An ovarian-targeting exosome loaded with antioxidants and its preparation method

Abstract

This invention relates to an ovarian-targeted exosome loaded with antioxidants and its preparation method. The method involves constructing ovarian-targeted exosomes and then loading small-molecule antioxidants into these exosomes. This invention enables the targeted delivery of small-molecule antioxidants to the ovarian tissue of cancer patients before or during chemotherapy, protecting ovarian function without affecting the efficacy of chemotherapy for tumor cells, thus achieving ovarian function protection during chemotherapy.

Description

Technical Field

[0001] This invention belongs to the field of tumor treatment, and specifically relates to an ovarian-targeted exosome loaded with antioxidants and its preparation method. Background Technology

[0002] Advances in cancer treatment have dramatically changed the outcomes for cancer patients, improving long-term survival rates. This has led to a growing desire for fertility among young female cancer patients. However, current cancer treatments such as chemotherapy and radiotherapy can damage ovarian function, increasing the risk of infertility. The ovary is not only the site of egg development and maturation but also secretes estrogen and progesterone, making it a vital organ for maintaining female fertility and overall health. Existing fertility preservation methods, such as egg cryopreservation and ovarian tissue cryopreservation, while addressing fertility loss caused by chemotherapy-induced ovarian damage to some extent, cannot fully restore or maintain ovarian endocrine function in the long term.

[0003] Current research on interventions for chemotherapy-induced ovarian damage mainly includes gonadotropin-releasing hormone agonists (GnRH-a), apoptosis inhibitors, antioxidants, and mesenchymal stem cells and their derivatives. The vast majority of these studies are still in the preclinical stage. The main problems include: ① controversial efficacy; ② unclear mechanism of action; ③ poor targeting, which may affect anti-tumor efficacy.

[0004] Chemotherapy and radiotherapy can cause cancer cells and normal tissue cells to produce large amounts of reactive oxygen species, leading to apoptosis. Antioxidants are a promising class of chemotherapy protectants; however, due to their lack of targeting and their antagonistic mechanism of action against the cancer-killing mechanisms of chemotherapy drugs, their use before or during chemotherapy may affect the cancer-clearing effect of chemotherapy drugs.

[0005] Mammalian cells continuously release extracellular vesicles, or exosomes, into the external environment. By genetically engineering the cells that produce exosomes or by directly chemically modifying the exosomes, the exosomes can be made targeted, thus becoming carriers for the targeted delivery of small molecule drugs. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide an ovarian-targeting exosome loaded with antioxidants and a method for preparing the same, thereby overcoming the problem of lack of targeting in existing ovarian chemotherapy protectants.

[0007] This invention provides an ovarian-targeted exosome loaded with an antioxidant, which is obtained by constructing an ovarian-targeted exosome and then loading a small molecule antioxidant into the ovarian-targeted exosome.

[0008] Preferably, the ovarian-targeting exosomes are produced by genetically modifying exosome-producing cells so that the surface of the exosomes produced has ovarian-targeting proteins.

[0009] Preferably, the exosome-producing cells are one of the following: human embryonic kidney cells HEK-293T cells, human umbilical cord mesenchymal stem cells, human adipose-derived mesenchymal stem cells, and human amniotic mesenchymal stem cells.

[0010] Preferably, the ovarian targeting protein is the Lamp2b protein, which is fused to the N-terminus of the FSH protein peptide at positions 33 to 53.

[0011] Preferably, the small molecule antioxidant is at least one of vitamin E, resveratrol, ferulic acid, and melatonin.

[0012] This invention also provides a method for preparing ovarian-targeting exosomes loaded with antioxidants, comprising the following steps:

[0013] Genetically modified exosome-producing cells were used to produce exosomes with ovarian-targeting proteins on their surface; small molecule antioxidants were then loaded into the exosomes to obtain ovarian-targeting exosomes loaded with antioxidants.

[0014] The loading process involves loading the exosomes using methods such as ultrasound.

[0015] The exosome-producing cells include one or more of the following: human embryonic kidney cells HEK-293T cells, human umbilical cord mesenchymal stem cells, human adipose-derived mesenchymal stem cells, and human amniotic mesenchymal stem cells.

[0016] The ovarian targeting protein is the Lamp2b protein, which is fused to the N-terminus of the FSH protein at positions 33 to 53. The polypeptide sequence is: YTRDLVYKDPARPKIQKTCTF (as shown in SEQ ID NO:2), and the corresponding gene sequence is: tacaccagggatctggtgtataaggacccagccaggcccaaaatccagaaaacatgtaccttc (as shown in SEQ ID NO:1).

[0017] The small molecule antioxidant is at least one of vitamin E, resveratrol, ferulic acid, and melatonin.

[0018] The present invention also provides the application of ovarian-targeting exosomes loaded with antioxidants in the preparation of ovarian-protective drugs during chemotherapy.

[0019] Beneficial effects

[0020] This invention enables the targeted delivery of small molecule antioxidants to the ovarian tissue of cancer patients before or during chemotherapy, protecting ovarian function without affecting the chemotherapy effect on tumor cells, thus achieving ovarian function protection during chemotherapy. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the structure of ovarian-targeting exosomes loaded with antioxidants;

[0022] Figure 2 These are the nanoparticle size tracking and detection results of the ovarian-targeted exosomes prepared in Example 3 and the ovarian-targeted exosomes loaded with vitamin E;

[0023] Figure 3 The figure shows the results of the CCK-8 assay for detecting cell proliferation.

[0024] Figure 4 Figure showing the experimental results of flow cytometry detection of cell apoptosis;

[0025] Figure 5 Figure showing the experimental results of ovarian tissue staining and follicle counting. Detailed Implementation

[0026] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0027] Example 1

[0028] Construction of ovarian-targeting protein expression plasmids and cell transfection.

[0029] The ovarian-targeting protein is a recombinant protein (SEQ ID NO:4) formed by adding a linker sequence between amino acids 33 to 53 of the FSH protein (SEQ ID NO:2) and the Lamp2b protein. The DNA sequence expressing this recombinant protein (SEQ ID NO:3) was synthesized and then introduced into a pcDNA eukaryotic expression vector via NheI and BamHI restriction endonuclease sites.

[0030] The successfully constructed ovarian-targeting protein expression plasmid was introduced into DH5α E. coli competent cells and plated onto agar plates containing ampicillin resistance. After cloning sites appeared, single colonies were picked and inoculated into LB broth containing ampicillin for amplification. Plasmid extraction was then performed using an endotoxin-free plasmid extraction kit.

[0031] HEK-293T cells were seeded into 10cm diameter cell culture dishes. When the cell density reached approximately 80% confluence, plasmid transfection was performed using Lipofectine as the transfection reagent. TM 2000 liposome transfection reagent (purchased from Invitrogen). The amount of chromatin used for transfection of cells per 10 cm dish was 10 μg, and the corresponding volume of transfection reagent used was 30 μL.

[0032] Example 2

[0033] Collection and purification of ovarian-targeted exosomes:

[0034] 24 hours after plasmid transfection, the culture medium was replaced with DMEM containing 10% exosome-free fetal bovine serum. After 48 hours of sequence culture, the cell culture supernatant was harvested, and the exosomes in the supernatant were collected by differential centrifugation. The specific steps were as follows: ① Centrifuge at 350×g for 15 minutes at 4°C to remove cells; ② Centrifuge at 2,000×g for 20 minutes at 4°C to remove dead cells and cell debris; ③ Centrifuge at 12,000×g for 40 minutes at 4°C to remove large extracellular vesicles; ④ Centrifuge at 120,000×g for 90 minutes at 4°C to precipitate exosomes; ⑤ Resuspend the exosome precipitate with PBS buffer, centrifuge at 120,000×g for 70 minutes at 4°C, wash and collect the exosomes; ⑥ Resuspend the exosome precipitate with an appropriate volume of PBS, aliquot and freeze at -80°C.

[0035] Example 3

[0036] Ovarian-targeted exosomes loaded with antioxidants.

[0037] An appropriate concentration of small-molecule antioxidant was mixed with purified ovarian-targeting exosomes. The preferred small-molecule antioxidant was vitamin E, with a preferred concentration of 10 μM. The preferred concentration of ovarian-targeting exosomes was 1 × 10⁸ cells / mL. The mixture was sonicated using an ultrasonic homogenizer with a total power of 500 W, a φ2 amplitude rod, 40% power, and a 2-second pause after every 2 seconds of sonication, for a total of 5 minutes. After sonication, the mixture was incubated at room temperature for 30 minutes, followed by centrifugation at 120,000 × g for 70 minutes at 4°C to remove free small-molecule antioxidants.

[0038] The final structural diagram of the ovarian-targeted exosomes loaded with antioxidants is shown below. Figure 1 As shown.

[0039] The final nanoparticle size of ovarian-targeting exosomes before and after loading with vitamin E was determined. The experimental results are as follows: Figure 2As shown, the average diameter of ovarian-targeted exosomes before and after vitamin E loading was approximately 100 nanometers, consistent with typical exosome characteristics. Loading vitamin E via ultrasound did not significantly affect the particle size of the exosomes.

[0040] Example 4

[0041] Ovarian-targeting exosomes loaded with vitamin E were used to culture human ovarian granulosa cells (KGN cells) with the chemotherapy drug cisplatin and a solvent control. After drug treatment, cell proliferation was detected by CCK-8 assay, and apoptosis was detected by flow cytometry.

[0042] The results of the CCK-8 assay for cell proliferation viability are as follows: Figure 3 As shown, the addition of ovarian-targeting exosomes loaded with vitamin E significantly improved the reduction in granulosa cell viability caused by cisplatin treatment.

[0043] Experimental results of detecting cell apoptosis using flow cytometry, as follows: Figure 4 As shown, the addition of ovarian-targeting exosomes loaded with vitamin E significantly improved cisplatin-induced granulosa cell apoptosis.

[0044] Example 5

[0045] Detection of the ovarian protective effect of vitamin E-loaded ovarian-targeting exosomes on a mouse model of cisplatin chemotherapy.

[0046] Eight-week-old female C57BL / 6 mice that had undergone acclimatization were administered cisplatin intraperitoneally at a dose of 5 mg / kg. On day 1 post-administration, exosomes were injected intravenously via the tail vein at a dose of 100 μg per mouse, repeated every other day for a total of three injections. Samples were collected on day 7 post-cisplatin treatment. Ovaries were removed, paraffin-embedded, sectioned, stained with hematoxylin and eosin (HE), and examined under a light microscope for morphological and structural observation. The number of various follicle types was also counted.

[0047] The experimental results of ovarian tissue staining and follicle counting are as follows: Figure 5 As shown, compared with the control group, the total number of healthy follicles in the ovaries of mice treated with ovarian-targeted exosomes loaded with vitamin E was significantly increased.

Claims

1. An antioxidant-loaded ovary-targeted exosome, characterized by: The small molecule antioxidant is loaded into the ovary-targeting exosome by constructing the ovary-targeting exosome and then loading the small molecule antioxidant into the ovary-targeting exosome; the ovary-targeting exosome is obtained by genetically modifying exosome-producing cells so that the exosomes produced by the exosome-producing cells have ovary-targeting proteins on the surface of the exosomes; the exosome-producing cells are one of human embryonic kidney cells HEK-293T cells, human umbilical cord mesenchymal stem cells, human adipose tissue mesenchymal stem cells, and human amniotic membrane mesenchymal stem cells; the ovary-targeting protein is a recombinant protein composed of the 33rd to 53rd amino acids of the FSH protein and a connector sequence added in the middle of the Lamp2b protein, and the specific sequence is shown as SEQ ID NO: 4; and the small molecule antioxidant is vitamin E.

2. A preparation method of the ovary-targeting exosome loaded with the antioxidant according to claim 1, comprising the following steps: genetically modifying exosome-producing cells so that the exosomes produced by the exosome-producing cells have ovary-targeting proteins on the surface of the exosomes; and loading a small molecule antioxidant into the exosomes to obtain the ovary-targeting exosome loaded with the antioxidant.

3. An application of the ovary-targeting exosome loaded with the antioxidant according to claim 1 in preparing a drug for protecting ovaries during chemotherapy.

Images