an amplification linker B sequence, a spatial positioning sequence, or a UMI sequence; The excision region is used to release the amplification product from the vector; The amplification linker B sequence is used for amplification; The spatial positioning sequence is used for spatial positioning of the nucleic acid array; The UMI sequence is used to quantify and remove repetitive sequences introduced by amplification.

3. The detection composition according to claim 1 or 2, characterized in that The nucleic acid array probe includes, from the 5' end to the 3' end, an excision region, an amplification linker B sequence, a spatial positioning sequence, a UMI sequence and the capture sequence.

4. The detection composition according to claim 3, characterized in that The protein-nucleic acid conjugate comprises a protein and a nucleic acid sequence; The nucleic acid sequence includes a capture complementary sequence; the capture complementary sequence is complementary to the capture sequence and is used to capture the protein.

5. The detection composition according to claim 4, characterized in that The nucleic acid sequence also includes one or a combination of the amplification linker A sequence or the protein sequence; The amplification linker A sequence is used for amplification; The protein sequence has a unique corresponding relationship with a known nucleic acid sequence and is used to label the protein.

6. The detection composition according to any one of claims 1 to 5, characterized in that The nucleic acid sequence includes, from the 5' end to the 3' end, an amplification linker A sequence, a protein sequence and a capture complementary sequence; Preferably, the length of the capture complementary sequence is not greater than the length of the capture sequence.

7. Use of the detection composition according to any one of claims 1 to 6 in protein detection.

8. Use of the detection composition according to any one of claims 1 to 6 in the preparation of a product for detecting a protein.

9. The use according to claim 7 or 8, characterized in that The product includes, but is not limited to, one or more of a reagent, a kit, a chip or a device.

10. The use according to any one of claims 7 to 9, characterized in that The detection includes capture and sequencing; Preferably, the detection comprises high-throughput detection on the same tissue section; Preferably, the high-throughput detection comprises detection of a negative control, a positive control or one or more of the proteins.

11. A reagent, characterized in that The method comprises the detection composition according to any one of claims 1 to 6 and an acceptable auxiliary agent.

12. A chip, characterized in that The detection composition according to any one of claims 1 to 6 and an acceptable carrier are fixed thereon.

13. A test strip, characterized in that The detection composition according to any one of claims 1 to 6 and an acceptable carrier are fixed thereon.

14. A kit, characterized in that It comprises the detection composition according to any one of claims 1 to 6, the reagent according to claim 11, the chip according to claim 12 or the test strip according to claim 13, and acceptable excipients, adjuvants or carriers.

15. The kit according to claim 14, characterized in that The acceptable auxiliary materials and adjuvants include a blocking solution; the blocking solution includes a combination of one or more of serum, salmon sperm DNA, 32 nt PolyA or WB.

16. The device, characterized in that It comprises the detection composition according to any one of claims 1 to 6, the reagent according to claim 11, the chip according to claim 12, the test strip according to claim 13 or the components in the kit according to claim 14 or 15, and other acceptable parts.

17. A method for capturing protein, characterized in that: The sample to be tested is mixed with any of the following items and reacted to capture the protein; (I), a detection composition as described in any one of claims 1 to 6; and / or (II), the reagent as claimed in claim 11; and / or (III) The chip as claimed in claim 12; and / or (IV), a test strip as described in claim 13; and / or (V) A component, a test strip or a chip in a kit as described in claim 14 or 15.

18. A method for protein detection, characterized in that: The sample to be tested is mixed with any of the following items and reacted to capture the protein and detect it; (I), a detection composition as described in any one of claims 1 to 6; and / or (II), the reagent as claimed in claim 11; and / or (III) The chip as claimed in claim 12; and / or (IV), a test strip as described in claim 13; and / or (V) A component, a test strip or a chip in a kit as described in claim 14 or 15.

19. The method according to claim 17 or 18, characterized in that The steps include: Step 1: taking the detection composition according to any one of claims 1 to 6, the reagent according to claim 11, the chip according to claim 12, the test strip according to claim 13 or the protein-nucleic acid conjugate in the kit according to claim 14 or 15 and specifically binding it to the components in the sample to be tested; Step 2: The capture sequence in the nucleic acid array probe is hybridized with the protein-nucleic acid conjugate, and the complementary sequence of the antibody sequence and the complementary sequence of the amplification linker A sequence are extended on the nucleic acid array probe through nucleic acid amplification to obtain a nucleic acid with spatial information and antibody information; Step 3: Release the nucleic acid and recover it.

20. The method of claim 19, wherein: It also includes a sequencing step to obtain the type and quantity of the sample to be tested; Preferably, the nucleic acid comprises one or more of the spatial localization sequence, the protein sequence or the UMI sequence; Preferably, the binding and hybridization in step 2 includes but is not limited to binding and hybridizing the capture sequence in the nucleic acid array probe with the protein-nucleic acid conjugate by permeabilizing the tissue; Preferably, the extension in step 2 further comprises: when the length of the capture complementary sequence is not greater than the length of the capture sequence, the protein-nucleic acid conjugate is extended to obtain a nucleic acid having spatial information and antibody information; Preferably, between step 1 and step 2, there is also a step of detecting whether the protein-nucleic acid conjugate specifically binds to the components in the sample to be tested; Preferably, before step 1, the method further includes the step of taking the sample to be tested and making tissue sections.

21. The detection composition according to any one of claims 1 to 6, the use according to any one of claims 7 to 10, the reagent according to claim 11, the chip according to claim 12, the test strip according to claim 13, the kit according to claim 14 or 15, the device according to claim 16, or the method according to any one of claims 17 to 20, characterized in that: The proteins include, but are not limited to, antibodies.

Images