Tumor tissue culture and extracellular vesicle typing analysis method in micro-fluidic chip

Abstract

The invention discloses a tumor tissue culture and extracellular vesicle typing analysis method in a micro-fluidic chip, which comprises the following steps: step 1, providing two aptamer probes, including an aptamer PD-L1-L (modifying a second fluorophore) combined with PD-L1 protein, an aptamer EpCAM-L combined with EpCAM protein and a connecting arm (including a fluorescence quenching group and a first fluorophore), step 2, culturing tumor tissues in the chip, and capturing extracellular vesicles secreted by the tumor tissues through an antibody modified on the chip; 3, incubating the tumor tissue and the two aptamer probes, then incubating with the connecting arm, and generating a double-switch mode of first fluorescence recovery and second fluorescence quenching by the tumor cells, so as to identify the extracellular vesicles derived from the tumor cells; the second fluorescence of the immune cell PD-L1-L is maintained, and the first fluorescence of the connecting arm is quenched. Therefore, tumor tissue extracellular vesicle typing analysis is carried out.

Description

Technical Field

[0001] The invention relates to a method for culturing tumor tissue and analyzing extracellular vesicle typing in a microfluidic chip. Background Art

[0002] Extracellular vesicles are vesicles secreted by cells with a lipid bilayer enclosed structure. Extracellular vesicles contain protein markers, nucleic acids, lipids and other molecules. These biological molecules play an important role in intercellular communication involving extracellular vesicles, thereby regulating a variety of biological processes. Existing methods for studying tumor extracellular vesicles are mostly to separate and detect total extracellular vesicles from tumor cell culture supernatants or body fluids (blood, urine, breast milk, tears). Tumor cells will undergo changes in genetic characteristics during long-term culture. In addition, the source of extracellular vesicles obtained from cell culture is single, and the interaction effects of other symbiotic cells in tumor tissues are lost. Tumor-associated extracellular vesicles in body fluids are diluted and remodeled by body fluid circulation, resulting in differences in the biological properties of extracellular vesicles in tumor tissues. Therefore, the separation and analysis of extracellular vesicles in tumor tissues is the key to understanding the mechanism of tumor occurrence and development. The main methods for separating and analyzing extracellular vesicles in tumor tissues are enzymatic hydrolysis and ultracentrifugation to obtain total extracellular vesicles between tissues and perform marker analysis. The above methods may reduce the activity of extracellular vesicles and lose some biological properties, and cannot represent the state of extracellular vesicles in physiological tumor tissues. In addition, the analysis of total extracellular vesicles cannot distinguish the source of extracellular vesicles, and the understanding of the biological mechanism of the interactive communication of extracellular vesicles secreted by different cells in tumor tissues is limited. Therefore, it is necessary to develop a typing and analysis method for extracellular vesicles from different cell sources in tumor tissues.

[0003] Currently, there is no suitable device for analyzing extracellular vesicles of different cell origins in tumor tissues. Summary of the invention

[0004] The main purpose of the present invention is to provide a method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip.

[0005] The technical solution adopted by the present invention to solve its technical problem is:

[0006] A method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip comprises the following steps:

[0007] Step 1, providing two aptamer probes and a connecting arm, wherein the two aptamer probes are respectively an aptamer probe PD-L1-L for recognizing PD-L1 protein and an aptamer probe EpCAM-L for recognizing EpCAM protein, and the two aptamers respectively have a sequence that binds to the target protein and a DNA extension chain, and the two DNA extension chains are respectively complementary to a DNA sequence of the connecting arm, and the connecting arm is a hairpin structure modified with a quenching group and a first luminescent group; the PD-L1-L aptamer probe is modified with a second luminescent group.

[0008] Step 2: Cultivate tumor tissue in a microfluidic chip and capture the extracellular vesicles secreted by the tumor tissue using capture molecules modified on the chip.

[0009] Step three, after the captured extracellular vesicles are incubated with two aptamer probes, they are washed to remove unbound probes and then incubated with the tether; tumor cells are double positive for PD-L1 and EpCAM, and bind to the PD-L1-L aptamer and EpCAM-L aptamer. When incubated with the tether, due to the complementarity of PD-L1-L and EpCAM-L with the partial sequence of the tether, the hairpin structure of the tether is opened, and the first fluorescence is restored. At the same time, the quenching group on the tether is adjacent to the second fluorescent molecule on PD-L1-L, quenching the second fluorescence, thereby generating a double switching mode of first fluorescence recovery and second fluorescence quenching, thereby identifying extracellular vesicles derived from tumor cells; immune cells are PD-L1 positive and can only bind to the PD-L1-L aptamer but not the EpCAM-L aptamer; when incubated with the tether, the hairpin structure of the tether cannot be opened, therefore, the second fluorescence of PD-L1-L is maintained and the first fluorescence of the tether is quenched, thereby identifying them as extracellular vesicles derived from immune cells.

[0010] Furthermore, in step 1, the first sequence on the connecting arm that is complementary to the aptamer probe PD-L1-L and the second sequence on the connecting arm that is complementary to the aptamer probe EpCAM-L do not overlap.

[0011] Furthermore, in step 2, the microfluidic chip includes a top layer, a tissue culture layer, a fluid layer and a capture layer from top to bottom: wherein,

[0012] The middle part of the top layer is provided with a probe injection port, the left half is provided with a top layer fluid injection port, and the right half is provided with a top layer fluid outlet.

[0013] The tissue culture layer has a tumor tissue culture area and two fluid through holes. The tumor tissue culture area is connected to the probe injection port of the top layer. One of the two fluid through holes is connected to the fluid injection port of the top layer; the other is connected to the fluid outlet of the top layer.

[0014] The left half of the fluid layer is provided with a left diversion area, and the right half is provided with a right diversion area; the left diversion area is correspondingly connected to the fluid through-holes on the left side of the tissue culture layer, and is correspondingly connected to the fluid through-holes on the left side of the tumor tissue culture area, and the right diversion area is correspondingly connected to the fluid through-holes on the right side of the tissue culture layer, and is correspondingly connected to the fluid through-holes on the right side of the tumor tissue culture area; a capture hole is provided in the middle of the fluid layer; the capture hole corresponds to the position of the tumor tissue culture area.

[0015] The capture layer has a capture area, and the position of the capture area corresponds to the capture hole.

[0016] Furthermore, in step 2, the modified capture molecules on the chip are arranged in the capture area.

[0017] Furthermore, in step 2, the capture molecules modified in the capture zone include antibodies, polypeptides or nucleic acid aptamers.

[0018] Furthermore, the capture molecule includes an antibody, a polypeptide or a nucleic acid aptamer that specifically recognizes CD63, CD81 or CD9.

[0019] Furthermore, the tumor tissue culture area extends a plurality of strip grooves to the left, and the strip grooves form a comb-tooth-shaped left transition area; the culture area extends a plurality of strip grooves to the right, and the strip grooves form a comb-tooth-shaped right transition area.

[0020] Furthermore, the left diversion area includes a handle on the left and a diversion area on the right; the handle covers the left fluid through hole; the diversion area is a comb-shaped area composed of multiple strip grooves distributed in the left and right directions. The position of the diversion area corresponds to the position of the left transition area.

[0021] Furthermore, the right diversion area includes a diversion area on the left and a handle on the right; the handle covers the right fluid through hole; the diversion area is a comb-shaped area composed of multiple strip grooves distributed in the left and right directions; the position of the diversion area corresponds to the position of the right transition area.

[0022] Compared with the background technology, this technical solution has the following advantages:

[0023] 1. The present invention develops a dual switch strategy based on dual aptamers and molecular beacons for the capture and typing analysis of extracellular vesicles in tumor tissues. Tumor tissues are cultured and extracellular vesicles secreted by tumor tissues are captured. + EpCAM + ) and immune cell-derived extracellular vesicles (PD-L1 + EpCAM -) Based on the different expression levels of surface markers, we designed the PD-L1 protein recognition aptamer PD-L1-L, the EpCAM protein recognition aptamer EpCAM-L, and the molecular beacon Connector. When the DNA probe recognizes extracellular vesicles, the fluorescence of the Cy5-PD-L1-L aptamer of the tumor cell-derived extracellular vesicles is quenched, the fluorescence signal of the Connector is restored, and the extracellular vesicles derived from immune cells have no response, thereby performing typing analysis of the two types of extracellular vesicles in tumor tissues.

[0024] 2. The advantages of the method of the present invention also lie in that, firstly, the extracellular vesicles in the tumor microenvironment are obtained by tissue culture in a microfluidic chip, which avoids the damage to cells by using digestive enzymes and can better simulate the tumor microenvironment. Secondly, the extracellular vesicles secreted by tumor tissues are directly captured in the microfluidic chip, which can minimize the loss of extracellular vesicles caused by differential centrifugation. In addition, the strategy based on dual aptamers and dual switches can be used to type and analyze extracellular vesicles from different cell sources, avoiding false positive signals caused by a single aptamer.

[0025] 3. The chip of the present invention can be used for tumor tissue culture, and can be used to capture extracellular vesicles in the capture area by using modified antibodies or the like.

[0026] 4. The transition zone and the diversion zone of the chip of the present invention are comb-shaped, which can reduce the shear force of tissue culture and is more conducive to tumor tissue culture. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0028] Figure 1 Schematic diagram of each layer of the microfluidic chip in Example 1.

[0029] Figure 2 This is a schematic diagram of the top structure of the microfluidic chip in Example 1.

[0030] Figure 3 This is a schematic diagram of the structure of the tissue culture layer of the microfluidic chip in Example 1.

[0031] Figure 4 This is a schematic diagram of the fluid layer structure of the microfluidic chip in Example 1.

[0032] Figure 5 This is a schematic diagram of the capture layer structure of the microfluidic chip in Example 1.

[0033] Figure 6 Schematic diagram of the use principle of the microfluidic chip of the present invention.

[0034] Figure 7 It is a schematic diagram of the detection principle of the present invention.

[0035] Figure 8 Biotin-CD63 antibody modification efficiency.

[0036] Fig. 9 This is the detection result of A375 extracellular vesicles captured on the microfluidic chip in Example 3.

[0037] Fig.10 This is the detection result of U251 extracellular vesicles captured on the microfluidic chip in Example 3.

[0038] Fig.11 The feasibility of extracellular vesicle typing analysis of 4T1 tumor tissue in Example 3. Yellow arrows: extracellular vesicles secreted by tumor cells; blue arrows: extracellular vesicles secreted by immune cells. DETAILED DESCRIPTION

[0039] Example 1

[0040] See also Figure 1 The present invention provides a microfluidic chip for tumor tissue culture and extracellular vesicle typing analysis method, which includes a top layer 100, a tissue culture layer 200, a fluid layer 300 and a capture layer 400 from top to bottom.

[0041] See also Figure 2 The top layer 100 has a probe injection port 120 in the middle, a left fluid injection port 110 in the left half, and a right fluid outlet 130 in the right half.

[0042] See also Figure 3 A tumor tissue culture area 220 is provided in the middle of the tissue culture layer 200, a left fluid through hole 210 is provided in the left half, and a right fluid through hole 230 is provided in the right half. The left fluid through hole 210 corresponds to the left fluid injection port 110, and the right fluid through hole 230 corresponds to the right fluid outlet 130. The middle of the tumor tissue culture area 220 is a culture area 222, which is a rectangular through hole. The culture area 222 extends to the left with a plurality of strip grooves, which form a comb-shaped left transition area 221; the culture area 222 extends to the right with a plurality of strip grooves, which form a comb-shaped right transition area 223.

[0043] See also Figure 4 The fluid layer 300 has a capture hole 320 in the middle, a left diversion area 310 in the left half, and a right diversion area 330 in the right half. The capture hole 320 corresponds to the tumor tissue culture area 220.

[0044] Among them, the left diversion area 310 includes a handle 311 on the left side and a diversion area 312 on the right side. The handle 311 covers the left fluid through hole 210; the diversion area 312 is a comb-shaped strip grooves distributed in the left and right directions. The position of the diversion area 312 corresponds to the position of the left transition area 221. The right diversion area 330 is symmetrically arranged with the left diversion area 310. That is, the right diversion area 330 includes a diversion area 331 on the left side and a handle 332 on the right side. The handle 332 covers the right fluid through hole 230; the diversion area 331 is a comb-shaped strip grooves distributed in the left and right directions. The position of the diversion area 331 corresponds to the position of the right transition area 223.

[0045] See also Figure 5 The capture layer 400 has a capture zone 410 in the middle, and the position of the capture zone 410 corresponds to the capture hole 320 .

[0046] See also Figure 6

[0047] The use of the present invention is as follows:

[0048] Tumor tissue is placed in the tumor tissue culture area 220 in the middle of the tissue culture layer, and then the top layer 100, the tissue culture layer 200, the fluid layer 300 and the capture layer 400 are fixed. The fixation can be performed by various methods such as rubber band fixation and bonding.

[0049] After each layer is fixed, the probe injection port 120 is first taped. A peristaltic pump is used to inject tissue culture fluid from the left fluid injection port 110 of the top layer. The tissue culture fluid passes through the left fluid through hole 210 of the tissue culture layer 200 and enters the handle 311 of the left shunt area 310 of the fluid layer 300, then flows rightward from the handle 311 to the shunt area 312, and then flows upward from the shunt area 312 to the left transition area 221 of the tissue culture layer 200, thereby entering the culture area 222. Afterwards, it enters the shunt area 331 downward from the right transition area 223, and then flows to the handle 332. Finally, it flows out from the right fluid through hole 230 from the right fluid outlet 130. When culturing tumor tissue, a peristaltic pump is used to circulate the culture medium to simulate the blood circulation of tumor tissue.

[0050] The design of the comb-tooth structure of the fluid layer and the tissue culture layer of the present invention can divert the culture medium and reduce the shear force. The cultured tumor tissue is infiltrated in the culture medium, and the capture area 410 of the capture layer can be pasted with a cover glass modified with CD63 antibodies to capture the extracellular vesicles secreted by the tumor tissue. The probe injection port 120 can be opened by tearing off the tape and adding the detection probe.

[0051] See also Figure 7, which is a schematic diagram of the detection principle of the present invention, provides a method for analyzing the typing of extracellular vesicles secreted by tumor cells and immune cells, and distinguishes extracellular vesicles derived from tumor cells and immune cells in tumor tissues by the difference in the expression of PD-L1 and EpCAM markers on the surface of extracellular vesicles. An aptamer probe (Cy5-PD-L1-L) and an EpCAM protein aptamer probe (EpCAM-L) for recognizing PD-L1 protein are designed. These two aptamers respectively have a sequence that binds to the target protein and a DNA extension chain, and the DNA extension chain is complementary to a DNA sequence of the connector arm (Connector). Tumor cells are double positive for PD-L1 and EpCAM, and can bind to Cy5-PD-L1-L aptamer and EpCAM-L aptamer. When incubated with Conenctor modified with FAM and quenching group BHQ, due to the complementarity of Cy5-PD-L1-L and EpCAM-L with the partial sequence of Connector, the hairpin structure of Conenctor is opened and the FAM fluorescence is restored. At the same time, the quenching group BHQ on the Connector is adjacent to the Cy5 fluorescent molecule on Cy5-PD-L1-L, which can quench the fluorescence of Cy5. This produces a dual-switch mode of FAM fluorescence recovery and Cy5 fluorescence quenching, thereby identifying extracellular vesicles derived from tumor cells. Immune cells are PD-L1 positive, so they can only bind to the Cy5-PD-L1-L aptamer but not the EpCAM-L aptamer. When incubated with the connector arm, the hairpin structure of the Connector cannot be opened, so the Cy5 fluorescence of Cy5-PD-L1-L is maintained and the FAM fluorescence of the connector arm is quenched.

[0052] Specifically, the sequences and fluorescent labels of the two probes and the connecting arms of the present invention are as follows:

[0053] Cy5-PD-L1-L(5'-3'):TACAGGTTCTGGGGGGTGGGTGGGGAACCTGTTTGTGGTCTATGTCGTCGTTC GCTAGTAGTTC / iCy5dT / CTGGGCTGCAC;

[0054] EpCAM-L(5'-3'):TCGAGGCGTAGAATTCCCCCGATGCGCGCTGTTCTCACTACAGAG GTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG;

[0055] Connector (5'-3'):

[0056] FAM-CTGGGCTGTTATTGTATTCTACGCCTCGAGTGCAGCCCAG-BHQ

[0057] According to the dual switch mode or fluorescence maintenance principle of the present invention, in other embodiments, other sequences of PD-L1-L, EpCAM-L and connecting arms can also be used to achieve the dual switch mode or fluorescence maintenance, and the effect of FAM fluorescence quenching of the connecting arm. In addition, the types of fluorescent groups and quenching groups can also be replaced. The above specific sequences and fluorescent groups and quenching groups are only used for example and not for limitation.

[0058] The capture layer of the microfluidic chip is pasted with a cover glass modified with biotin-CD63 antibody to capture extracellular vesicles secreted by tumor tissue. The modification method is: add 5% (3-mercaptopropyl) trimethoxysilane (dissolved in ethanol) on the surface of the cover glass of the capture layer, incubate at room temperature for 2 hours, wash with anhydrous ethanol, and place at 90°C for 30 minutes. After the chip is cooled to room temperature, add 0.5 mg / mL GMBS (dissolved in ethanol) and incubate at room temperature for 30 minutes. After the incubation is completed, wash with anhydrous ethanol and PBS buffer in turn. Add 30μg / mL streptavidin (dissolved in PBS), place at 4°C overnight, rinse with PBS, add 30μg / mL biotin-CD63 antibody (dissolved in PBS), and place at 4°C overnight. After the modification of biotin-CD63 antibody, add AF488 fluorescent secondary antibody, and characterize the modification efficiency of biotin-CD63 antibody by laser confocal microscopy (the control group is unmodified biotin-CD63 antibody). The results showed that the fluorescence intensity of the coverslip modified with biotin-CD63 antibody was significantly stronger than that of the coverslip not modified with biotin-CD63 antibody ( Figure 8 ), therefore, the biotin-CD63 antibody was successfully modified on the cover glass surface of the capture layer of the microfluidic chip, which can be used to capture the extracellular vesicles secreted by tumor tissues.

[0059] Example 2

[0060] First, we investigated the potential of microfluidic chips to capture extracellular vesicles secreted by tumor cells and immune cells and to identify the two types of extracellular vesicles using DNA probes. + EpCAM + Extracellular vesicles, representing extracellular vesicles secreted by tumor cells) or U251 (secreting PD-L1 + EpCAM -Extracellular vesicles, representing extracellular vesicles secreted by immune cells) After cell recovery, culture with DMEM medium (10% serum to remove extracellular vesicles and 1% double antibody) for 60 hours, and collect the culture medium. The collected cell culture supernatant was centrifuged at 3000g for 20 minutes at 4°C to remove cell debris. The supernatant after centrifugation was taken out with a pipette and centrifuged at 4°C, 16500g, 45min to remove large vesicles. The supernatant was then centrifuged at 100,000g, 4°C for 2 hours, and the centrifuged precipitate was harvested. Finally, the precipitate obtained in the previous step was suspended in PBS, centrifuged at 4°C, 100000g, 2h, the supernatant was removed, and the A375 or U251 extracellular vesicle sample was resuspended with 200μL PBS. The total protein concentration of A375 or U251 extracellular vesicles was detected using a BCA kit.

[0061] The cover glass of the capture layer of the microfluidic chip was modified with biotin-CD63 antibody, 3% BSA was added, incubated at room temperature for 1h, and washed with PBS. 1mg / mL A375 / U251 exosomes were added dropwise, blocked with 100mM glycine and 0.5% BSA for 30min, and washed twice with 0.5% BSA. 200nM Cy5-PD-L1-L aptamer and 200nM EpCAM-L aptamer were added to the binding buffer (PBS containing 10mM MgCl2, 0.5% BSA) and incubated at room temperature for 40min. After washing twice with 0.5% BSA, 1μM Connector was added, incubated at room temperature for 20min in the binding buffer, and washed 3 times. The control group was incubated with the 59-base random sequence / Cy5-PD-L1-L aptamer / EpCAM-L aptamer labeled with Cy5 for 40 minutes, then incubated with the Connector at room temperature for 20 minutes, and washed twice with binding buffer. Images of the FAM channel and the Cy5 channel were taken using a laser confocal microscope.

[0062] The identification results of A375 extracellular vesicles captured by the capture layer of the microfluidic chip showed that when the control DNA (59-base random sequence labeled with Cy5) / PD-L1-L aptamer / EpCAM-L aptamer were incubated with the connector arm, the hairpin structure of the connector arm was not opened, so the fluorescence remained. However, when A375 extracellular vesicles were incubated with PD-L1-L aptamer, EpCAM-L aptamer, and the connector arm at the same time, the hairpin structure of the connector arm was opened, the FAM fluorescence modified on the connector arm was restored, and the Cy5 fluorescence of the Cy5-PD-L1-L aptamer was partially quenched, indicating that there was a connector. + 、PD-L1 + and Connector + 、PD-L1 - Extracellular vesicles ( Fig. 9), so this method can detect PD-L1 and EpCAM double-positive extracellular vesicles captured by CD63 antibody on the capture layer of the microfluidic chip.

[0063] The results of identification of U251 extracellular vesicles captured by the capture layer of the microfluidic chip showed that the fluorescence intensity of the linker arm after U251 extracellular vesicles were incubated with Cy5-PD-L1-L aptamer, EpCAM-L aptamer and linker arm at the same time was consistent with that of the control group, and the fluorescence intensity of the Cy5-PD-L1-L aptamer was also consistent with the result of U251 incubated only with Cy5-PD-L1-L aptamer and linker arm ( Fig.10 ), indicating that this strategy can detect PD-L1-positive, EpCAM-negative U251 extracellular vesicles captured by CD63 antibody on the capture layer of the microfluidic chip.

[0064] Example 3

[0065] 4T1 cells were subcutaneously implanted in Balb / C mice. After tumor formation, the tumor tissue was removed and placed in the cell culture layer of the microfluidic chip. RPMI-1640 medium (containing 20% ​​exosome-removed serum and 1% double antibody) was passed through. The 4T1 tumor tissue was placed in the microfluidic chip, and the medium was circulated using a peristaltic pump and cultured for 12 hours. The tumor tissue was removed, and the feasibility of using microfluidic chips to culture 4T1 tumor tissues and to perform typing analysis of captured extracellular vesicles was investigated by probe incubation and laser confocal microscopy imaging. The confocal imaging results showed that when the capture layer was incubated with control DNA and the tether or EpCAM aptamer and the tether, there was no fluorescence signal in the FAM channel and the Cy5 channel. When the capture layer was incubated with the Cy5-PD-L1-L aptamer and the tether, the fluorescence signal of the tether was not restored, and the fluorescence signal of the Cy5-PD-L1-L aptamer was maintained. When the capture layer was incubated with EpCAM-L aptamer, Cy5-PD-L1-L aptamer and the linker, the fluorescence signal of the linker was restored, while the fluorescence signal of the Cy5-PD-L1-L aptamer was quenched ( Fig.11 , yellow arrow), indicating that this particle is an extracellular vesicle secreted by tumor cells. The fluorescence signal of the connecting arm was not restored, and the particles whose fluorescence signal of the Cy5-PD-L1-L aptamer was retained were extracellular vesicles secreted by immune cells ( Fig.11 , blue arrow). Therefore, this strategy can be used for the profiling of extracellular vesicles secreted by 4T1 tumor tissue.

[0066] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip, characterized in that: The steps include: Step 1, providing two aptamer probes and a connecting arm, wherein the two aptamer probes are respectively an aptamer probe PD-L1-L for recognizing PD-L1 protein and an aptamer probe EpCAM-L for recognizing EpCAM protein, the two aptamers respectively have a sequence that binds to the target protein and a DNA extension chain, the two DNA extension chains are respectively complementary to a DNA sequence of the connecting arm, the connecting arm is a hairpin structure, and is modified with a quenching group and a first luminescent group; the PD-L1-L aptamer probe is modified with a second luminescent group; Step 2: Cultivate tumor tissue in a microfluidic chip and capture the extracellular vesicles secreted by the tumor tissue through the capture molecules modified on the chip; Step three, after the captured extracellular vesicles are incubated with two aptamer probes, they are washed to remove unbound probes and then incubated with the tether; tumor cells are PD-L1 and EpCAM double positive, and bind to the PD-L1-L aptamer and EpCAM-L aptamer. When incubated with the tether, due to the complementarity of PD-L1-L and EpCAM-L with the partial sequence of the tether, the hairpin structure of the tether is opened, and the first fluorescence is restored. At the same time, the quenching group on the tether is adjacent to the second fluorescent molecule on PD-L1-L, quenching the second fluorescence, thereby generating a double switching mode of first fluorescence recovery and second fluorescence quenching, thereby identifying them as extracellular vesicles derived from tumor cells; immune cells are PD-L1 positive and can only bind to the PD-L1-L aptamer but not the EpCAM-L aptamer. When incubated with the tether, the hairpin structure of the tether cannot be opened, therefore, the second fluorescence of PD-L1-L is maintained and the first fluorescence of the tether is quenched, thereby identifying them as extracellular vesicles derived from immune cells.

2. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 1, characterized in that: In step 1, the first sequence on the connecting arm that is complementary to the aptamer probe PD-L1-L and the second sequence on the connecting arm that is complementary to the aptamer probe EpCAM-L do not overlap.

3. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 1, characterized in that: In step 2, the microfluidic chip includes a top layer, a tissue culture layer, a fluid layer and a capture layer from top to bottom: wherein, The middle part of the top layer has a probe injection port, the left half has a top layer fluid injection port, and the right half has a top layer fluid outlet; The tissue culture layer has a tumor tissue culture area and two fluid through holes, the tumor tissue culture area is correspondingly connected to the probe injection port of the top layer, one of the two fluid through holes is correspondingly connected to the fluid injection port of the top layer; the other is correspondingly connected to the fluid outlet of the top layer; The left half of the fluid layer is provided with a left shunt area, and the right half is provided with a right shunt area; the left shunt area is correspondingly connected to the fluid through hole on the left side of the tissue culture layer, and is correspondingly connected to the left side of the tumor tissue culture area, and the right shunt area is correspondingly connected to the fluid through hole on the right side of the tissue culture layer, and is correspondingly connected to the right side of the tumor tissue culture area; a capture hole is provided in the middle of the fluid layer; the capture hole corresponds to the position of the tumor tissue culture area; The capture layer has a capture area, and the position of the capture area corresponds to the capture hole.

4. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 2, characterized in that: In step 2, the modified capture molecules on the chip are placed in the capture zone.

5. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 4, characterized in that: In step 2, the capture molecules modified in the capture zone include antibodies, peptides or nucleic acid aptamers.

6. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 5, characterized in that: Capture molecules include antibodies, peptides or nucleic acid aptamers that specifically recognize CD63, CD81 or CD9.

7. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 2, characterized in that: The tumor tissue culture area extends a plurality of strip grooves to the left, and the strip grooves form a comb-tooth-shaped left transition area; the culture area extends a plurality of strip grooves to the right, and the strip grooves form a comb-tooth-shaped right transition area.

8. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 2, characterized in that: The left diversion area includes a handle on the left and a diversion area on the right; the handle covers the left fluid through hole; the diversion area is a comb-shaped area composed of multiple strip grooves distributed in the left and right directions, and the position of the diversion area corresponds to the position of the left transition area.

9. The method for tumor tissue culture and extracellular vesicle typing analysis in a microfluidic chip according to claim 2, characterized in that: The right diversion area includes the diversion area on the left and the handle on the right; the handle covers the right fluid through hole; the diversion area is a comb-shaped area composed of multiple strip grooves distributed in the left and right directions; the position of the diversion area corresponds to the position of the right transition area.

Images