Bacillus simplex and application thereof in uranium enrichment

Abstract

The invention discloses bacillus simplex A16 which is registered and preserved in the China Center for Type Culture Collection on July 18, 2024, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: M 20241597. The application of the bacillus simplex in uranium enrichment comprises the following steps: inoculating a ring of bacillus simplex into a peptone fermentation culture medium, and culturing in a shaking table for 20-28 hours to obtain a bacterial solution with an OD600 value of 1.6-2.0; centrifuging the obtained bacterial liquid, discarding the supernatant, and washing the precipitate with sterile water for 2-4 times to obtain thalli; and under the aerobic condition, adding the obtained thalli into a uranium solution, and culturing in a shaking table for 2-24 hours. The invention provides bacillus simplex A16, which can quickly remove uranyl ions in a water body, effectively reduce the concentration of uranium and achieve the purpose of repairing the uranium-polluted water body.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and more specifically, relates to a simple bacillus and application thereof in uranium enrichment. Background Art

[0002] Radioactive uranium is the main raw material for nuclear power. During the mining and use of uranium, some of it will leak into the environment, causing a great impact on the aquatic ecosystem. Therefore, it is very important to choose a suitable method to remove radioactive uranium from the soil. Bioremediation technology has natural advantages such as environmental friendliness, low cost, sustainability, small ecological disturbance, and little damage to the functions of environmental media. It is increasingly widely used in the field of pollution remediation. Under long-term pollution stress, environmental microorganisms in tailings and surrounding areas have evolved complex and diverse resistance and tolerance mechanisms, becoming the most important germplasm resource bank for pollution remediation. Therefore, screening dominant strains and exploring mechanisms from soil contaminated by uranium tailings is conducive to the exploration of functional microorganisms for pollution remediation and the promotion and application of pollution remediation technology, laying the foundation for the remediation of uranium-contaminated environments.

[0003] Microorganisms are the most diverse and widely distributed life forms on Earth so far. Compared with plants and animals in the same growth environment, microbial communities are more sensitive to soil radioactive contamination stress. The number of sensitive microorganisms will decrease rapidly, while tolerant microorganisms can adapt to environmental changes and their relative abundance will increase significantly. Therefore, people can use microorganisms to treat low-concentration uranium-containing wastewater and uranium-containing soil. As an important part of the Earth's complex ecosystem, the water environment plays a role in maintaining the biogeochemical nutrient energy cycle and ensuring the balance between its internal ecosystems. It is of great significance to develop a microbial strain that can efficiently adsorb uranium in the water environment. Summary of the invention

[0004] An object of the present invention is to solve at least the above problems and / or disadvantages and to provide at least the advantages which will be described hereinafter.

[0005] In order to achieve these purposes and other advantages of the present invention, a simple Bacillus is provided, which is Bacillus simplex A16 (Bacillus simplex A16), which has been registered and preserved in the China Center for Type Culture Collection on July 18, 2024, with a preservation number of CCTCC NO: M20241597.

[0006] Preferably, the 16s rDNA sequence of Bacillus simplex is as shown in SEQ ID NO:1.

[0007] A simple Bacillus as described above is used for the enrichment of uranium.

[0008] Preferably, the use of the simple bacillus in uranium enrichment comprises the following steps:

[0009] Step 1: Take a loop of Bacillus simplex A16 cells and inoculate it into 50 mL of peptone fermentation medium. Incubate in a shaker for 20 to 28 hours to obtain an OD 600 The bacterial solution has a value of 1.6 to 2.0;

[0010] Step 2: Take the bacterial solution obtained in step 1, centrifuge it, discard the supernatant, and wash the precipitate with sterile water 2 to 4 times to obtain the bacterial cells;

[0011] Step 3: Under aerobic conditions, add the bacteria obtained in step 2 to the uranium solution and culture in a shaker for 2 to 24 hours.

[0012] Preferably, in step 1, the peptone fermentation medium comprises the following components: 10 g peptone, 5 g yeast extract powder, 10 g sodium chloride and 1 L distilled water, pH 7, sterilized at 121° C. for 15 min.

[0013] Preferably, in step 1, the culture is carried out in a shaking incubator at 30° C. and a rotation speed of 120 to 150 r / min.

[0014] Preferably, in step 2, the centrifugation is performed at 7000-9000 r / min at room temperature for 3-7 minutes.

[0015] Preferably, in step 3, based on the volume of the uranium solution, the amount of bacteria added is 0.08 to 0.48 g / L.

[0016] Preferably, in step 3, based on the volume of the uranium solution, the amount of bacteria added is 0.24-0.48 g / L.

[0017] Preferably, in step 3, the uranium concentration of the uranium solution is 25-200 mg / L, and the pH is 4.0-8.0.

[0018] Preferably, in step 3, the uranium concentration of the uranium solution is 25-75 mg / L, and the pH is 5.0-7.0.

[0019] Preferably, in step three, the culture is carried out in a shaking incubator at 30° C. and a rotation speed of 120 to 150 r / min.

[0020] Preferably, the step three is replaced by: under aerobic conditions, adding the bacteria obtained in step two to a uranium solution, placing the obtained solution in a DC electric field for treatment for 1 to 3 hours, and then continuing to culture in a shaker for 2 to 23 hours; wherein the specific method of treatment in the DC electric field is: placing the solution between two stainless steel electrode plates with a spacing of 14 to 30 cm between the electrode plates, applying DC power at both ends of the electrode plates with an electric field strength of 0.5 to 2.0 V / cm, and switching the polarity of the electrode plates every 20 to 40 minutes.

[0021] The present invention at least includes the following beneficial effects: the present invention provides a simple bacillus A16 (Bacillussimplex A16), which can quickly remove uranyl ions in water bodies, effectively reduce the concentration of uranium, and achieve the purpose of repairing uranium-contaminated water bodies. When the uranium concentration of the uranium solution is 50 mg / L, the pH value is 6, the ambient temperature is 30°C, and the bacterial cell dosage is 0.32 g / L, A16 has the best adsorption effect on uranium, the adsorption rate of uranium within 1 hour exceeds 80%, the final adsorption rate reaches 89%, and the adsorption amount is 138 mg / g; compared with traditional physical and chemical methods, the microbial remediation method of the present invention generates less harmful substances during the treatment process, has less impact on the environment and human health, is simple to operate, has low technical requirements on operators, and is easy to promote and apply.

[0022] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The morphological characteristics of the 20 uranium-resistant bacteria initially screened in Example 1;

[0024] Figure 2 Comparison of uranium adsorption rates of the four uranium-resistant dominant bacteria obtained by repeated screening in Example 1;

[0025] Figure 3 Gram staining of strain A16 in Example 1;

[0026] Figure 4 This is the SEM image of strain A16 in Example 1;

[0027] Figure 5 is the evolutionary tree of A16 in Example 1;

[0028] Figure 6 is the standard curve graph of uranium;

[0029] Figure 7 The effect of initial uranium concentration on the uranium removal performance of strain A16 in Example 2 (left: adsorption rate, right: adsorption amount);

[0030] Figure 8 The effect of the amount of bacterial cells added in Example 3 on the uranium removal performance of the A16 strain (left: adsorption rate, right: adsorption amount);

[0031] Fig. 9 The effect of pH value on the uranium removal performance of strain A16 in Example 4 (left: adsorption rate, right: adsorption amount);

[0032] Fig.10 The effect of temperature on the uranium removal performance of strain A16 in Example 5 (left: adsorption rate, right: adsorption amount);

[0033] Fig.11 This is the effect of different ions on the uranium removal performance of the A16 strain in Example 6. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0035] It should be understood that the terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0036] In the following examples, the uranium separation medium includes the following components: 0.105 g uranium, 10 g peptone, 5 g yeast extract, 10 g sodium chloride and 1 L distilled water, pH 7, sterilized at 121° C. for 15 min.

[0037] The peptone fermentation medium includes the following components: 10 g of peptone, 5 g of yeast extract powder, 10 g of sodium chloride and 1 L of distilled water, pH 7, sterilized at 121°C for 15 min.

[0038] The peptone fermentation solid medium includes the following components: 10 g peptone, 5 g yeast extract powder, 10 g sodium chloride, 20 g agar and 1 L distilled water, pH 7, sterilized at 121°C for 15 min.

[0039] Example 1

[0040] A simple Bacillus, wherein the simple Bacillus is simple Bacillus A16 (Bacillus simplexA16), which has been registered and deposited in the China Center for Type Culture Collection on July 18, 2024, and the deposit number is CCTCC NO: M20241597;

[0041] For the separation and identification of the simple Bacillus A16 of the present invention:

[0042] 1. Identification method:

[0043] The strain of the present invention was isolated from uranium mine soil contaminated with high concentration of uranium:

[0044] Initial screening:

[0045] 10 g of fresh soil (from a uranium mining area in Sichuan Province, China) was placed in a 250 mL sterile conical flask, 90 mL of sterile water was added and stirred for 30 min to obtain a bacterial suspension. 1 mL of the bacterial suspension was added to 9 mL of sterile water and diluted according to a gradient to prepare 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 Take 100 μL of the bacterial suspension of different concentrations, spread it on the uranium separation medium, invert it in a 30°C incubator and culture it for 24 hours, and observe the growth of the strain. When screening the strain, you should choose a single colony with a larger diameter. Inoculate the purified single colony into the peptone fermentation medium and culture it for 24 hours. The strain that can make the medium turbid is preserved in glycerol and numbered. After multiple enrichments of uranium-resistant bacteria in the soil samples, a total of 20 strains with good growth were obtained from the uranium separation medium. They were numbered A1 to A20 according to the separation time, and the colony morphology was recorded. The morphology of the 20 strains is as follows: Figure 1 As shown, 20 isolated strains were deposited as slant deposits.

[0046] Rescreening:

[0047] One loopful of each of the 20 strains obtained from the initial screening was inoculated into a peptone fermentation medium and cultured in a shaking incubator at 30°C and 150 r / min for 1 day. Then, equal amounts of different bacteria were added into a 250 mL conical flask containing 100 mL of peptone fermentation medium containing 400 mg / L uranium, and cultured at a rotation speed of 150 r / min and a temperature of 30°C. The growth of the bacteria was observed, and four uranium-resistant dominant bacteria were obtained, which were numbered A3, A14, A16, and A18 respectively.

[0048] The dominant uranium-resistant bacteria were activated, and the same amount of different bacteria were added to a 250mL conical flask containing 100mL uranium solution containing 50mg / L uranium, with a dosage of 0.6g / L. The culture was shaken at a speed of 150r / min and a temperature of 30℃ for 2h. The final experimental strain was determined by comparing the adsorption rate of uranium by different bacteria. Figure 2 As shown, strain number A16 had the highest adsorption rate and the best effect, so strain A16 was selected as the target strain for subsequent experiments.

[0049] Identification:

[0050] Morphological characteristics: The strain was inoculated on a peptone fermentation medium, cultured at 30°C, and its growth, colony color, size, shape, edge, surface, protrusion, and transparency were recorded. In a sterile operating table, a single colony was picked onto a glass slide for preparing slides for Gram staining, and the morphological characteristics of the bacteria were observed under an optical microscope. In addition, the pre-treated bacterial solution was fixed overnight in a 2.5% (v / v) glutaraldehyde solution at 4°C, and then the samples were dehydrated using ethanol solutions of different concentrations. The dehydrated samples were frozen for 24 hours, vacuum dried, sputtered gold-plated, and observed using a scanning electron microscope. Through observation, the colonies of strain A16 on a peptone fermentation solid medium were round, white, with irregular edges, wrinkled surfaces, protruding centers, and opaque; a biofilm was generated when left stationary after liquid culture; Gram staining showed that the bacteria were purple, such as Figure 3 As shown, the bacteria are positive bacteria; scanning electron microscopy revealed that the strain has a short rod-shaped structure, such as Figure 4 As shown; the strain of the present invention meets the characteristics of Bacillus;

[0051] Molecular biological identification: The pre-cultured strain was placed in a 2mL PE tube, and the DNA of the target strain was extracted using the TSI NGKE Plant DNA Extraction Kit (Universal). Then the universal primer 27F / 1492R for bacteria was used for PCR amplification. The amplification system was: 45μL 1×TSE101 Gold Mix, 2μL upstream primer (GAGAGTTTGATCCTGGCTCAG), 2μL downstream primer (TACGGCTACCTTGTTACGAC), 1μL DNA template, a total of 50μL. The amplification program was: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 55℃ annealing for 15s, 72℃ extension for 15s / kb, 39 cycles; then 72℃ extension for 5min; finally stored at 4℃. The amplified PCR product was subjected to agarose gel electrophoresis to observe whether the band meets the sequencing requirements. If it meets the requirements, the prepared PCR product was sent to Qingke Biotechnology Co., Ltd. for sequencing. After completion, the sequencing results were spliced ​​using ContigExpress, and after removing the inaccurate parts at both ends, the spliced ​​sequences were compared in the NCBI database (blast.ncbi.nlm.nih.gov), and the 16S rDNA sequences with high similarity were analyzed, and the phylogenetic tree was constructed using the software MEGA11.0;

[0052] 16S rDNA sequencing: The 16S rDNA product was submitted to Chengdu Qingke Biotechnology Co., Ltd. for sequencing, and the full-length 16S rDNA sequence of the isolated strain was obtained, totaling 1468bp. The obtained 16S rDNA sequence was compared with the gene sequences of known bacterial species in the GeneBank database using the Blast program on the NCBI website. The results showed that the strain was most closely related to the genus Bacillus. After sequencing, the gene sequence of the 16S rDNA of the isolated strain A16 was obtained as SEQ ID NO: 1;

[0053] Phylogenetic tree analysis of strains: Through systematic comparison, gene sequences with close genetic relationships in the genus Bacillus were obtained from the database, and the phylogenetic tree was constructed by the neighbor-joining method, such as Figure 5 As shown in the figure, strain A16 is in the same branch as Peribacillus simplex strain LMG 11160 in the phylogenetic tree, indicating that it is most closely related to Peribacillus simplex strain. Combining morphological and physiological and biochemical characteristics, strain A16 was preliminarily identified as Peribacillus simplex strain.

[0054] like Figure 4 , Figure 5 The SEM image of the strain and the phylogenetic tree analysis showed that strain A16 was Bacillus simplex.

[0055] The present invention uses the arsenazo III spectrophotometer method to measure the uranium concentration: 0.5 mL of U solution is sequentially added with 0.1 mL of 0.5 M hydrochloric acid and 0.02 mL of 0.1% arsenazo III solution, 0.2 mL is sucked and added to a 96-well ELISA plate, three replicates are made for each sample, and the absorbance at 652 nm is measured using an ELISA instrument. According to the standard curve, the U concentration is calculated as 4.5522*OD 652 -0.2075(R 2 =0.9997), the error of each experiment does not exceed 5%; Figure 6 As shown, the standard curve is: y = 4.5522x-0.2075, R 2 =0.9997.

[0056] The adsorption rate and adsorption amount of uranium are calculated according to the following formula:

[0057] Adsorption rate (%) = (C0-C t ) / C0×100%;

[0058] Adsorption amount (mg / g) = (C0-C t ) / m×V;

[0059] Where C0 is the initial concentration of uranium in the solution (mg / L); C t is the initial concentration of uranium in the solution at the adsorption time t (mg / L); m is the amount of bacteria added (g); V is the volume of the solution (L).

[0060] Example 2

[0061] The application of a simple bacillus in uranium enrichment includes the following steps:

[0062] Step 1: Take a loop of bacteria, namely Bacillus simplex A16, and inoculate it into 50 mL of peptone fermentation medium. Incubate it in a shaker at 30°C and 150 rpm for about 24 hours until the stable phase. The OD value of the bacterial solution is 600 The value is 1.8 (±0.15);

[0063] Step 2: Take 10 mL of the bacterial solution obtained in step 1, centrifuge at 8000 r / min for 5 minutes at room temperature, discard the supernatant, add 10 mL of sterile water to the precipitate and mix thoroughly, centrifuge again at 8000 r / min for 5 minutes, repeat the washing of the precipitate 3 times, and obtain the bacterial cells;

[0064] Step 3: Fill 150 mL Erlenmeyer flasks with 50 mL of uranium solutions containing uranium concentrations of 25, 50, 75, 100, 150, and 200 mg / L, respectively, adjust the pH of the uranium solution to 7.0 with 0.1 mol / L HCl and NaOH, pour the bacteria prepared in step 2 into the uranium solution under aerobic conditions, and culture in a shaker at 30°C and 150 r / min for 24 h; during the experiment, take samples at 0 to 24 h, determine the uranium concentration of the supernatant, and calculate the effect of the initial uranium concentration on the uranium removal performance of A16.

[0065] Example 3

[0066] The application of a simple bacillus in uranium enrichment includes the following steps:

[0067] Step 1: Take a loop of bacteria, namely Bacillus simplex A16, and inoculate it into 50 mL of peptone fermentation medium. Incubate it in a shaker at 30°C and 150 rpm for about 24 hours until the stable phase. The OD value of the bacterial solution is 600 The value is 1.8 (±0.15);

[0068] Step 2: Take the bacterial solution obtained in step 1, centrifuge at 8000 r / min for 5 minutes at room temperature, discard the supernatant, add sterile water to the precipitate and mix thoroughly, centrifuge again at 8000 r / min for 5 minutes, repeat the washing of the precipitate 3 times, and obtain the bacterial cells;

[0069] Step 3: Place 50 mL of a uranium solution containing 50 mg / L of uranium in a 150 mL conical flask, adjust the pH of the uranium solution to 7.0 with 0.1 mol / L HCl and NaOH, and pour the bacteria prepared in step 2 into the uranium solution under aerobic conditions. The bacteria dosages are 0.08, 0.16, 0.24, 0.32, 0.40, and 0.48 g / L, respectively. The cells are cultured in a shaker at 30°C and a speed of 150 r / min. During the experiment, samples are taken at 0 to 24 h to determine the uranium concentration of the supernatant, and the effect of the bacteria dosage on the uranium removal performance of A16 is calculated.

[0070] Example 4

[0071] The application of a simple bacillus in uranium enrichment includes the following steps:

[0072] Step 1: Take a loop of bacteria, namely Bacillus simplex A16, and inoculate it into 50 mL of peptone fermentation medium. Incubate it in a shaker at 30°C and 150 rpm for about 24 hours until the stable phase. The OD value of the bacterial solution is 600 The value is 1.8 (±0.15);

[0073] Step 2: Take 10 mL of the bacterial solution obtained in step 1, centrifuge at 8000 r / min for 5 minutes at room temperature, discard the supernatant, add 10 mL of sterile water to the precipitate and mix thoroughly, centrifuge again at 8000 r / min for 5 minutes, repeat the washing of the precipitate 3 times, and obtain the bacterial cells;

[0074] Step 3: Place 50 mL of a uranium solution containing 50 mg / L of uranium in a 150 mL conical flask, adjust the pH of the uranium solution to 4.0, 5.0, 6.0, 7.0, and 8.0 with 0.1 mol / L HCl and NaOH, pour the bacteria prepared in step 2 into the uranium solution under aerobic conditions, and culture in a shaker at 30° C. and 150 r / min. During the experiment, take samples at 0 to 24 h, determine the uranium concentration of the supernatant, and calculate the effect of pH on the uranium removal performance of A16.

[0075] Example 5

[0076] The application of a simple bacillus in uranium enrichment includes the following steps:

[0077] Step 1: Take a loop of bacteria, namely Bacillus simplex A16, and inoculate it into 50 mL of peptone fermentation medium. Incubate it in a shaker at 30°C and 150 rpm for about 24 hours until the stable phase. The OD value of the bacterial solution is 600 The value is 1.8 (±0.15);

[0078] Step 2: Take 10 mL of the bacterial solution obtained in step 1, centrifuge at 8000 r / min for 5 minutes at room temperature, discard the supernatant, add 10 mL of sterile water to the precipitate and mix thoroughly, centrifuge again at 8000 r / min for 5 minutes, repeat the washing of the precipitate 3 times, and obtain the bacterial cells;

[0079] Step 3: Place 50 mL of a uranium solution containing 50 mg / L of uranium in a 150 mL conical flask, adjust the pH of the uranium solution to 7.0 with 0.1 mol / L HCl and NaOH, pour the bacteria prepared in step 2 into the uranium solution under aerobic conditions, and culture them in a shaker at 20-40° C. and a speed of 150 r / min; during the experiment, take samples at 0-24 h, determine the uranium concentration of the supernatant, and calculate the effect of temperature on the uranium removal performance of A16.

[0080] Example 6

[0081] The application of a simple bacillus in uranium enrichment includes the following steps:

[0082] Step 1: Take a loop of bacteria, namely Bacillus simplex A16, and inoculate it into 50 mL of peptone fermentation medium. Incubate it in a shaker at 30°C and 150 rpm for about 24 hours until the stable phase. The OD value of the bacterial solution is 600 The value is 1.8 (±0.15);

[0083] Step 2: Take 10 mL of the bacterial solution obtained in step 1, centrifuge at 8000 r / min for 5 minutes at room temperature, discard the supernatant, add 10 mL of sterile water to the precipitate and mix thoroughly, centrifuge again at 8000 r / min for 5 minutes, repeat the washing of the precipitate 3 times, and obtain the bacterial cells;

[0084] Step 3: Use 50 mL of uranium solution containing 50 mg / L uranium to prepare 0.01, 0.02, 0.05, 0.1, and 0.2 mol / L Ca(NO3)2, CaCl2, MgCl2, NaCl, NaHCO3, and Na2SO4 solutions, respectively. Use 0.1 mol / L HCl and NaOH to adjust the pH of the uranium solution to 7.0. Under aerobic conditions, pour the bacteria prepared in step 2 into the uranium solution, culture in a shaker at 30°C and 150 r / min for 24 h, determine the uranium concentration of the supernatant, and calculate the effect of different ions on the uranium removal performance of A16.

[0085] like Figure 7 As shown in Figure 2, with the increase of initial uranium concentration, the adsorption rate of A16 gradually decreased, and the adsorption rate was the highest when the uranium concentration was 50 mg / L. Figure 8As shown in the figure, with the increase of the amount of bacteria added, the adsorption rate gradually increases, while the adsorption amount gradually decreases. Fig. 9 As shown in the figure, when the pH value is 6, the adsorption capacity of A16 for U(VI) is the highest. When the pH value is too high or too low, the adsorption amount and adsorption rate will decrease to a certain extent. Fig.10 As shown, changing the temperature has little effect on bacterial adsorption. In summary, when the uranium concentration of the uranium solution is 50 mg / L, the pH value is 6, the ambient temperature is 30°C, and the bacterial dosage is 0.32 g / L, A16 has the best adsorption effect on uranium. The adsorption rate of uranium within 1 hour exceeds 80%, and the final adsorption rate reaches 89%, and the adsorption amount is 138 mg / g.

[0086] like Fig.11 As shown, different ions have different effects on the adsorption of uranium by A16, except for HCO3 - The addition of other ions will only have a small effect on the adsorption. Studies have shown that UO2 2+ Easy with CO3 2- Complexation, HCO3 - Easily hydrolyzed to H + and CO3 2- , so HCO3 - The presence of will reduce the adsorption of uranium by A16 to a certain extent.

[0087] Example 7

[0088] The application of a simple bacillus in uranium enrichment includes the following steps:

[0089] Step 1: Take a loop of bacteria, namely Bacillus simplex A16, and inoculate it into 50 mL of peptone fermentation medium. Incubate it in a shaker at 30°C and 150 rpm for about 24 hours until the stable phase. The OD value of the bacterial solution is 600 The value is 1.8 (±0.15);

[0090] Step 2: Take the bacterial solution obtained in step 1, centrifuge at 8000 r / min for 5 minutes at room temperature, discard the supernatant, add sterile water to the precipitate and mix thoroughly, centrifuge again at 8000 r / min for 5 minutes, repeat the washing of the precipitate 3 times, and obtain the bacterial cells;

[0091] Step 3: Place 50 mL of a uranium solution containing 50 mg / L of uranium in a 150 mL conical flask, adjust the pH of the uranium solution to 6.0 with 0.1 mol / L HCl and NaOH, pour the bacteria prepared in step 2 into the uranium solution under aerobic conditions, and add 0.32 g / L of bacteria. First, place it in a DC electric field for 2 h, and then continue to culture it in a shaking incubator at 30°C and a speed of 150 r / min. During the experiment, samples were taken at 0 to 24 h to determine the uranium concentration of the supernatant. The specific method of electric field treatment is as follows: place the solution between two stainless steel electrode plates with a plate spacing of 18 cm, apply DC power to both ends of the electrodes, the electric field strength is 1.0 V / cm, and the polarity of the electrode plates is switched every 30 min. In this embodiment, a DC electric field is applied in the initial stage of uranium adsorption (0 to 2 hours), and it is found that under the action of the DC electric field, the activity of simple Bacillus A16 can be improved, and the adsorption efficiency of A16 on uranium is further improved. When the uranium concentration of the uranium solution is 50 mg / L, the pH value is 6, the ambient temperature is 30°C, and the bacterial dosage is 0.32 g / L, the adsorption rate of uranium within 1 hour exceeds 85%, and the final adsorption rate reaches 95%.

[0092] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A simple Bacillus, characterized in that The simple Bacillus is simple Bacillus A16 (Bacillus simplex A16), which was registered and preserved in the China Center for Type Culture Collection on July 18, 2024, with the preservation number CCTCC NO: M 20241597.

2. The simple bacillus according to claim 1, characterized in that The 16s rDNA sequence of the simple Bacillus is shown in SEQ ID NO:

1.

3. Use of the simple bacillus as described in any one of claims 1 to 2 in uranium enrichment.

4. The use of simple bacillus in uranium enrichment as claimed in claim 3, characterized in that: The following steps are involved: Step 1: Take a loop of Bacillus simplex A16 cells and inoculate it into 50 mL of peptone fermentation medium. Incubate in a shaker for 20 to 28 hours to obtain an OD 600 The bacterial solution has a value of 1.6 to 2.0; Step 2: Take the bacterial solution obtained in step 1, centrifuge it, discard the supernatant, and wash the precipitate with sterile water 2 to 4 times to obtain the bacterial cells; Step 3: Under aerobic conditions, add the bacteria obtained in step 2 to the uranium solution and culture in a shaker for 2 to 24 hours.

5. The use of simple bacillus in uranium enrichment as claimed in claim 4, characterized in that: In the step 1, the peptone fermentation medium includes the following components: 10 g peptone, 5 g yeast extract powder, 10 g sodium chloride and 1 L distilled water, pH 7, sterilized at 121° C. for 15 min.

6. The use of simple bacillus in uranium enrichment as claimed in claim 4, characterized in that: In the step 1, the culture is carried out in a shaking incubator at 30° C. and a rotation speed of 120 to 150 r / min.

7. The use of simple bacillus in uranium enrichment as claimed in claim 4, characterized in that: In the step 2, the centrifugation is performed at 7000-9000 r / min for 3-7 minutes at room temperature.

8. The use of simple bacillus in uranium enrichment as claimed in claim 4, characterized in that: In the step 3, based on the volume of the uranium solution, the amount of bacteria added is 0.08-0.48 g / L.

9. The use of simple bacillus in uranium enrichment as claimed in claim 4, characterized in that: In the step 3, the uranium concentration of the uranium solution is 25-200 mg / L, and the pH is 4.0-8.

0.

10. The use of simple bacillus in uranium enrichment as claimed in claim 4, characterized in that: In the step 3, the culture is carried out in a shaking incubator at 30° C. and a rotation speed of 120 to 150 r / min.

Images