Yeast genetically engineered bacterium for enhancing secretory expression of heterologous protein and application of yeast genetically engineered bacterium

Abstract

The invention discloses a yeast genetically engineered bacterium for enhancing secretory expression of heterologous protein and application of the yeast genetically engineered bacterium. According to the invention, yeast is used as an original strain, the yeast genetically engineered bacterium is constructed by introducing genes, and the introduced genes comprise any one of the following groups: (1) grpE gene; (2) a groES gene; (3) a groEL gene; (4) a PDI1 gene; (5) an ERO1 gene; (6) a dnaJ gene; (7) a tig gene; and (8) a dnaK gene. The chaperonin widely used in escherichia coli is applied to pichia pastoris for the first time, so that the secretory expression efficiency of heterologous protein is remarkably improved. According to the invention, glycosyl transferase EUGT11m which is difficult to express in pichia pastoris is selected as a model protein, and experiments find that after the molecular chaperones are introduced into the pichia pastoris, the EUGT11m not only realizes effective secretory expression, but also confirms the functionality of the EUGT11m through enzyme activity detection.

Description

Technical Field

[0001] The invention relates to the field of bioengineering, and in particular to a yeast genetic engineering bacterium for enhancing secretory expression of heterologous proteins and an application thereof. Background Art

[0002] Pichia pastoris, as a microorganism showing great potential in the field of biotechnology, has unique physiological characteristics and biological advantages that make it a preferred host for the production of exogenous proteins. The yeast can grow in an environment with methanol as the only carbon source and energy source. This feature not only simplifies the composition of the culture medium and reduces production costs, but also the amount of self-protein secreted by Pichia pastoris during growth is extremely low, making exogenous protein the main component of protein in the culture medium, greatly improving the purity of the target protein. This characteristic provides favorable conditions for the production of high-quality, high-purity protein products, especially in the fields of biopharmaceuticals and biotechnology, where the application value of Pichia pastoris is particularly outstanding.

[0003] The methanol-inducible promoter pAOX1 of Pichia pastoris is recognized as one of the most powerful promoters in eukaryotes. Its expression level can be precisely regulated by the methanol concentration, thereby achieving efficient induced expression of exogenous proteins. In addition, Pichia pastoris also has the ability of high-density fermentation and can reach high cell density in a short time, further improving production efficiency, which gives it a significant advantage in industrial-scale production. Therefore, Pichia pastoris is widely regarded as one of the most promising protein production hosts, especially in the production of therapeutic antibodies, enzyme preparations, vaccines and other biological drugs, and its application prospects are broad.

[0004] However, despite its excellent performance in protein production, Pichia pastoris still faces many challenges in expressing certain special proteins, especially complex enzymes such as glycosyltransferases. These challenges include but are not limited to insufficient expression levels, complete lack of protein expression, loss of activity due to the presence of proteins in inclusion bodies, and protein misfolding. These problems severely limit the scope of application of Pichia pastoris in the production of specific types of proteins, and also prompt researchers to continuously explore and optimize the protein expression system of Pichia pastoris.

[0005] In order to solve the above problems, genetic engineering technology has become a key means to improve the protein secretion and expression ability of Pichia pastoris. Through genetic engineering technology, Pichia pastoris can be transformed in a targeted manner and its protein expression path can be optimized. For example, through the multi-copy integration strategy of genes, the copy number of the target protein in the genome can be significantly increased, thereby improving the expression level of the protein. In addition, the introduction of specific protein tags, such as maltose binding protein (MBP), ubiquitin-like protein modifier (SUMO), thioredoxin (TrxA), etc., can not only increase the expression of the protein, but also promote the correct folding of the protein by improving the solubility and stability of the protein, and increase the yield of functional proteins. The application of these strategies provides an effective solution to overcome the difficulties encountered by Pichia pastoris in expressing complex proteins.

[0006] In addition to optimizing the number of gene copies and protein tags, integrating chaperone proteins is also an important way to improve the protein expression capacity of Pichia pastoris. Chaperone proteins, especially molecular chaperones, play a key role in promoting the correct folding and assembly of proteins in cells. By integrating these chaperone proteins in Pichia pastoris, the expression efficiency and secretion capacity of heterologous proteins can be significantly improved, especially for those proteins with complex structures and prone to misfolding. The introduction of chaperone proteins is particularly important. These chaperone proteins have a wide range of applicability and can act on a variety of proteins with significant differences in amino acid sequences to promote the formation of mature proteins with specific spatial structures and functions.

[0007] In summary, by genetically engineering Pichia pastoris and optimizing its protein expression system, we can not only effectively solve the problems encountered in expressing special proteins, but also further improve the protein yield and purity, and meet the demand for high-quality protein products in the fields of biopharmaceuticals and biotechnology. Summary of the invention

[0008] In order to achieve efficient secretory expression of some specific proteins in Pichia pastoris, we aim to enhance the problems of misfolding and non-expression faced by Pichia pastoris in the process of heterologous protein expression by introducing chaperone proteins from Escherichia coli and Saccharomyces cerevisiae. The present invention integrates chaperone protein-related genes from Escherichia coli and Saccharomyces cerevisiae, including dnaK gene, dnaJ gene, grpE gene, groES gene, groEL gene, tig gene, ERO1 gene and PDI1 gene, and evaluates their effects on enhancing heterologous protein expression. At the same time, Pichia pastoris chassis cells with enhanced protein expression ability of chaperone protein-related genes are also constructed.

[0009] The present invention provides a Pichia pastoris strain with enhanced heterologous protein expression ability, using Pichia pastoris as a starting strain and introducing the following chaperone protein gene:

[0010] (1) grpE gene;

[0011] (2) groES gene;

[0012] (3) groEL gene;

[0013] (4) PDI1 gene;

[0014] (5) ERO1 gene;

[0015] (6) dnaJ gene;

[0016] (7)tig gene;

[0017] (8)dnaK gene.

[0018] Preferably, the starting strain is Pichia pastoris. The Pichia pastoris in the embodiment of the present invention is the common Pichia pastoris GS115.

[0019] When introducing genes into the genetically engineered Pichia pastoris, the grpE gene, groES gene, groEL gene, PDI1 gene, ERO1 gene, dnaJ gene, tig gene and dnaK gene are respectively integrated into the Int55 site; the upstream ORF of the Int55 site is PAS_chr2-1_0635, and the downstream ORF is PAS_chr2-1_0634, and the sequence thereof is ACGAAGTAGAGGGAGCGGAG.

[0020] Among them, the dnaK gene is derived from Escherichia coli k-12, with Gene ID: 944750; the dnaJ gene is derived from Escherichia coli k-12, with Gene ID: 944753; the grpE gene is derived from Escherichia coli K-12, with Gene ID: 947097; the groES gene is derived from Mycobacterium tuberculosis H37Rv, with Gene ID: 887583; the groEL gene is derived from Staphylococcus aureus, with Gene ID: 3919674; the tig gene is derived from Staphylococcus aureus, with Gene ID: 6481854; the ERO1 gene is derived from Saccharomyces cerevisiae, with Gene ID: 854909; and the PDI1 gene is derived from Saccharomyces cerevisiae, with Gene ID: 850314.

[0021] The genes introduced into the preparation method of the genetically engineered strain of Pichia pastoris used in the present invention include (1) dnaK gene; (2) dnaJ gene; (3) grpE gene; (4) groES gene; (5) groEL gene; (6) tig gene; (7) ERO1 gene; and (8) PDI1 gene.

[0022] The preparation method comprises the following steps:

[0023] (1) The Cas9 nuclease encoding gene was expressed episomally in Pichia pastoris GS115 in the form of a plasmid using the CRISPR / Cas9 system;

[0024] (2) integrating the introduced gene into the Int55 site of strain a obtained in step (1) to obtain strain b;

[0025] (3) Integrating the coding gene of the heterologous protein into the strain b obtained in step (2) to obtain the yeast genetic engineering strain with enhanced secretory expression of glycosyltransferase.

[0026] Step (2) includes any of the following steps:

[0027] (2.1) Integrate the dnaK gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 1;

[0028] (2.2) Integrate the dnaJ gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 2;

[0029] (2.3) Integrate the grpE gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 3;

[0030] (2.4) Integrate the grpES gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 4;

[0031] (2.5) Integrate the groEL gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 5;

[0032] (2.6) Integrate the tig gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 6;

[0033] (2.7) Integrate the ERO1 gene into the Int55 site of Pichia pastoris strain GS115 to obtain strain 7;

[0034] (2.8) The PDI1 gene was integrated into the Int55 site of Pichia pastoris strain GS115 to obtain strain 8.

[0035] According to the above preparation method, Pichia pastoris chassis cells expressing chaperone proteins can be obtained.

[0036] The heterologous protein selected in the embodiment of the present invention is glycosyltransferase EUGT11m. The Gene ID of the gene encoding the glycosyltransferase EUGT11m is: 109208666.

[0037] The invention also provides the application of the yeast genetic engineering bacteria in enhancing the secretory expression of heterologous proteins.

[0038] Preferably, when the heterologous protein is glycosyltransferase EUGT11m, the substrate is rebaudioside A.

[0039] Beneficial effects of the present invention:

[0040] The genetically engineered Pichia pastoris strain of the present invention can successfully express some special proteins that cannot be expressed in the wild-type Pichia pastoris GS115, such as EUGT11m in glycosyltransferase. The Pichia pastoris strain with enhanced protein secretion expression ability can be used to express some proteins that cannot be expressed by the wild type, and can be used to construct a cell factory for Pichia pastoris protein expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is a map of plasmid pPIC9K-pAOX1-EUGT11m-tAOX1.

[0042] Figure 2 This is a map of plasmid HZP-sgRNA-Int55.

[0043] Figure 3 To detect the remaining amount of substrate rebaudioside A to reflect the enzymatic activity of glycosyltransferase EUGT11m (ie, the less the remaining amount of substrate, the stronger the enzyme activity).

[0044] Figure 4 This is a map of plasmid pPIC9K-pAOX1-tAOX1. DETAILED DESCRIPTION

[0045] In the following examples of the present invention, the exogenous gene was synthesized by GenScript Biotechnology Co., Ltd., the starting plasmids and strains used were stored in the laboratory, the primers used were synthesized by Youkang Biotechnology Co., Ltd., and the plasmid construction method was seamless cloning. Escherichia coli was purchased from Qingke Biotechnology Co., Ltd., DH5α was used for plasmid construction, and BL21 (DE3) was used for tool enzyme expression. Plasmid extraction kit, PCR product purification kit and gel recovery kit were purchased from Sangon Biotechnology (Shanghai) Co., Ltd. All enzymes used were purchased from New England Biotechnology Co., Ltd.

[0046] The LB medium formula is 5g / L yeast extract, 10g / L tryptone, and 10g / L sodium chloride. The YPD medium formula is 10g / L yeast extract, 20g / L peptone, and 20g / L glucose. The MD medium formula is 3.4g / L YNB (yeast nitrogen base), 10g / L ammonium sulfate, 0.4mg / L biotin, and 20g / L glucose. The BMGY medium formula is 10g / L yeast extract, 20g / L peptone, 10g / L glycerol, 3.4g / L YNB, 10g / L ammonium sulfate, 0.4mg / L biotin, and 100mmol / L phosphate buffer (pH6.0). The BMMY medium formula is yeast extract 10g / L, peptone 20g / L, YNB 3.4g / L, ammonium sulfate 10g / L, biotin 0.4mg / L, phosphate buffer (pH6.0) 100mmol / L, methanol 1% (v / v). The above medium formula is suitable for liquid medium preparation. If solid medium is prepared, 20g / L agar powder needs to be added.

[0047] Table 1 Primers used in amplifying genes and constructing plasmid vectors in the examples

[0048] Primer Sequence (5'-3') dnaK-F atgggtaaaataattggtat dnaK-R ttattttttgtctttgacttcttcaaa Int55-sgRNA-F acgcacgaagtagagggagcggag Int55-sgRNA-R aaacctccgctccctctacttcgt Int55-donor-F aagatctttgcaatgcatgg Int55-donor-R aagatctttgcaatgcatgg dnaJ-F atggctaagcaagattatta dnaJ-R ttagcgggtcaggtcgtcaaaaaacttcttc grpE-F atacattttagttattcgccaacgatgtctactcaacaagtttcttctg grpE-R caaatggcattctgacatcctcttgagttagtcgtccaacttaactggg grpES-F atgaatattcgtccattgca grpES-R ttacgcttcaacaattgccag grpEL-F atggcagctaaagacgtaaa grpEL-R ttacatcatgccgcccatgccaccca tig-F atacattttagttattcgccaacgatgtctactcaacaagtttcttctg tig-R caaatggcattctgacatcctcttgagttagtcgtccaacttaactggg EUGT11m-F atgggtaaaataattggtat EUGT11m-R tcagtctttgtaggaccgta AOX-CHECK-F ttttaacgacttttaacga AOX-CHECK-R ctgatcaggagcaagctcgta T7-CHECK-F taatacgactcactatagg T7-CHECK-R acccgtttagaggccccaa ERO1-F atgagattaagaaccgccattgccacact ERO1-R ttattgtatatctagcttataggaaatag PDI1-F atgaagttttctgctggtgccgt PDI1-R ttacaattcatcgtgaatggcatcttc

[0049] Table 2 Plasmids used for strain construction and their genotypes

[0050] Plasmid Genotype pPIC9K-pAOX1-tAOX1 HIS4, G418 pPIC9K-pAOX1-EUGT11m-tAOX1 HIS4, G418, pAOX1-EUGT11m-tAOX1 pET-28a(+) Kan pGAP-Cas9 HIS4, pGAP-Cas9 HZP-sgRNA-Int55 PARS1, zeocin, pSER, Int55 Int55-tig Int55-pAOX1-tig-tAOX1 Int55-grpES Int55-pAOX1-grpES-tAOX1 Int55-grpE Int55-pAOX1-grpE-tAOX1 Int55-grpEL Int55-pAOX1-grpEL-tAOX1 Int55-dnaJ Int55-pAOX1-dnaJ-tAOX1 Int55-dnaK Int55-pAOX1-dnaK-iAOX1 Int55-ERO1 Int55-pAOX1-ERO1-tAOX1 Int55-PDI1 Int55-pAOX1-PDI1-tAOX1

[0051] The primers used for amplifying genes and constructing plasmid vectors in the examples are shown in Table 1, and the plasmids used for strain construction and their genotypes are shown in Table 2.

[0052] Example 1: Construction of strain 1

[0053] The Int refers to the insertion site of the Pichia pastoris GS115 genome. The auxiliary plasmid Int55-pAOX1-tAOX1 (sequence as shown in SEQ ID No. 1) used is composed of a universal skeleton (ampicillin resistance gene expression cassette plus the replication initiation site ori of the prokaryotic gene plasmid) and 500bp homology arms upstream and downstream of the site; the auxiliary plasmids HZP-sgRNA, HHP-sgRNA and HGP-sgRNA are detailed in the applicant's previous patent application with publication number CN114507613A and invention name "A yeast engineering bacteria for fermentation and production of α-santalene and its application". 。

[0054] Starting from the auxiliary plasmid Int55-pAOX1-tAOX1, the recombinant vector Int55-pAOX1-chaperone protein-tAOX1 was obtained; starting from the auxiliary plasmid HZP-sgRNA, sgRNA-Int55 was introduced using the restriction site BsaI in the vector to obtain the recombinant vector HZP-sgRNA-Int55. Then, the donor primers were designed using the recombinant vector Int55-pAOX1-chaperone protein-tAOX1 as a template, and PCR was performed to obtain the corresponding Int55-donor, which was co-transformed into the Pichia pastoris cell GS115 (the Cas9 protein encoding gene was introduced by the Pichia pastoris GS115 strain plasmid) to obtain the recombinant strain.

[0055] (1) Construction of gene vector of chaperone protein dnaK:

[0056] The gene encoding the chaperone protein dnaK (Gene ID: 944750) was amplified from the genome of Escherichia coli k-12 as a template, and the primers dnaK-F / dnaK-R were designed to amplify the target gene dnaK, which was assembled with the vector Int55-pAOX1-tAOX1 after restriction digestion using the seamless cloning method, and transformed into the Escherichia coli DH5α strain to obtain the recombinant vector Int55-pAOX1-dnaK-tAOX1. The primer sequences used are shown in Table 1.

[0057] (2) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int55

[0058] Using plasmid HZP-sgRNA as a template, primers Int55-sgRNA-F and Int55-sgRNA-R were designed, and Int55-sgRNA was introduced using the restriction site BsaI in the vector HZP-sgRNA. The recombinant vector HZP-sgRNA-Int55 was obtained by T4 enzyme ligation. Figure 2 .

[0059] (3) Transformation of recombinant Pichia pastoris strains containing chaperone dnaK

[0060] Primers Int55-donor-F and Int55-donor-R were designed using the recombinant vector Int55-pAOX1-dnaK-tAOX1 as a template, and PCR was performed to obtain the corresponding linearized fragment Int55-donor, which was transformed into Pichia pastoris cells GS115 with the corresponding recombinant guide plasmid HZP-sgRNA-Int55 and pGAP-Cas9 plasmid to obtain recombinant strain 1. The primer sequences used are shown in Table 1.

[0061] Example 2: Construction of strain 2

[0062] (1) Construction of gene vector of chaperone protein dnaJ

[0063] The gene encoding the chaperone protein dnaJ (Gene ID: 944753) was amplified from the genome of Escherichia coli k-12 as a template, and the primers dnaJ-F / dnaJ-R were designed to amplify the target gene dnaJ, which was assembled with the vector Int55-pAOX1-tAOX1 after restriction digestion using the seamless cloning method and transformed into the Escherichia coli DH5α strain to obtain the recombinant vector Int55-pAOX1-dnaJ-tAOX1. The primer sequences used are shown in Table 1.

[0064] (2) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int55

[0065] Using plasmid HZP-sgRNA as a template, primers Int55-sgRNA-F and Int55-sgRNA-R were designed, and Int55-sgRNA was introduced using the restriction site BsaI in the vector HZP-sgRNA, and the recombinant vector HZP-sgRNA-Int55 was obtained by T4 enzyme ligation. The primer sequences used are shown in Table 1.

[0066] (3) Transformation of chaperone dnaJ recombinant strains of Pichia pastoris

[0067] Primers Int55-donor-F and Int55-donor-R were designed using the recombinant vector Int55-pAOX1-dnaJ-tAOX1 as a template, and PCR was performed to obtain the corresponding linearized fragment Int55-donor. It was then transformed into Pichia pastoris cells GS115 along with the corresponding recombinant guide plasmid HZP-sgRNA-Int55 and pGAP-Cas9 plasmid to obtain recombinant strain 2.

[0068] Example 3: Construction of strain 3

[0069] The recombinant strain 3 was constructed with the gene encoding the chaperone protein grpE (Gene ID: 947097), and the construction method was the same as that of Examples 1 and 2. The primer sequences used are shown in Table 1.

[0070] Example 4: Construction of strain 4

[0071] The recombinant strain 4 was constructed with the gene encoding the chaperone protein groES (Gene ID: 887583). The construction method was the same as that of Examples 1 and 2. The primer sequences used are shown in Table 1.

[0072] Example 5: Construction of strain 5

[0073] The recombinant strain 5 was constructed with the gene encoding the chaperone protein groEL (Gene ID: 3919674). The construction method was the same as that of Examples 1 and 2. The primer sequences used were shown in Table 1.

[0074] Example 6: Construction of strain 6

[0075] The recombinant strain 6 was constructed with the coding gene of the chaperone protein tig (Gene ID: 6481854). The construction method was the same as that of Examples 1 and 2. The primer sequences used were shown in Table 1.

[0076] Example 7: Construction of strain 7

[0077] The recombinant strain 7 was constructed with the gene encoding the chaperone protein ERO1 (Gene ID: 854909). The construction method was the same as that of Examples 1 and 2. The primer sequences used are shown in Table 1.

[0078] Example 8: Construction of strain 8

[0079] The recombinant strain 8 was constructed with the gene encoding the chaperone protein PDI1 (Gene ID: 850314). The construction method was the same as in Examples 1 and 2. The primer sequences used are shown in Table 1.

[0080] Application Example 1: Protein expression ability test and application of recombinant Pichia pastoris strains

[0081] Plasmid pPIC9K-pAOX1-tAOX1 (see Figure 4 ) was digested with restriction endonucleases EcoRI and NdeI, and the gene encoding glycosyltransferase EUGT11m was introduced, with Gene ID: 109208666, and transformed into Escherichia coli DH5α strain. The transformants were verified with primers AOX-CHECK-F and AOX-CHECK-R, and positive recombinants were screened to obtain the recombinant plasmid pPIC9K-pAOX1-EUGT11m-tAOX1 (plasmid map see Figure 1 ).

[0082] The plasmid pPIC9K-pAOX1-EUGT11m-tAOX1 was extracted, digested with the restriction endonuclease SalI, and transformed into the Pichia recombinant strain constructed in Example 1-6. After transformation, it was revived in 1 mol / L sorbitol for 4 h at 30°C and 250 rpm, spread on an SC plate, and cultured at 30°C. When a single colony grows, it is transferred to a YPD plate containing different concentrations of G418 and cultured at 30°C. Strains that grow well on YPD plates containing 2 g / L G418 were screened, and verified by primers AOX-CHECK-F and AOX-CHECK-R to obtain strains 9-16 (different chaperone protein chassis strains express glycosyltransferase EUGT11m respectively).

[0083] The expression and enzyme activity of the glycosyltransferase EUGT11m of the above strain 9-16 were determined as follows:

[0084] (1) Shake flask culture method of strain 9-16

[0085] After the strains 9-16 in the above examples were activated on YPD plates, single colonies were picked and inoculated into 5 mL YPD test tubes, cultured at 30°C, 250 rpm for 16-20 h, inoculated into 50 mL BMGY medium at 1% (v / v) inoculum, and cultured at 30°C, 250 rpm for 24 h. Centrifuged at 6000 rpm for 5 min, collected the cells, discarded the supernatant, and washed twice. All the cells were transferred to 50 mL BMMY medium, fermented at 30°C, 250 rpm for 4 days, and 1% (v / v) methanol was added every 24 h.

[0086] (2) Enzyme activity detection based on glycosyltransferase EUGT11m

[0087] The supernatant of Pichia pastoris fermentation broth (containing glycosyltransferase EUGT11m) was added to the enzyme reaction system, with a total system of 500 μL, including components and final concentrations of 50 mmol / L pH 8.0 potassium phosphate buffer, 1 mmol / L rebaudioside A, 2 mmol / L UDP-G, and 3 mmol / L MgCl2. The remaining volume was made up with the fermentation supernatant and reacted at 35°C for 24 h.

[0088] (3) Rebaudioside A detection method

[0089] Sample treatment: Take 100 μL of the catalytic reaction solution in step (2), add 900 μL of methanol, centrifuge at 10,000 rpm for 5 min, take the supernatant and filter it through a 0.22 μm nylon filter membrane for HPLC detection.

[0090] HPLC detection conditions: ShimNex CS C18 (5μm, 4.6×250 mm) chromatographic column, column temperature controlled at 35°C, detection wavelength 210nm, injection volume 10μL. Chromatographic conditions: mobile phase A is pH 2.6 phosphoric acid solution, mobile phase B is acetonitrile, 0-5min, 10%-25% B; 5-25min, 25%-40% B; 25-35min, 40% B; 35-36min, 40%-10% B; 36-40min, 10% B.

[0091] Experimental results ( Figure 3 ) in the in vitro enzyme catalytic conversion experiment conducted in, rebaudioside A (RA) was converted into rebaudioside D (RD) under the catalysis of glycosyltransferase EUGT11m. Therefore, the experimental results in Figure 3 show that the less the amount of RA remaining as a reaction substrate in the system after the enzyme catalytic reaction, the higher the expression level of glycosyltransferase EUGT11m, otherwise there is no expression or the expression level is low.

[0092] The results showed that the constructed Pichia pastoris recombinant strain chassis cell strain 11 had the highest conversion efficiency for the substrate rebaudioside A, so the expression level of glycosyltransferase EUGT11m of strain 11 was the highest, verifying that chassis strain 3 can increase the secretory expression of heterologous proteins in Pichia pastoris and that the proteins it expresses have biological functions.

Claims

1. A genetically engineered yeast strain for enhancing secretory expression of heterologous proteins, characterized in that: The yeast genetic engineering bacteria are obtained by using yeast as a starting strain and introducing genes, wherein the introduced genes include any one of the following groups: (1) grpE gene; (2) groES gene; (3) groEL gene; (4) PDI1 gene; (5) ERO1 gene; (6) dnaJ gene; (7)tig gene; (8)dnaK gene.

2. The yeast genetic engineering bacteria for enhancing secretory expression of heterologous proteins according to claim 1, characterized in that: The starting strain is Pichia pastoris.

3. The yeast genetic engineering bacteria for enhancing secretory expression of heterologous proteins according to claim 1, characterized in that: When introducing the gene, the introduced gene was integrated into the Int55 site; the upstream ORF of the Int55 site was PAS_chr2-1_0635, and the downstream ORF was PAS_chr2-1_0634.

4. The yeast genetic engineering bacteria for enhancing secretory expression of heterologous proteins according to claim 1, characterized in that: The dnaK gene is derived from Escherichia coli k-12, and its Gene ID is 944750; the dnaJ gene is derived from Escherichia coli k-12, and its Gene ID is 944753; the grpE gene is derived from Escherichia coli K-12, and its Gene ID is 947097; the groES gene is derived from Mycobacterium tuberculosis H37Rv, and its Gene ID is 887583; the groEL gene is derived from Staphylococcus aureus, and its Gene ID is 3919674; the tig gene is derived from Staphylococcus aureus, and its Gene ID is 6481854; the ERO1 gene is derived from Saccharomyces cerevisiae, and its Gene ID is 854909; and the PDI1 gene is derived from Saccharomyces cerevisiae, and its Gene ID is 850314.

5. A method for preparing a yeast genetically engineered bacterium for enhancing secretory expression of heterologous proteins according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) The Cas9 nuclease encoding gene was expressed in Pichia pastoris GS115 in the form of a plasmid using the CRISPR / Cas9 system to obtain strain a; (2) integrating the introduced gene into the Int55 site of strain a obtained in step (1) to obtain strain b; (3) Integrating the coding gene of the heterologous protein into the strain b obtained in step (2) to obtain the yeast genetic engineering strain with enhanced secretory expression of glycosyltransferase.

6. The preparation method according to claim 5, characterized in that: The heterologous protein is glycosyltransferase EUGT11m.

7. The preparation method according to claim 6, characterized in that: The GeneID of the gene encoding the glycosyltransferase EUGT11m is: 109208666.

8. Use of the genetically engineered yeast according to any one of claims 1 to 4 in enhancing secretory expression of heterologous proteins.

9. The use according to claim 8, characterized in that: When the heterologous protein is glycosyltransferase EUGT11m, the substrate is rebaudioside A.

Images