Engineered Escherichia coli for producing spermidine and application of engineered Escherichia coli

Abstract

The invention discloses escherichia coli engineering bacteria for producing spermidine and application, and belongs to the field of synthetic biology. A metabolic engineering modification method is adopted, a novel exogenous pathway is introduced, various product inhibition of a spermidine synthesis pathway is relieved, a spermidine transport system is changed, the enzyme expression quantity of a key pathway is enhanced, the escherichia coli engineering bacterium with high spermidine yield is obtained, the concentration of spermidine in a shake flask supernatant is 27.9 g / L, and the escherichia coli engineering bacterium has the high spermidine yield. Good industrial application prospects are realized.

Description

Technical Field

[0001] The invention relates to an Escherichia coli engineering bacterium for producing spermidine and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Spermidine, with a linear molecular formula of NH2(CH2)3NH(CH2)4NH2, is widely present in microorganisms, plants and animals and is an important physiologically active substance. Spermidine has the effect of extending the lifespan of animals and counteracting age-related diseases such as cardiovascular disease, neurodegenerative diseases and cancer.

[0003] There are two main synthetic pathways for spermidine found in organisms: (1) Spermidine is directly synthesized from carboxylated adenosylmethionine and putrescine under the action of spermidine synthase. Carboxylated adenosylmethionine can be obtained from methionine (Met) through adenylation and decarboxylation catalyzed by related enzymes. This pathway is a common traditional spermidine synthesis pathway and is widely present in animals, plants and microorganisms; (2) Spermidine is synthesized from aspartate-β-semialdehyde and putrescine under the catalysis of carboxyspermidine dehydrogenase and decarboxylase. Aspartate-β-semialdehyde can be synthesized from common amino acids such as aspartate (Asp) through phosphorylation and dehydrogenation catalyzed by related enzymes. This pathway is an alternative synthesis pathway and is mainly present in some bacteria, including important human pathogens, intestinal flora, etc. In Escherichia coli, only pathway (1) exists, and the enzymes in these pathways are highly regulated, resulting in extremely low spermidine content. At present, no microorganisms that can produce spermidine in large quantities have been found.

[0004] The prior art (CN112725251A) genetically modifies Escherichia coli and introduces an exogenous CASDH / CASDC synthesis pathway to achieve dual-pathway synthesis of spermidine based on the traditional synthesis of Escherichia coli. However, the invention still has the problem that there are few enzyme source hosts in the pathway, making it difficult to screen out enzymes with higher catalytic efficiency and further increase the yield. Summary of the invention

[0005] [Technical issues]

[0006] The technical problem to be solved by the present invention is to construct a genetically engineered Escherichia coli bacterium, which can achieve efficient production of spermidine through a completely new metabolic pathway.

[0007] [Technical solution]

[0008] The invention provides an Escherichia coli genetic engineering bacterium, which is a new way to introduce exogenous synthetic spermidine by taking Escherichia coli as a host. The Escherichia coli genetic engineering bacterium expresses exogenous carboxyaminopropyl agmatine dehydrogenase gene, exogenous carboxyaminopropyl agmatine decarboxylase gene and exogenous aminopropyl agmatine urea hydrolase gene.

[0009] The first object of the present invention is to provide a genetically engineered Escherichia coli bacterium, wherein the engineered bacterium is introduced with an exogenous spermidine synthesis pathway and contains genes for carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

[0010] In one embodiment, the carboxyaminopropyl agmatine dehydrogenase can be a carboxyaminopropyl agmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropyl agmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrio acetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0011] In one embodiment, the carboxyaminopropyl agmatine decarboxylase can be a carboxyaminopropyl agmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropyl agmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrio acetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0012] In one embodiment, the aminopropylagmatine urea hydrolase can be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it can be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc. Further alternatively, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrio acetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobacter coccineus YM16-304.

[0013] In one embodiment, the engineered bacteria also knock out the gene encoding the repressor protein argR and construct an argA negative feedback mutant.

[0014] In one embodiment, the engineered bacteria argA negative feedback mutant is a mutant in which the 43rd base C of the argA gene is mutated to T, and the encoded histidine is changed to tyrosine, thereby significantly increasing the production of arginine.

[0015] In one embodiment, the engineered bacteria also utilizes a strong promoter to replace the natural promoter of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the argA gene encoding N-acetylglutamate synthetase, the argH gene encoding arginine succinate lyase, and the speA gene encoding arginine decarboxylase. For example, the strong promoter trc is used to replace the natural promoters of lysC, asd, argA, argH, and speA to enhance the expression of aspartate kinase, aspartate semialdehyde dehydrogenase, N-acetylglutamate synthetase, arginine succinate lyase, and arginine decarboxylase. Optionally, the strong promoter sequence is shown in SEQ ID NO.176.

[0016] In one embodiment, the engineered bacteria also knocks out the gene encoding the transporter protein PotABCD, thereby reducing the transfer of spermidine into the cell; optionally, further, the expression of the transporter protein MdtJI that transfers spermidine to the extracellular space is enhanced, for example, by replacing the natural promoter of the MdtJI gene encoding the strong promoter.

[0017] In one embodiment, the engineered bacteria further knock out the thrA and metL genes encoding homoserine synthase; or, after knocking out the thrA and metL genes, the dapA gene encoding dihydropyridinedicarboxylate synthase is further knocked out; or, after knocking out the thrA, metL, and dapA genes, the proC encoding pyrroline 5-carboxylate reductase is further knocked out.

[0018] In one embodiment, the engineered bacteria also has the astA gene encoding arginine N-succinyltransferase knocked out.

[0019] In one embodiment, the strong promoter is the trc promoter.

[0020] In one embodiment, the strong promoter sequence is shown as SEQ ID NO.187.

[0021] In one embodiment, the gene integration and expression of the genetically engineered bacteria is carried out using the principle of homologous recombination.

[0022] In one embodiment, the gene is knocked out using homologous recombination technology.

[0023] In one embodiment, the gene is knocked out using Crispr / Cas9 gene editing technology.

[0024] The second object of the present invention is to provide the use of genetically engineered Escherichia coli in producing spermidine.

[0025] [Beneficial Effects]

[0026] The present invention constructs an Escherichia coli that uses glucose as raw material to produce high spermidine based on synthetic biology methods. The production process is simple, the raw materials are easily available and the cost is low, and it has good industrial application prospects. The details are as follows:

[0027] (1) The present invention introduces an exogenous pathway, and realizes a new pathway for the synthesis of spermidine in Escherichia coli by introducing exogenous carboxylaminopropyl agmatine dehydrogenase gene, exogenous carboxylaminopropyl agmatine decarboxylase gene, and exogenous aminopropyl agmatine urea hydrolase gene. Escherichia coli hardly produces spermidine without genetic engineering modification, and the yield is extremely low, close to zero. The traditional spermidine synthesis pathway in Escherichia coli synthesizes spermidine through carboxylation-S-adenosylmethionine and putrescine under the action of spermidine synthase, and the synthesis pathway of carboxylation-S-adenosylmethionine has a low production efficiency. Compared with the traditional production pathway, the Escherichia coli genetically engineered bacteria of the present invention can greatly increase the yield of spermidine. When only the exogenous pathway is introduced, the spermidine concentration reaches 6.7 g / L.

[0028] (2) The present invention relieves feedback inhibition and repression. The synthesis of arginine is a multi-stage enzyme chain reaction starting from glutamate, and it is necessary to remove the inhibitory effect of arginine on N-acetylglutamate synthetase encoded by argA. ArgR is a repressor protein of the arginine (Arg) pathway. The present invention relieves the feedback inhibition of arginine and relieves the repression of the pathway by ArgR. After optimization, the production of spermidine reaches 7.8 g / L.

[0029] (3) The present invention strengthens the expression of key enzymes. The aspartate kinase encoded by the lysC gene and the aspartate semialdehyde dehydrogenase encoded by the asd gene are key enzymes that catalyze the synthesis of aspartate semialdehyde from aspartate. The N-acetylglutamate synthetase and arginine succinate lyase encoded by the argA and argH genes are the first and last enzymes in the arginine synthesis pathway, respectively. The arginine decarboxylase encoded by the speA gene is a key enzyme that catalyzes the further synthesis of agmatine from arginine. Strengthening the expression of these five enzymes can increase the yield of spermidine to 14.8 g / L.

[0030] (4) The present invention improves the transport pathway of spermidine. PotABCD and MdtJI proteins are proteins that transport spermidine into and out of cells, respectively. Knocking out PotA and enhancing the expression of MdtJI can increase the production of spermidine to 18.5 g / L.

[0031] (5) The present invention weakens the competitive pathways of the spermidine process. In the spermidine synthesis process, the aspartaldehyde intermediate has multiple competitive pathways for the production of amino acids, such as the lysine pathway and the homoserine pathway. There are also competitive pathways for the glutamate intermediate, such as the synthesis of Pro. These pathways are weakened, and after knocking out the genes thrA, metL, dapA, and proC, the spermidine production reaches 21.3 g / L.

[0032] (6) The present invention knocks out the relevant decomposition pathway. Escherichia coli has enzymes that utilize and degrade the intermediates and products of spermidine synthesis, such as the arginine N-succinyltransferase encoded by the astA gene, which degrades arginine to produce N2-succinylarginine, which is further degraded into L-Glu and succinic acid through the ast series genes, thereby increasing the yield of spermidine to 27.9 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The method for synthesizing spermidine in the present invention is DETAILED DESCRIPTION

[0034] 1. Strains and plasmids involved in the present invention

[0035] pRSFDuet-1, pTrc99a, PKD46, pCP20, T19 vector plasmids, pMD18-T vector plasmid, Escherichia coli BL21 (DE3), Escherichia coli JM109, etc. were purchased from Novagen.

[0036] 2. Fermentation conditions

[0037] The formula of the shake flask fermentation medium used in verifying the strain yield of the present invention is: 10g glucose, 10g yeast extract, 20g NaCl, 50% (v / v) R / 2 medium, and 5mL trace metal element stock solution per liter; the components of the R / 2 medium are: 2g (NH4)2HPO4, 6.75g KH2PO4, 0.85g citric acid, and 0.7g MgSO4·7H2O per liter, and the pH value is 6.86; the components of the trace metal element stock solution are: 5M HCl, 10g FeSO4·7H2O, 2.25g ZnSO4·7H2O, 1g CuSO4·5H2O, 0.5g MnSO4·5H2O, 0.23g Na2B4O7·10H2O, 2g CaCl2·2H2O, and 0.1g (NH4)6Mo7O 24 The shake flask fermentation temperature was controlled at 37°C and the initial pH was 7. The liquid volume was 1 / 5 of the shake flask volume. The rotation speed was controlled at 200 rpm and the shake flask fermentation time was 24 hours.

[0038] 3. Determination of spermidine content

[0039] Preparation of OPA derivatization reagent: OPA reagent was prepared by Uren method and Karababa (15). 0.20 g of OPA was dissolved in 9.0 mL of methanol, and 1.0 mL of 0.40 M (pH 9.0) borate buffer and 160 μL of 2-mercaptoethanol (reducing agent) were added. OPA reagent was stored at 4°C.

[0040] Spermidine was first derivatized with o-phthalaldehyde (OPA; Sigma, St. Louis, MO). 50 μL of sample and 450 μL of water were added to 400 μL of methanol. After adding 100 μL of OPA reagent, the mixture was filtered through a 0.2-μm filter membrane and 20.0 μL of the filtrate was immediately injected into the HPLC instrument.

[0041] HPLC detection conditions: Spermidine was detected by the method in reference (Qian, ZG, XXXia, and SYLee, Metabolic engineering of Escherichia coli for the production of putrescine: a fourcarbon diamine. Biotechnol Bioeng, 2009. 104 (4): p. 651-662): Luna 5-μm C18 (2) 100A column (250 × 4.6 mm; Phenomenex) operated at 25 ° C and 0.8 mL / min mobile phase was used for all sample separations. The mobile phase consisted of solvent A (55% methanol in 0.1 M sodium acetate, pH 7.2) and solvent B (methanol). The following gradient was applied: 1-6 min, 100% A; 6-10 min, linear gradient of B from 0% to 30%; 10-15 min, linear gradient of B from 30% to 50%; 15-19 min, linear gradient of B from 50% to 100%; 19-23 min, 100% B; 23-25 ​​min, linear gradient of B from 100% to 30%; 25-28 min, linear gradient of B from 30% to 0% (all in vol %).

[0042] 4. Gene integration expression plan

[0043] The principle of homologous recombination is used for gene integration and expression. Specifically,

[0044] The target gene was amplified using the amplification primer "KZ-F / R" and integrated into the multiple cloning site of the T19 vector plasmid by homologous recombination. The left arm (LA) and the right arm (RA) of the homologous arm were amplified using the 1000bp above and below the target gene as a template, and connected to the two ends of the target gene on the T19 vector plasmid to construct the homologous arm. The plasmid with the left and right arms connected was extracted, and the target fragment: LA-trc-target gene-RA was amplified using the corresponding primers using the plasmid T19-LA-trc-target gene-RA as a template. After the PCR product was purified, the template effect was eliminated using the restriction endonuclease DpnI, and the product after enzyme digestion was purified again. The homologous recombination enzyme expression PKD46 plasmid was extracted using a plasmid extraction kit, and after purification, it was transformed into the competent cell E.coliBL21 to construct E.coli BL21-PKD46. After the E. coli BL21-PKD46 competent cells were prepared by the CaCl2 method, they were stored at -80°C for future use. The purified product was transferred into the above-mentioned E. coli competent cells, and the positive transformants were screened on the resistance plate using the carnamycin resistance marker. To verify whether recombination occurred, PCR was performed using the corresponding primers "target gene-YZ-F" and "target gene-YZ-R". If recombination occurred, a fragment of about 1200 bp could be amplified, otherwise no fragment could be amplified. At the same time, the corresponding PCR method was used to verify E. coli on the ampicillin and carnamycin double resistance plates to determine that the correct transformant E. coli PKD46 (kana R Then, the kanamycin resistance was eliminated. First, the CaCl2 method was used to prepare E. coli PKD46 (kana R ) competent state, and transform the pCP20 plasmid into E. coli-PKD46 (kana R ) After the cells were in competent state, resistance-eliminated transformants were screened using non-resistance plates and resistant plates, and transformants were identified by colony PCR to screen out transformants that integrated the target gene and eliminated resistance.

[0045] By using the above-mentioned integration expression method and integration operation steps, the mutated gene and the replaced promoter sequence are integrated into the required position of the genome, and the strain is subjected to corresponding metabolic engineering transformation.

[0046] Enzyme digestion reaction system: 10×Q Cut Buffer 5μL, DNA 20μL, ddH2O 33μL, endonuclease-1 1μL, endonuclease-2 1μL, mix well, and heat in a 37℃ water bath for 0.5 to 1h.

[0047] Ligation reaction system: 5 μL of Lightning Cloning Enzyme, 1-2 μL of double-enzyme-cut plasmid (10-100 ng), 4-5 μL of homologous target fragment, add ddH2O to 10 μL, mix well, and heat in a 50°C water bath for 30 min.

[0048] DpnI template effect elimination reaction system (60 μL): DpnI 3 μL, PCR purified product 20 μL, 10×FastDigest Buffer 6 μL, ddH2O 31 μL.

[0049] PCR amplification target gene reaction system (50 μL): DNA template 1 μL, 5× PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, amplification primer 1 μL, amplification primer 1 μL, PrimeSTAR HSDNA Polymerase 0.5 μL, ddH2O3 2.5 μL.

[0050] PCR amplification program: 30 cycles (98°C for 10 s, 55°C for 10 s, 72°C at 1 kb / min), 72°C for 10 min, and storage at 4°C.

[0051] Colony PCR reaction system: 2×Tag Master Mix 10μL, upstream primer (concentration 10μM) 1μL, downstream primer (concentration 10μM) 1μL, ddH2O 8μL, a small amount of colonies or bacterial liquid as template.

[0052] Example 1: Introduction of exogenous spermidine synthesis pathway

[0053] Aspartate semialdehyde is an important intermediate metabolite in cells, a direct precursor for the synthesis of methionine and decarboxylated S-adenosylmethionine, and an important precursor for the synthesis of spermidine. The metabolic pathway from aspartate semialdehyde to decarboxylated S-adenosylmethionine is complex and changeable, the metabolic pathway is long, and it involves the metabolism of various amino acid intermediates. After excessive modification of its metabolic pathway, it is easy to affect the growth of bacteria. Based on the above reasons, the present invention introduces the CAPADH / CAPADC / APAUH pathway from different microbial strains into E.coli for heterologous expression. The carboxyaminopropyl agmatine dehydrogenase encoded by CAPADH directly uses aspartate semialdehyde and agmatine as precursors to synthesize carboxyaminopropyl agmatine, and then decarboxylates and synthesizes aminopropyl agmatine under the action of carboxyaminopropyl agmatine decarboxylase encoded by CAPADC, and finally generates spermidine under the action of aminopropyl agmatine ureahydrolase encoded by APAUH. First, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from various sources are expressed in E. coli by plasmid. The enzyme with the highest catalytic efficiency is further selected, and the CAPADH / CAPADC / APAUH pathway is exogenously integrated by homologous recombination. The genomic integration position selected by the present invention is upstream of the argA gene of E. coli BL21.

[0054] The specific process is as follows:

[0055] The carboxyaminopropylagmatine dehydrogenase genes stcapadh, dacapadh, gscapadh and iccapadh were cloned from the genomes of Spirochaeta thermophila DSM 6578, Denitrovibrio acetiphilus DSM 12809, Geobacter sulfurreducens KN400 and Ilumatobacter coccineusYM16-304 using amplification primers. The amino acid sequences of the genes were WP_014623968.1, WP_013011851.1, WP_010943175.1 and WP_015442124.1 on NCBI, respectively; The carboxyaminopropylagmatine decarboxylase genes stcapadc, dacapadc, gscapadc, and iccapadc were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623969.1, WP_013011852.1, WP_004513933.1, and WP_015442123.1 in NCBI, respectively; The aminopropylagmatine urea hydrolase genes stapauh, daapauh, lbapauh, and icapauh were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623970.1, WP_013011853.1, WP_015770028.1, and WP_015442122.1 in NCBI, respectively. The three cloned genes were connected to the same pRSFDuet-1 plasmid to obtain recombinant Escherichia coli with enhanced expression of the three genes.

[0056] CAPADH and CAPADC in the above-mentioned microorganisms are located in adjacent positions of a gene cluster. Using stcapadh-BamHI-F and stcapadc-HindⅢ-R as primers and the Spirochaeta thermophila DSM 6578 genome as a template, the target fragment stcapadh-stcapadc was amplified; the first multiple cloning site of the plasmid pRSFDuet-1 was treated with double enzymes BamHI and HindⅢ enzymes, and after purification of the digestion product, the cut plasmid was connected with the amplified target fragment stcapadh-stcapadc, and the connection product pRSFDuet-1-stcapadh-stcapadc was transferred into JM109 competent cells, and positive clones were selected on the resistance plate card sodium plate, and its correctness was further verified by colony PCR; using stapauh-KpnI-F and stapauh-XhoI-R as primers, Spirochaeta thermophila DSM 6578 genome as a template, amplify the target fragment stapauh, use the double enzymes KpnI and XhoI to digest the second multiple cloning site of the plasmid pRSFDuet-1-stcapadh-stcapadc, purify the digestion product, and connect it with the amplified target fragment stapauh. The connection product pRSFDuet-1-stcapadh-stcapadc-stapauh is transformed into JM109 competent cells, and positive clones are selected on the resistance plate card sodium plate. Colony PCR further verifies its correctness. Select the JM109 strain with the correct connection, extract the plasmid pRSFDuet-1-stcapadh-stcapadc-stapauh and transform it into the competent cell E.coli BL21 to construct the E.coli-stcapadh-stcapadc-stapauh spermidine synthesis strain. The construction method of the remaining strains is similar to that of E. coli-stcapadh-stcapadc-stapauh. Carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from different strains are connected to the two multiple cloning sites of the pRSFDuet-1 plasmid. The connection of other genes is similar to the above. The primer sequences used are shown in Table 1:

[0057] Table 1 Primer sequences (SEQ ID NO. 1-4)

[0058] Primer Name Sequence 5’-3’ SEQ ID stcapadh-BamHⅠ-F <![CDATA[CCACAGCCA GGATCC GATGGGCACGGGTGCTCATCAT]]> NO.1 stcapadc-HinⅢ-R <![CDATA[GCATTATGCGGCCGC AAGCTT TTACGAGAGGCGCCGCTT]]> NO.2 stapauh-KpnI-F <![CDATA[GCGATCGCTGACGTC GGTACC ATGCGCTATCCCCACTTCCT]]> NO.3 stapauh-XhoI-R <![CDATA[GGTTTCTTTACCAGA CTCGAG CTACCGCCGGGGTAGATGCC]]> NO.4

[0059] The recombinant E. coli was transferred into LB medium (10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl) at a volume ratio of 2%.600 After reaching 0.6-0.8, IPTG was added at a final concentration of 0.4 mM, and the expression was induced at 20°C for 12 h. After the induction expression was completed, the supernatant was collected by centrifugation at 4°C, 8000 rpm, and 20 minutes. The spermidine concentration in the supernatant was detected by HPLC, as shown in Table 2.

[0060] Table 2

[0061] Recombinant Bacteria Spermidine (g / L) E.coli-stcapadh-stcapadc-stapauh 6.7 E.coli-iccapadh-iccapadc-icapauh 4.3 E.coli-dacapadh-dacapadc-daapauh 2.1 E.coli-gscapadh-gscapadc-lbapauh 3.7 E.coli-stcapadh-gscapadc-stapauh 4.1 E.coli-gscapadh-stcapadc-stapauh 5.4 E.coli-stcapadh-dacapadc-stapauh 3.2 E.coli-dacapadh-stcapadc-stapauh 1.2

[0062] The use of expression vectors to overexpress key genes for spermidine synthesis will bring a metabolic burden to the bacteria and affect their growth. The expression vectors are structurally unstable and easy to lose during bacterial reproduction, and their copy number in the cells is unstable. The addition of antibiotics affects bacterial growth and pollutes the environment. The increased cost caused by IPTG induction limits the expansion of production scale. Therefore, the strain E. coli-stcapadh-stcapadc-stapauh with the best induced expression of spermidine synthesis was selected, and the promoter J23119 and ribosome binding site (RBS) B0034 in Escherichia coli were connected to the stcapadh-stcapadc-stapauh gene to form an exogenous gene expression fragment. According to the aforementioned "4. Gene integration and expression plan", the exogenous gene expression fragment was integrated into the knockout strain E. coli BL21 to construct the strain E. coli-stcapadh-stcapadc-stapauh, named E1, and used as the basic strain for subsequent research.

[0063] The production of E1 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 6.7 g / L.

[0064] Example 2: Removal of feedback inhibition of important enzymes in the pathway and inhibition of the promoter of key enzymes in the pathway by repressor proteins

[0065] In the important intermediate process of aspartate semialdehyde and arginine synthesis, there is an important repressor protein that inhibits the synthesis of intermediates and final products. The DNA-binding dual transcriptional regulator encoded by the argR gene (the accession number of the amino acid sequence on NCBI is QJZ05382.1) inhibits the expression of the arg series genes and the excessive synthesis of the required important intermediates ornithine and arginine. Therefore, in order to ensure the stable and high-speed synthesis of each intermediate, the gene encoding the repressor protein is deleted to increase the metabolic flux.

[0066] In the metabolic pathway of arginine synthesis, N-acetylglutamate synthase encoded by argA (amino acid sequence accession number on NCBI is QJZ04982.1) is subject to feedback inhibition by the product arginine. In order to improve the activity of the enzyme, on the basis of knocking out the argR gene, the gene encoding the enzyme was further mutated to construct a negative feedback mutant, thereby relieving feedback inhibition and obtaining the engineered bacterium E. coli argA fbr ΔArgR, named E2.

[0067] The specific process is as follows:

[0068] (1) Knockout of the repressor protein ArgR

[0069] The primer designs are shown in Table 3:

[0070] Table 3 Primer sequences (SEQ ID 5-14)

[0071] Primer Name Primer Sequence 5’-3’ SEQ ID ApaI-LA-argR <![CDATA[CGCGCGGATCTTCCAGAGATTGGGCCC ACCTG TGACAGCAGCGGCAG]]> NO.5 argR-LA-EcoRI <![CDATA[AAGCTTGACGTCCAGGTGCCT CTTAAG AAGTCACCCGATATGGTGGT]]> NO.6 KpnI-RA-argR <![CDATA[CACGCTAGCGGATCCGAGCTC GGTACC TCTCTGCCCCGTCGTTTCTG]]> NO.7 argR-RA-SalI <![CDATA[CGTGCGGACGGCAAGCTGCTA CAGCTG CGATGCACGGCAGAACTCGC]]> NO.8 argR-LA-YZ-F tgaattagaactcggtacgcgcgga NO.9 argR-LA-YZ-R tagagaataggaacttcgaactgca NO.10 argR-RA-YZ-F aacttcgaagcagctccagcctaca NO.11 argR-RA-YZ-R atgattacgccaagtttgcacgcct NO.12 argR-YZ-F AGACCCGCCACCGGCCTTCGCTTCA NO.13 argR-YZ-R Cgccctgagtgcttgcggcagcgtg NO.14

[0072] The homologous recombination enzyme expression PKD46 plasmid was extracted using a plasmid extraction kit, and after purification, it was transformed into competent cells E1 to construct E1-PKD46. After the E1-PKD46 competent cells were prepared by the CaCl2 method, they were stored at -80℃ for future use. The homologous recombination fragment template plasmid T19 vector was extracted using a plasmid extraction kit, and purified and recovered using a rubber tapping recovery kit. Primers ApaI-LA-argR and argR-LA-EcoRI, KpnI-RA-argR and argR-RA-SalI were designed to amplify the corresponding homologous arm LA and RA fragments, and purified and recovered using a rubber tapping recovery kit. The plasmid T19 vector was double-digested with ApaI and EcoRI, and the digestion results were detected by electrophoresis. The size after digestion was 5041bp, and the digestion product was purified and recovered. The product after double digestion of the T19 vector was connected with the left arm LA fragment. The connected product was transformed into JM109 competent state, spread on a card sodium resistance plate, screened for positive clone strains, and the results were verified by colony PCR using primers LA-YZ-F and LA-YZ-R. The band size was about 1100bp. The successfully verified strains were sent for sequencing to further confirm that the fragments were successfully connected. The T19 plasmid with the LA fragment connected was double-digested with KpnI and SalI, and the RA fragment was connected using the same method as above, and the connected plasmid was verified. The T19 vector plasmid with the LA and RA fragments connected was extracted, and used as a template, and PCR was performed with primers ApaI-LA-argR and argR-RA-SalI to obtain the target fragment argR-LA-FRT-Kan-FRT-RA. The electrophoresis identification band size was about 3324bp. After the PCR product was purified, the restriction endonuclease DpnI was used to eliminate the template effect. The target fragment argR-LA-FRT-Kan-FRT-RAPCR product after restriction endonuclease DpnI digestion is further purified and transferred into E.coli BL21-PKD46 competent cells after purification. The positive transformants are screened on the resistance plate using the carnamycin resistance marker. To verify whether the positive transformants screened have indeed undergone recombination, the positive transformants are used as templates. The primers argR-YZ-F and argR-YZ-R can be used to amplify a fragment of about 1100bp, which can be judged as recombination. Conversely, if no fragment can be amplified, it can be judged as a false positive. While verifying whether recombination has occurred by PCR amplification, the corresponding PCR verification bacteria are spotted on the ampicillin sodium plate. The correct transformant E1-PKD46 (kana R ) was used to eliminate carnamycin resistance. First, E1-PKD46 (kana R ) competent cells, the extracted pCP20 plasmid was transformed into E1-PKD46 (kana R) After being in competent state, resistance-eliminated transformants were screened using non-resistance plates and resistant plates, and transformants were identified by colony PCR, and transformant E1-△argR with knockout of argR gene and elimination of resistance was screened.

[0073] (2)argA fbr Construction of mutants

[0074] The argA gene is subject to feedback inhibition by the target product arginine. The present invention mutates the 43rd base C of the argA gene to T. After the encoded histidine is changed to tyrosine, the yield of arginine is significantly increased. Therefore, the present invention mutates this site and integrates it into the plasmid pRSFDuet-1 plasmid.

[0075] The specific process is as follows:

[0076] The primer designs are shown in Table 4 below:

[0077] Table 4 Primer sequences (SEQ ID NO.15~18)

[0078] Primer Name Primer Sequence 5’-3’ SEQ ID F-argA-Amplification Primer GTGGTAAAGGAACGTAAAACCGA NO.15 R-argA-Amplification Primer TTACCCTAAATCCGCCATCAACAC NO.16 argA-TB-F <![CDATA[GTCGAGGGATTCCGC T ATTCGGTTCC]]> NO.17 argA-TB-R <![CDATA[ A GCGGAATCCCTCGACCAACTCGGT]]> NO.18

[0079] First, the pRSFDuet-1 (high copy) plasmid was extracted using a plasmid extraction kit, and BamHI and HindⅢ were selected for double enzyme digestion. The enzyme digestion system (50μL) was as follows: 10×Q Cut Buffer 5μL, plasmid 20μL, BamHI 1μL, HindⅢ 1μL, ddH2O 33μL, and purified after enzyme digestion. Secondly, the wild-type E.coli BL21 genome was extracted, and the argA gene fragment was amplified using the genome as a template. After PCR product verification, it was connected to the pRSFDuet-1 plasmid after enzyme digestion. E.coli JM109 competent cells were prepared by the CaCl2 method, and the pRSFDuet-1 plasmid connected with the argA fragment was transformed into the competent cells, and the positive transformants were selected. After colony PCR identification, the transformed strain E.coli JM109-argA was successfully identified. The plasmid pRSFDuet1-argA in E.coli JM109-argA was extracted and used as a template to perform site-directed mutagenesis of argA. The mutant gene was designed and extracted using the Fast Mutangenesis System kit. The extracted pRSFDuet1-argA plasmid was used as a template to amplify argA using the argA mutant primers argA-TB-F / R. fbr The PCR amplification system (50 μL) was as follows: 3 μL of plasmid template, 1 μL of argA-TB-F, 1 μL of argA-TB-R, FastPfu Fly PCR SuperMix 25μL, ddH2O 20μL. The PCR amplification program is: 94℃2-5min, 20-25 cycles (94℃20s, 55℃20s, 72℃2-6kb / min), 72℃10min, and store at 4℃. Add 1-3μL DMT enzyme to the obtained PCR product for digestion, mix well, and incubate at 37℃ for 1h. After purifying the obtained DMT enzyme digestion product using a PCR product purification kit, take 2-5μL and add it to 50μL JM109 competent cells for transformation. Select the positive transformants, preliminarily identify them by colony PCR, and screen the correct transformant JM109-argA after sequencing by the company. fbr .

[0080] Extraction of transformant JM109-argA fbr Plasmid pRSFDuet1-argA fbr According to the above-mentioned "4. Gene integration expression plan", the gene fragment argA fbr Integrate into knockout strain E1-△argR to construct strain E1-argA fbr ΔArgR was named E2 for subsequent studies.

[0081] The production of E2 arginine was verified by shake flask culture, and the arginine concentration in the shake flask supernatant was measured to be 7.8 g / L.

[0082] Example 3: Enhanced expression of key enzymes in the pathway

[0083] In the metabolic process of synthesizing important intermediates such as decarboxylated aspartate semialdehyde and arginine, some genes act as rate-limiting enzymes to strictly regulate the flux expression of the entire metabolic pathway. The N-acetylglutamate synthase encoded by the argA gene is the rate-limiting enzyme of the arginine metabolic synthesis pathway, and the arginine succinate lyase encoded by the argH gene catalyzes the synthesis of arginine from arginine succinate. These two enzymes inhibit the excessive synthesis of arginine to a great extent. The arginine decarboxylase encoded by the gene speA catalyzes arginine to generate agmatine, which is an important precursor for the production of spermidine in a new pathway. Therefore, the present invention uses a strong promoter trc to replace its natural promoter, strengthen its expression, and promote the synthesis of arginine metabolic flux. Wherein, the trc promoter (sequence: SEQ ID NO.187: 5'-TTGACAATTAATCATCCGGCTCGTATAATG-3') is derived from the pTrc99a plasmid. The aspartate kinase encoded by the lysC gene catalyzes the phosphorylation of aspartate, and the aspartate semialdehyde dehydrogenase encoded by the asd gene catalyzes the phosphorylated aspartate to produce aspartate semialdehyde. In order to enhance the enzyme activity and metabolic flux of this metabolic pathway, the strong promoter trc is used to replace its natural promoter, strengthen its expression, and accumulate more target products.

[0084] Using E2 as the starting strain, the key enzymes of the synthesis pathway, lysC (the accession number of the amino acid sequence on NCBI is QZI64953.1), asd (the accession number of the amino acid sequence on NCBI is QJZ05564.1), argA (the accession number of the amino acid sequence on NCBI is QJZ04982.1), argH (the accession number of the amino acid sequence on NCBI is QJZ06087.1) and speA (the accession number of the amino acid sequence on NCBI is QJZ05082.1) were further enhanced, and the strong trc promoter was used to replace the natural promoter of the gene to obtain the engineered strain E2-P trc lysC-P trc asd-P trc argA-P trc argH-P trc speA strain.

[0085] The specific process is as follows:

[0086] According to the lysC of E.coli BL21 in NCBI, Primer Premier5 was used to design the relevant fragment primers (Table 5). Using the E.coli BL21 genome as a template and lysC-KZ-F / R as primers, PCR amplified the target gene fragment lysC, and added restriction sites EcoRI and HindⅢ in the upstream and downstream, respectively, and the PCR fragment was purified. The pTrc99a plasmid was double-digested with EcoRI and HindⅢ, the plasmid after restriction digestion was purified, and the purified lysC fragment was connected and transformed into E.coli JM109 competent cells, and the positive transformants were selected. Colony PCR and sequencing were performed using the verification primer lysC-99a-YZ-F / R to verify its correctness. The successfully transformed plasmid pTrc-lysC was extracted and used as a template. BamHI-trc-lysC-F and trc-lysC-SacI-R were used as primers to amplify the target fragment trc-lysC sequence, which was verified to be about 1453bp by gel running and purified. The T19 vector plasmid was double-digested with BamHI and SacI enzymes, and after purification, it was connected and transformed with the trc-lysC fragment. The verification primers trc-lysC-T19-YZF / YZR were used for colony PCR and company sequencing to verify and select the correct positive transformant T19-trc-lysC. Using the lysC genome in E.coli BL21 as a template, lysC-LA-ApaI and EcoRI-lysC-LA were used as primers to amplify the left arm fragment LA, and lysC-RA-KpnI and SalI-lysC-RA were used as primers to amplify the right arm fragment RA. After purification, they were connected to the left and right arms of the double-enzyme-digested and purified plasmid T19-trc-lysC, respectively. The verification primers lysC-LA-YZ-F and lysC-LA-YA-R, lysC-RA-YZ-F and lysC-RA-YA-R were used to perform colony PCR for preliminary verification, and the products were sent to the company for sequencing to find the plasmid T19-LA-trc-lysC-RA that correctly connected the left and right arms. The plasmid T19-LA-trc-lysC-RA with the left arm and the right arm connected was extracted and used as a template. LysC-LA-ApaI and SalI-lysC-RA were used as primers to amplify the target fragment LA-trc-lysC-RA with a size of about 3700 bp. After the PCR product was purified, the restriction endonuclease DpnI was used to eliminate the template effect.The product after enzyme digestion is further purified and transferred into E2-PKD46 (the homologous recombinase expression plasmid PKD46 is extracted using a plasmid extraction kit, and after purification, it is transformed into competent cells E2 to construct E2-PKD46). In competent cells, positive transformants are screened on resistance plates using the kanamycin resistance marker. To verify whether recombination occurs, primers lysC-YZ-F and lysC-YZ-R can amplify a fragment of about 1000 bp. Otherwise, no fragment should be amplified. At the same time, the corresponding PCR verification bacteria are spotted on ampicillin sodium plates. Determine the correct transformant E2-PKD46 (kana. R To eliminate carnamycin resistance, firstly, E2-PKD46 (kana R ) competent cells, and the pCP20 plasmid was transformed into E2-PKD46 (kana R ) After the competent state, the resistance-eliminated transformants were screened using non-resistant plates and resistant plates, and the transformants were identified by colony PCR. The transformants E2-P that replaced the lysC gene promoter and eliminated resistance were screened. trc lysC.

[0087] According to the above method, the promoters of genes asd, argA, argH and speA were replaced in sequence. trc lysC-P trc asd-P trc argA-P trc argH-P trc speA, and named it E3. The primers used are as shown in Table 5:

[0088] Table 5 Primer sequences (SEQ ID NO.19~108)

[0089]

[0090]

[0091]

[0092] The production of E3 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 14.8 g / L.

[0093] Example 4: Improving transport pathways

[0094] PotABCD is a transporter protein that Escherichia coli absorbs spermidine into cells, so it is knocked out; since PotABCD protein is composed of four subunits encoded by gene clusters potA, potB, potC, and potD, potA encodes ATP binding subunits to provide necessary energy for transport, potB encodes ABC transport membrane subunit PotB, potC encodes ABC transport membrane subunit PotC, and potD encodes ABC transport protein periplasmic binding protein, the four genes of the operon are necessary for the correct expression of the operon function, and the deletion of any one gene will inevitably lead to functional inactivation, therefore, the ATP binding subunit potA (the accession number of the amino acid sequence on NCBI is QJZ03606.1) is deleted in the present invention, the ability of the transferred protein to transport spermidine is weakened, and a strain with improved transport pathway is constructed on the basis of E3. PotA is knocked out according to the method of Red homologous recombination in Example 2 to obtain strain E3-△PotA. MdtJI (amino acid sequence accession number CAQ32076.1 on NCBI) is a protein that transports spermidine out of Escherichia coli and is encoded by a gene cluster consisting of the gene clusters mdtJ and mdtI. Therefore, it was expressed by using a strong trc promoter. According to the method described in Example 2, the promoter was replaced to obtain the strain E3-ΔPotA-P with improved transport pathway. trc MdtJI and named it E4.

[0095] Table 6 Primer sequences (SEQ ID NO.109~136)

[0096]

[0097]

[0098] The production of E4 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 18.5 g / L.

[0099] Example 5: Weakening competition approach

[0100] (1) Homoserine competition pathway:

[0101] The intermediate substance aspartate semialdehyde is further converted into homoserine by homoserine synthase encoded by thrA (amino acid sequence accession number on NCBI is QJZ02606.1) and metL (amino acid sequence accession number on NCBI is QJZ06068.1). In order to eliminate the shunt of the competitive metabolic pathway, according to the method described in Example 1, based on strain E4, thrA and metL genes were deleted by Red homologous recombination method to construct strain E4-△thrA△metL. The obtained strain was named E5-1.

[0102] (2) Lys competition pathway:

[0103] The dihydropicolinate synthase encoded by the dapA gene (the amino acid sequence is accession number QJZ04698.1 on NCBI) converts the intermediate substance aspartate semialdehyde into dihydropicolinate. In order to weaken the influence of this branch pathway and allow more aspartate to flow into the metabolic pathway of aspartate semialdehyde synthesis, the strain E4-△thrA△metL was constructed by knocking out the gene dapA using the Red homologous recombination method based on the strain E4-△thrA△metL△dapA according to the method described in Example 2. The obtained strain was named E5-2.

[0104] (3) Glu has a competitive pathway: glutamate kinase encoded by proB and glutamate semialdehyde dehydrogenase encoded by proA form glutamate semialdehyde, which can be spontaneously converted into pyrroline-5-carboxylic acid, which is converted into proline (Pro) by pyrroline 5-carboxylic acid reductase encoded by proC (the accession number of the amino acid sequence on NCBI is QJZ02915.1). Therefore, in order to prevent the metabolic flow of the competitive pathway, the present invention will delete the gene proC to weaken the pathway. According to the method described in Example 2, based on the strain E4△thrA△metL△dapA, the expression of the competitive pathway gene proC was deleted by the Red homologous recombination method to construct the strain E4△thrA△metL△dapA△proC. The obtained strain was named E5-3.

[0105] The required primers are shown in Table 7 below.

[0106] Table 7 Primer sequences (SEQ ID NO.137-176)

[0107]

[0108]

[0109] The production of spermidine of E5-1, E5-2, and E5-3 was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 19.3 g / L, 19.7 g / L, and 21.3 g / L.

[0110] Example 6: Knockout of key enzymes in relevant decomposition pathways

[0111] There are two pathways for the utilization and degradation of Arg (competitive pathway): (1) Arg is degraded to N by arginine N-succinyltransferase encoded by the astA gene (the amino acid sequence accession number at NCBI is QJZ04124.1). 2-succinylarginine, which is further degraded into L-Glu and succinic acid through ast series genes. In order to reduce the degradation of Arg, the present invention weakens the Arg degradation pathway, that is, deletes the astA gene.

[0112] According to the method described in Example 2, strain E5-3 was used as the starting strain of the metabolic pathway, and the gene astA was deleted by Red homologous recombination to prevent further degradation of Arg and allow more metabolic flux to flow to the synthesis of spermidine, thereby obtaining strain E5-3ΔastA, which was named E6. The required primers are shown in Table 8:

[0113] Table 8 Primer sequences (SEQ ID NO.177-186)

[0114]

[0115]

[0116] The production of E6 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 27.9 g / L.

[0117] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered Escherichia coli, characterized in that: The engineering bacteria express exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

2. The engineered bacteria according to claim 1, characterized in that The engineered bacteria knock out the gene encoding the repressor protein argR and construct an argA negative feedback mutant.

3. The engineered bacteria according to claim 1, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene argA encoding N-acetylglutamate synthetase, the gene argH encoding arginine succinate lyase, and the gene speA encoding arginine decarboxylase.

4. The engineered bacteria according to claim 2, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene lysC encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene argA encoding N-acetylglutamate synthetase, the gene argH encoding arginine succinate lyase, and the gene speA encoding arginine decarboxylase.

5. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineered bacteria knock out the gene encoding the transporter PotA, or enhance the expression of the transporter MdtJI that transfers spermidine to the extracellular space on the basis of knocking out the gene encoding the transporter PotA.

6. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineered bacteria also have thrA and metL genes encoding homoserine synthase knocked out; or, based on the knockout of thrA and metL genes, the dapA gene encoding dihydropicolinate synthase is further knocked out; or, based on the knockout of thrA, metL, dapA genes, the proC encoding pyrroline 5-carboxylate reductase is further knocked out.

7. The engineered bacteria according to any one of claims 1 to 6, characterized in that The engineered bacteria knock out the astA gene encoding arginine N-succinyltransferase.

8. The engineered bacteria according to any one of claims 3 to 7, characterized in that The strong promoter is the trc promoter.

9. Use of a genetically engineered Escherichia coli according to any one of claims 1 to 4 in producing spermidine.

10. Use of a genetically engineered Escherichia coli according to any one of claims 5 to 7 in producing spermidine.

Images