Application of double-stranded RNA molecules and related biological materials in controlling Bemisia tabaci

By developing double-stranded RNA molecules targeting the BtSgAbd-2 gene of whitefly and using them in combination with polymer vectors and insecticides, the problem of lack of effective RNA pesticide targets in the prior art is solved, and efficient prevention and control of whitefly is achieved.

CN119736298BActive Publication Date: 2025-06-06CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510251480.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-05
Publication Date
2025-06-06
Estimated Expiration
2045-03-05

AI Technical Summary

Technical Problem

The lack of effective RNA pesticide targets for whiteflies in the prior art leads to increased resistance to whiteflies and reduced plant quality.

Method used

A double-stranded RNA molecule targeting the endocutile structural glycoprotein-2 (BtSgAbd-2) gene was developed, and the prevention and treatment effect of whiteflies was improved through the use in combination with polymer carriers and insecticides.

Benefits of technology

By reducing the expression of the BtSgAbd-2 gene of whitefly, the mortality rate and survival rate of whitefly are significantly improved, thereby achieving precise prevention and treatment of whitefly and reducing dependence on chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736298B_ABST
    Figure CN119736298B_ABST
Patent Text Reader

Abstract

The present invention provides an application of double-stranded RNA molecules and related biological materials in controlling Bemisia tabaci, which relates to the technical field of agricultural pest control. BtSgAbd‑2 double-stranded RNA molecule of the gene, which can BtSgAbd‑2 The invention can interfere with the gene, and obtain the death phenotype of whitefly under the premise of ensuring the interference efficiency. In addition, the invention also provides a composition and preparation comprising the above double-stranded RNA molecule, which can be used in combination with an insecticide to further increase the mortality rate of whitefly. The invention can achieve precise control of whitefly, improve the control effect of whitefly, and prevent plants from being damaged by whitefly; at the same time, the invention helps to reduce the dependence on chemical pesticides, is an innovative green control technology, and has a positive impact on agricultural sustainable development and environmental protection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of agricultural pest control, and in particular to application of a double-stranded RNA molecule and related biological materials in controlling whitefly. Background Art

[0002] Bemisia tabaci Bemisia tabaci ) belongs to the family Aleyrodidae of the order Hemiptera and is one of the most destructive agricultural pests. The whitefly has the characteristics of overlapping generations and rapid reproduction, which leads to the increasing frequency and dosage of chemical pesticides, resulting in the increasing resistance of whiteflies to pesticides year by year, while reducing the quality of vegetables and fruits. Therefore, the development of green control measures against whiteflies is of far-reaching significance.

[0003] RNA biopesticide is an emerging biological agent based on RNA interference (RNAi). It uses double-stranded RNA (dsRNA) molecules to trigger efficient and specific degradation of homologous mRNA, thereby leading to gene silencing to achieve the purpose of killing pests. In recent years, two commercial products based on RNAi have been approved internationally. One is the RNA transgenic corn MON 87411 developed by Bayer / Monsanto to control corn rootworms; the other is the spray-type RNA biopesticide Ledprona developed by GreenLight Bioscience to control potato beetles. However, there is a serious lack of RNA pesticide targets for whiteflies and they need to be developed urgently. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a double-stranded RNA molecule targeting whiteflies, so as to reduce the survival rate of whiteflies and prevent plants from being damaged by whiteflies.

[0005] In a first aspect, the present invention provides a double-stranded RNA molecule, wherein the double-stranded RNA molecule targets Bemisia tabaci endocuticle structural glycoprotein-2 ( BtSgAbd-2 ) gene, the BtSgAbd-2 The coding sequence of the gene is SEQ ID NO:3.

[0006] The double-stranded RNA molecule as described above consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID NO:1, and the nucleotide sequence of the antisense strand is SEQ ID NO:2.

[0007] The double-stranded RNA molecule as described above, the double-stranded RNA molecule can BtSgAbd-2 The coding sequence fragment of the gene (the nucleotide sequence shown at positions 570-810 of SEQ ID NO: 3) is used as a template and transcribed in vitro.

[0008] In a second aspect, the present invention provides a biological material related to the above double-stranded RNA molecule, wherein the biological material is selected from at least one of A1) to A5):

[0009] A1) a DNA molecule encoding the above double-stranded RNA molecule;

[0010] A2) an expression cassette containing the DNA molecule described in A1);

[0011] A3) a recombinant vector containing the DNA molecule described in A1) or a recombinant vector containing the expression cassette described in A2);

[0012] A4) a recombinant microorganism containing the DNA molecule described in A1) or a recombinant microorganism containing the expression cassette described in A2) or a recombinant microorganism containing the recombinant vector described in A3);

[0013] A5) A transgenic cell line containing the DNA molecule described in A1) or a transgenic cell line containing the expression cassette described in A2) or a transgenic cell line containing the recombinant vector described in A3).

[0014] In a third aspect, the present invention provides a composition comprising any of the double-stranded RNA molecules described above.

[0015] The composition as described above also includes a double-stranded RNA molecule delivery vector. It is understood that the delivery route of the double-stranded RNA molecule can be by injection, feeding, epidermal delivery and the like, and the delivery vector used is different according to the delivery route; further, the delivery route can be epidermal delivery, which is convenient for improving the prevention and treatment efficiency.

[0016] Furthermore, the double-stranded RNA delivery vector is a polymer carrier as shown in Formula 1, which can deliver the double-stranded RNA molecule into the body of Bemisia tabaci through the epidermis;

[0017] ;

[0018] In formula 1, R 1 and R 2 Each independently selected from H, CH 3 , CH 2 CH 3 or CH 2 CH 2 CH 3 ; n1, n2, n3, n4 each independently take values ​​of 1-100.

[0019] Furthermore, in the structure shown in Formula 1, R 1 and R 2 All CH 3 , n1, n2, n3, and n4 are all 40.

[0020] Furthermore, the polymer carrier represented by Formula 1 can be prepared by the preparation method disclosed in Chinese invention patent publication number CN108794710A.

[0021] The composition as described above further comprises an insecticide. Further, the insecticide may be an insecticide effective against Bemisia tabaci, such as matrine and thiamethoxam.

[0022] In the composition as described above, the mass ratio of the double-stranded RNA molecule to the polymer carrier shown in Formula 1 is 1:1.

[0023] In the composition as described above, the final concentrations of the double-stranded RNA molecule and the polymer carrier represented by Formula 1 in the composition can be 1000-3000 ng / μL, respectively; specifically, 1000 ng / μL, 1100 ng / μL, 1200 ng / μL, 1300 ng / μL, 1400 ng / μL, 1500 ng / μL, 1600 ng / μL, 1700 ng / μL, 1800 ng / μL, 1900 ng / μL, 2000 ng / μL, 2100 ng / μL, 2200 ng / μL, 2300 ng / μL, 2400 ng / μL, 2500 ng / μL, 2600 ng / μL, 2700 ng / μL, 2800 ng / μL, 2900 ng / μL, 3000 ng / μL or within the range of any two thereof. Furthermore, the final concentration of the double-stranded RNA molecule in the composition can be 2500 ng / μL.

[0024] The content of the insecticide in the composition can be determined based on the IC 50 Determine; further, when the insecticide is matrine, the concentration of matrine in the composition is 88.48 mg / L.

[0025] The composition as described above further comprises a solvent, and the solvent used can be nuclease-free water.

[0026] The composition as described above further comprises a surfactant; further, the surfactant is a nonionic surfactant to promote the adhesion and spread of double-stranded RNA molecules on the surface of the insect body. Further, the surfactant is alkyl polyglTcoside (APG). Further, the volume concentration of the surfactant in the delivery mixture is 0.1%-1%.

[0027] As described above, each component in the composition can be stored separately. When used, the double-stranded RNA molecule is mixed with the polymer carrier shown in Formula 1 and incubated at 0-35°C for at least 15 min to form a mixed system of the double-stranded RNA molecule and the carrier, which is convenient for the delivery of the double-stranded RNA molecule.

[0028] Furthermore, the incubation temperature of the double-stranded RNA molecule and the above polymer carrier is 18-28°C.

[0029] In a fourth aspect, the present invention provides an RNA preparation comprising any of the double-stranded RNAs described above or any of the compositions described above.

[0030] As described above, the active ingredient of the RNA preparation is the double-stranded RNA molecule. The RNA preparation may also contain other biological components or non-biological components. Those skilled in the art may determine the other components of the RNA preparation according to the effects of the preparation.

[0031] In a fifth aspect, the present invention provides an application of the double-stranded RNA molecule or the biomaterial or the composition or the RNA preparation, wherein the application is selected from at least one of B1) to B6):

[0032] B1) In suppressing whiteflies BtSgAbd-2 Applications in gene expression;

[0033] B2) Preparation of Bemisia tabaci BtSgAbd-2 Application in gene expression products;

[0034] B3) Application in the control of whitefly;

[0035] B4) Use in the preparation of products for controlling Bemisia tabaci;

[0036] B5) Application in reducing the survival rate of whiteflies;

[0037] B6) Use in the preparation of products for reducing the survival rate of whiteflies.

[0038] In a sixth aspect, the present invention provides a method for reducing the survival rate of whiteflies, comprising contacting the above-mentioned double-stranded RNA molecule or the above-mentioned composition or the above-mentioned RNA preparation with whiteflies, and reducing the survival rate of whiteflies after the double-stranded RNA molecule enters the body of the whitefly.

[0039] In a seventh aspect, the present invention provides a method for controlling plant infestation by whiteflies, comprising applying the above-mentioned double-stranded RNA molecule or the above-mentioned composition or the above-mentioned RNA preparation on the surface of the plant, and after the double-stranded RNA molecule contacts with the whitefly and enters the body of the whitefly, controlling the plant infestation by whiteflies by reducing the survival rate of the whitefly.

[0040] In the above method, the double-stranded RNA molecule or the composition or preparation containing the double-stranded RNA molecule can be contacted with the whitefly by dripping or spraying on the body wall. Specifically, the body wall includes but is not limited to the back of the whitefly; the spraying can be directly sprayed on the surface of the whitefly or on the surface of the plant where the whitefly is active.

[0041] In the method as described above, the double-stranded RNA molecule and the insecticide can be used separately or simultaneously; specifically, the insecticide can be first contacted with the whitefly, and then the double-stranded RNA molecule can be contacted with the whitefly; or the double-stranded RNA molecule can be first contacted with the whitefly, and then the insecticide can be contacted with the whitefly; or the insecticide and the double-stranded RNA molecule can be mixed and then contacted with the whitefly at the same time; the present invention does not impose any further restrictions on the contact order.

[0042] In the method described above, the dosage of the double-stranded RNA molecule or the composition or preparation containing the double-stranded RNA molecule is determined according to actual conditions.

[0043] As described above, the plant is a plant that is susceptible to attack by whiteflies, specifically, vegetable plants such as tomatoes, cucumbers, zucchini, pumpkins, melons, cabbages, Chinese cabbages, radishes, eggplants, green peppers, beans, and lentils; it can also be economic crops such as cotton and corn; it can also be flower plants such as sunflowers; it can also be other plants such as tobacco, sweet potatoes, cassava, nepeta, licorice, mint, patchouli, motherwort, crotalaria, white crystal chrysanthemum, Achyranthes bidentata, blue thistle, alfalfa, and very fragrant basil.

[0044] The present invention uses genes related to epidermal formation of Bemisia tabaci BtSgAbd-2 A double-stranded RNA molecule is provided as a target to inhibit the growth of whiteflies. BtSgAbd-2 The gene is subjected to RNA interference, and the phenotype of death of whitefly is obtained under the premise of ensuring the interference efficiency. In addition, the present invention also provides a composition and preparation comprising the above double-stranded RNA molecule, which helps to further increase the mortality rate of whitefly by combining with an insecticide. The present invention can achieve precise control of whitefly, improve the control effect of whitefly, and prevent plants from being damaged by whitefly; at the same time, the present invention helps to reduce dependence on chemical pesticides, is an innovative green control technology, and has a positive impact on agricultural sustainable development and environmental protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 For use BtSgAbd-2 dsRNA / SPc and EGFP dsRNA / SPc were used to treat whitefly nymphs for 24h and 48h, respectively. BtSgAbd-2 Statistical results of relative gene expression;

[0046] Figure 2 For use BtSgAbd-2 The statistical results of mortality and emergence rate of whitefly nymphs treated with dsRNA / SPc and EGFP dsRNA / SPc after 2, 4, and 6 days, respectively; A is the mortality rate, and B is the emergence rate;

[0047] Figure 3 To treat Bemisia tabaci nymphs with matrine BtSgAbd-2 Statistical results of relative gene expression;

[0048] Figure 4 For the use of EGFP dsRNA / SPc, matrine, BtSgAbd-2 dsRNA / SPc and BtSgAbd-2 Statistical results of mortality and emergence rate of whitefly nymphs treated with dsRNA / SPc+matrine 2, 4, and 6 days after treatment; A is mortality, B is emergence rate;

[0049] Figure 5 For the use of EGFP dsRNA / SPc, matrine and BtSgAbd-2 dsRNA / SPc+matrine treatment of whitefly nymphs 24h and 48h later BtSgAbd-2 Statistical results of relative gene expression. DETAILED DESCRIPTION

[0050] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0051] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0052] The data in the following examples were processed using GraphPad Prism 9.5 statistical software, and the experimental results were expressed as mean ± standard deviation. t test( t test) and Tukey post hoc test (Tukey HSD test); among them, tIn the test method, * indicates significant difference ( P <0.05,** indicates extremely significant difference( P <0.01,*** indicates extremely significant difference( P <0.001,**** indicates extremely significant difference( P <0.0001, ns indicates no statistically significant difference; different letters indicate significant differences in Tukey's post hoc test ( P <0.05).

[0053] The whiteflies used in the following examples were raised indoors in the Agricultural and Forestry High-risk Biological Control Laboratory of China Agricultural University. The indoor raising conditions were: temperature 28±1°C, relative humidity maintained at 90±5%, and photoperiod of 14:10 hours (day:night). The raising method of whiteflies was as follows: planting cucumber seedlings, and when the seedlings grew 2-3 true leaves, 20 whitefly adults were inoculated on each leaf, and breeding was carried out under the above-mentioned raising conditions.

[0054] The nucleic acid carrier SPc used in the following examples is the star polymer P2 disclosed in Example 2 of the Chinese invention patent application with publication number CN108794710A, and its structural formula is as follows:

[0055] .

[0056] Matrine (CAS No. 519-02-8) used in the following examples was purchased from Shanghai MacLean Biochemical Technology Co., Ltd.

[0057] Example 1: Synthetic Targeting BtSgAbd-2 Double-stranded RNA (dsRNA) of a gene

[0058] 1. Extraction of target DNA fragments

[0059] Fifty third-instar nymphs of Bemisia tabaci were randomly selected and total RNA was extracted using M5 Total RNA Extraction Reagent (TRIgent). cDNA was synthesized using the reverse transcription kit PrimeScript™ II 1st Strand cDNA Synthesis Kit (purchased from TaKara). BtSgAbd-2 The CDS sequence of the gene (nucleotide sequence is SEQ ID NO: 3) was designed using the National Center for Biotechnology Information (NCBI) online website BtSgAbd-2 Gene amplification primers BtSgAbd-2 -F (nucleotide sequence is SEQ ID NO: 4) and BtSgAbd-2-R (nucleotide sequence is SEQ ID NO: 5). Using the cDNA obtained by reverse transcription as a template, 1 μL of cDNA template, 12.5 μL of 2×Taq Plus Master Mix, 1 μL of upstream primer BtSgAbd-2 -F, 1 μL of downstream primer BtSgAbd-2 -R and 9.5 μL of ddHO 2 O mixed to obtain a total volume of 25 μL of the mixed system, the mixed system was subjected to PCR reaction, the PCR reaction conditions were: 95℃ 2 min; 95℃ 30 s, 55℃ 20 s, 72℃ 1 min, 40 cycles; 72℃ 10 min, after the reaction was completed, the amplification was obtained BtSgAbd-2 Gene fragment (nucleotide sequence is positions 570-810 of SEQ ID NO: 3, as underlined below).

[0060] BtSgAbd-2 Coding sequence of the gene (SEQ ID NO:3):

[0061] 5'-ATGGATGAAGAGGTACCCAGCCTGGCTGGGGGATCCGCGCGCCAGCAAAACAAGACCGCGGTGTTGTGGGTAAATATAAGCACGCTACTCATCAAAAATCTTCACTCTCCACCGTGTTCCGGCCTAATCCACATCCGAAC AAACAGCCGCAACATGAAATTAACCATTGTCCCATTCCTTCTCACTCTGAGCGTGACGCTGGCCCAGCGTCAGTCATACCGCCAAGCTCAGCCTCAGTACCAGCAACAACAGCAGTACCAGCAGCAACAACAGTATGACCAAA AGCAACAACAGTACGACCAACAGCAGCAGTACCAGCAGTACCAGCAGTATCGGCCGGAGCCCAGCGCAGCTGACGTGTATTCCGCGCTGAAGAACCGGCCGATCGTGGTTCAGGACCAGAGCCCGGCCGCTGCGACTTACCAG AGCACTCCATCACCGGTGGCCGTCACGCCGGCCCAGAACCTCGTCCAACAGTACTCCACTCCCGAGGCCCCAGCTCGTCTCCTCTCGAGGGCCGAGTACACGACGGTCATACCCATCATCCGCTACCAGAAGGAACAGTCCCT CGATGGAAGCTACAAGGCGAGCTATGAA ACTGGTAACCACATCGTAGCTGAGGAAACAGGATTTTTGAAAAACGTCGGAGTTAAAGACCATGAAGCTTTGGTGCAACACGGTTCATACTCGTACACCTCACCAGATGGCGTCCTCATCAACGTCCAATACGTGGCCGACGAGGGAGGATT CCGGGCAACCGGTGACCACCTTCCTACCCCACCACCGATTCCCGCTGAGATCCAAAAGGGT TTGGATACCATCTTCGAGCAAATCAGACTTCAAGCGGAAGCAGAAGCCAGGAAACCCAAGCCAGCTGGAGACATCAACACAAACGCAGTAACGGAAAACTACAACGGGAGATACCAGCAGTAA-3'.

[0062] Upstream primer BtSgAbd-2 -F (SEQ ID NO:4): 5'-CGATGGAAGCTACAAGGCGA-3';

[0063] Downstream primer BtSgAbd-2 -R (SEQ ID NO:5): 5'-ACCCTTTTGGATCTCAGCGG-3'.

[0064] The PCR product was subjected to 1% agarose gel electrophoresis to check whether the target product size was correct. The correct product was purified and recovered using the FastPure Gel DNA Extraction Mini Kit (purchased from Vazyme). The recovered product was connected to the pMD19T vector (purchased from Takara) and then transferred into Escherichia coli DH5α competent cells (purchased from Vazyme). Escherichia coli DH5α was spread on a medium with 100 mg / mL Amp resistance and cultured overnight. Positive single colonies were picked and sent to Beijing Biotechnology Company for sequencing. The sequencing results were compared with the NCBI database to obtain BtSgAbd-2 The target strain was used to extract the plasmid using the Fast Pure Plasmid Mini Kit (purchased from Vazyme) and used as the template for the next step.

[0065] 2. Synthesis of dsRNA

[0066] The above-mentioned BtSgAbd-2 The plasmid of the target sequence fragment and the EGFP plasmid (purchased from Zhuangmeng Biotechnology, catalog number ZK427) were used as templates, and PCR amplification was performed using primers with T7 promoter sequences (among which, the primers used for amplification BtSgAbd-2 The primers for the target sequence fragments are named BtSgAbd-2 -1 and BtSgAbd-2 -2, the nucleotide sequences are SEQ ID NO: 6-7 respectively; the primers used to amplify the EGFP plasmid are named EGFP-1 and EGFP-2, and the nucleotide sequences are SEQ ID NO: 8-9 respectively). The amplification system and conditions are the same as above. After the amplification reaction, the target product is recovered and purified after gel electrophoresis detection and used as a DNA template for dsRNA synthesis.

[0067] BtSgAbd-2 -1 (SEQ ID NO:6): 5'- TAATACGACTCACTATAGGGCG ATGGAAGCTACAAGGCGA-3′;

[0068] BtSgAbd-2 -2 (SEQ ID NO:7): 5'- TAATACGACTCACTATAGGG ACCCTTTTGGATCTCAGCGG-3′;

[0069] EGFP-1 (SEQ ID NO:8): 5'- TAATACGACTCACTATAGGG TGGAGAGGGTGAAGG-3′;

[0070] EGFP-2 (SEQ ID NO:9): 5'- TAATACGACTCACTATAGGGGGG CAGATTGTGTGGAC-3′;

[0071] In SEQ ID NO:6-9, the underlined sequence is the T7 promoter sequence, and the non-underlined sequence is the gene sequence.

[0072] The dsRNA was synthesized using the T7 RNAi Transcription Kit (purchased from Vazyme). Specifically, 8 μL of NTP Mix, 2 μL of 10× Transcription Buffer, 2000 ng of DNA template, 2 μL of T7 Enzyme Mix, and RNase-free H 2 O to obtain a total volume of 20 μL of the mixed system, and incubate the mixed system at 37°C overnight. Add 2 μL of RNase T1 Dilution Buffer (diluted 10 times), 1 μL of DNaseI, and 17 μL of RNase-free H 2 O, and continue to incubate at 37°C for 30 min. Then add 4 μL 3M Solution Acetate and 100 μL isopropanol to the above reaction system, let it stand on ice for 5 min, and centrifuge at 12000 rpm for 20 min at 4°C. Discard the supernatant, keep the white precipitate at the bottom of the centrifuge tube, add 1000 μL 75% anhydrous ethanol, gently wash the precipitate, centrifuge at 12000 rpm for 10 min at 4°C, and discard the supernatant. Place the centrifuge tube in a fume hood, let it stand at room temperature for 10 min, and dry the precipitate. Then add 30 μL RNase-Free ddH 2 O dissolves the precipitate and obtains the dsRNA product, named BtSgAbd-2 dsRNA andEGFP dsRNA.

[0073] BtSgAbd-2 The dsRNA consists of a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO: 2. EGFP The dsRNA consists of a sense strand having a nucleotide sequence of SEQ ID NO: 10 and an antisense strand having a nucleotide sequence of SEQ ID NO: 11;

[0074] SEQ ID NO: 1 is specifically as follows:

[0075] 5'-CGAUGGAAGCUACAAGGCGAGCUAUGAAACUGGUAACCACAUCGUAGCUGAGGAAACAGGAUUUUUGAAAAACGUCGGAGUUAAAGACCAUGAAGCUUUGGUGCAACACGGUUCAUACUCG UACACCUCACCAGAUGGCGUCCUCAUCAACGUCCAAUACGUGGCCGACGAGGGAGGAUUCCGGGCAACCGGUGACCACCUUCCUACCCACCACCGAUUCCCGCUGAGAUCCAAAAGGGU-3';

[0076] SEQ ID NO:2 is specifically as follows:

[0077] 5'-ACCCUUUUGGAUCUCAGCGGGAAUCGGUGGUGGGGUAGGAAGGUGGUCACCGGUUGCCCGGAAUCCUCCCUCGUCGGCCACGUAUUGGACGUUGAUGAGGACGCCAUCUGGUGAGGUGUAC GAGUAUGAACCGUGUUGCACCAAAGCUUCAUGGUCUUUAACUCCGACGUUUUUCAAAAAUCCUGUUUCCUCAGCUACGAUGUGGUUACCAGUUUCAUAGCUCGCCUUGUAGCUUCCAUCG-3';

[0078] SEQ ID NO: 10 is specifically as follows:

[0079] 5’- UGGAGAGGGUGAAGGUGAUGCAACAUACGGAAAACUUACCCUUAAAUUUAUUUGCACUACUGGAAAACUACCUGUUCCAUGGCCAACACUUGUCACUACUUUCUCUUAUGGUGUUCAAUGCUUUUCAAGAUACCCAGAUCAUAUGAAACGGCAUGACUUUUUCAAGAGUGCCAUGCCCGAAGGUUAUGUACAGGAAAGAACUAUAUUUUUCAAAGAUGACGGGAACUACAAGACACGUGCUGAAGUCAAGUUUGAAGGUGAUACCCUUGUUAAUAGAAUCGAGUUAAAAGGUAUUGAUUUUAAAGAAGAUGGAAACAUUCUUGGACACAAAUUGGAAUACAACUAUAACUCACACAAUGUAUACAUCAUGGCAGACAAACAAAAGAAUGGAAUCAAAGUUAACUUCAAAAUUAGACACAACAUUGAAGAUGGAAGCGUUCAACUAGCAGACCAUUAUCAACAAAAUACUCCAAUUGGCGAUGGCCCUGUCCUUUUACCAGACAACCAUUACCUGUCCACACAAUCUG-3’;

[0080] SEQ ID NO:11 is specifically as follows:

[0081] 5'- -3'.

[0082] Take 1 μL of dsRNA solution, dilute 10 times, and detect the size and quality of dsRNA fragments by agarose gel electrophoresis. Determine the dsRNA concentration with a micro-UV spectrophotometer. Store the dsRNA in a -20℃ refrigerator for later use.

[0083] Embodiment 2, BtSgAbd-2 Application of dsRNA nanoparticles in the control of Bemisia tabaci

[0084] 1. Preparation of Nanoparticles

[0085] Take the sample obtained in Example 1 BtSgAbd-2 dsRNA and EGFP dsRNA, according to the measured concentration, take 25 μL of dsRNA solution with a dsRNA concentration of 5000 ng / μL, and add an equal mass of nanocarriers according to the mass ratio of dsRNA to nanocarrier SPc of 1:1, make up to 50 μL with deionized water, shake and mix evenly, and stand at room temperature for 15 min to allow SPc and dsRNA to fully combine, to obtain a dsRNA / SPc preparation with a final dsRNA concentration of 2500 ng / μL.

[0086] 2. dsRNA dripping on the back plate

[0087] Take a third-instar nymph of Bemisia tabaci from a cucumber leaf and drop 125ng of BtSgAbd-2 dsRNA BtSgAbd-2 dsRNA / SPc preparation, drip equal amount at the same time EGFP The dsRNA / SPc treatment was used as a control. Specifically, 5 μL (containing 12,500 ng dsRNA) of the nanoformulation was drawn with a 5 μL microinjector, squeezed to form small droplets, and dripped and adhered to the back plate of the whitefly nymph. The droplets formed small balls at the lipid interface of the body wall and were absorbed by the whitefly nymph.

[0088] The cucumber leaves with whiteflies were placed on agar plates and cultured in an artificial climate incubator with a light:dark period of 14:10 h, a light temperature of 28±1°C, and a relative humidity of 90%±5%.

[0089] 3. Determination of RNA interference effect

[0090] Surviving whitefly nymphs were collected 24 h and 48 h after the droplet of dsRNA / SPc preparation, and were evenly divided into 3 groups to extract total RNA, which was then reverse transcribed into cDNA in the same manner as in Example 1. qPCR primers (SEQ ID NO: 12-13) were designed using the NCBI online website, EF-1α was used as the internal reference gene (the nucleotide sequence of the amplification primer was SEQ ID NO: 14-15), and fluorescent quantitative PCR (qPCR) detection was performed using the TransStart® Top Green qPCR Super Mix (purchased from Transgene) kit.

[0091] Amplification BtSgAbd-2 Upstream primer of gene (SEQ ID NO: 12): 5′-CCAACAGTACTCCACTCCCG-3′;

[0092] Amplification BtSgAbd-2 Downstream primer of gene (SEQ ID NO: 13): 5′-TCGCCTTGTAGCTTCCATCG-3′;

[0093] Upstream primer for amplifying EF-1α gene (SEQ ID NO: 14): 5′-TAGCCTTGTGCCAATTTCCG-3′;

[0094] Downstream primer for amplifying EF-1α gene (SEQ ID NO: 15): 5'-CCTTCAGCATTACCGTCC-3'.

[0095] The reaction system is 20 μL, including TransStart ® Top Green qPCR Super Mix 10 μL, 1 μL cDNA, 0.4 μL upstream primer, 0.4 μL downstream primer, and the rest of the volume is ddHO 2 O. The reaction conditions were 94°C for 30 s; 94°C for 5 s, 60°C for 30 s, and 55°C for 60 s, for 40 cycles. The reaction was performed in a Quant Studio™ 1 Plus (Thermo Fisher Scientific, USA).

[0096] The results are as follows Figure 1 In the control group, BtSgAbd-2 The relative expression levels of BtSgAbd-2 In dsRNA-treated whiteflies, BtSgAbd-2 The expression level of BtSgAbd-2 The expression level of BtSgAbd-2 dsRNA silences endogenous BtSgAbd-2 Gene expression.

[0097] 4. Statistics on mortality and emergence rate

[0098] After the dsRNA / SPc preparation was dripped, the mortality of whitefly nymphs was counted every 2 days until the 6th day. The nymphs were kept until they emerged, and the emergence rate was counted.

[0099] Nymph mortality rate = number of dead individuals / initial number of individuals × 100%.

[0100] Emergence rate = number of emerged individuals / initial number of individuals × 100%.

[0101] The results are as follows Figure 2 As shown in A, in delivery BtSgAbd-2 The nymph mortality rates on the 2nd, 4th, and 6th days after dsRNA / SPc preparation were 43.43%, 56.83%, and 64.80%, respectively. EGFP There were significant differences in the corresponding days compared with the dsRNA / SPc control group. Since the nymphs of Bemisia tabaci attach to the leaves and do not move, the death characteristics are difficult to identify, so the statistics of the emergence rate are added to improve the accuracy. Figure 2 As shown in B, BtSgAbd-2 After dsRNA / SPc preparation, the emergence rate of whitefly nymphs was 37.50%, while the emergence rate of whitefly nymphs in the control group was 88.64%, which was consistent with the statistical results of nymph mortality. BtSgAbd-2The expression level of the gene can hinder the growth and development of whitefly, causing a large number of whitefly nymphs to die and a significant reduction in the emergence rate.

[0102] Example 3, matrine and BtSgAbd-2 Combination of dsRNA and SPc for the control of Bemisia tabaci

[0103] 3.1. Matrine LC 50 Determination of

[0104] To determine the median lethal concentration (LC) of matrine to whitefly nymphs 50 ), the third instar nymphs of Bemisia tabaci were treated with different concentrations of matrine by insect and leaf dipping method. Five matrine concentration gradients (625, 125, 25, 5, 1 mg / L) were set in the experiment. The mortality of Bemisia tabaci nymphs was counted every 2 days after application until the mortality rate remained unchanged. The LC of matrine on Bemisia tabaci was calculated using Poloplus 50 value, and obtain LC 50 The value is 88.48 mg / L.

[0105] 3.2. Matrine LC 50 Preparation of formulations

[0106] Weigh 4.4 mg of matrine into a 15 mL centrifuge tube, add 20 μL of Tween-80 (purchased from Macklin), make up to 10 mL of acetone as the mother liquor, then draw 450 μL of the mother liquor into a 50 mL centrifuge tube, make up to 50 mL with deionized water, and obtain the above matrine LC 50 solution for subsequent experiments.

[0107] The mother solution of the control group was 20 μL Tween-80, which was supplemented to 10 mL with acetone. 450 μL of the mother solution was pipetted into a 50 mL centrifuge tube and supplemented to 50 mL with deionized water to serve as the control solution.

[0108] 3.3、 BtSgAbd-2 Response to matrine stress

[0109] Cucumber leaves containing third-instar nymphs of Bemisia tabaci were immersed in the above-mentioned matrine LC 50 The solution and control solution were air-dried after 20 seconds. Each treatment was repeated 3 times, with at least 80 third-instar nymphs in each treatment.

[0110] After 24 h, 48 h, and 72 h of treatment, total RNA of whiteflies was extracted and detected by qPCR. BtSgAbd-2 The primers used were the same as those in Example 2.

[0111] The results are as follows Figure 3As shown in Figure 2, compared with the control group, the matrine-treated group had BtSgAbd-2 The gene expression levels increased by 6.744, 4.791, and 9.851 times, respectively, indicating that under matrine stress, Bemisia tabaci BtSgAbd-2 Increased gene expression.

[0112] 3.4、Matricine and BtSgAbd-2 Statistics of mortality and eclosion rate after dsRNA co-application

[0113] Use Matrine LC 50 The third instar nymphs of Bemisia tabaci were treated with the solution and insect-leaf dipping methods, and the leaves were dried before dsRNA / SPc treatment (the amount of dsRNA added to each nymph was 125 ng). After the combined treatment, the mortality rate and emergence rate were calculated according to the method in Example 2.

[0114] The results are as follows Figure 4 As shown in A, the mortality rates of whitefly nymphs were 59.72%, 78.42%, and 90.60% on the 2nd, 4th, and 6th days after the combined application of the two, respectively, with the highest mortality rate exceeding 90%. In contrast, the mortality rates of the treatment group treated with matrine alone were 12.88%, 23.10%, and 41.83% on the 2nd, 4th, and 6th days, respectively, which were significantly lower than the combined application. BtSgAbd-2 The mortality rate of dsRNA treatment was also significantly different compared with that of combined administration. Figure 4 As shown in Figure B, the nymph emergence rate of whitefly was 8.64% after the combination of the two, and 58.75% after matrine treatment. The above results show that compared with the single application of matrine or dsRNA, matrine and BtSgAbd-2 The combined treatment with dsRNA significantly increased the mortality of whitefly nymphs and reduced the emergence rate.

[0115] 3.5. Matrine and BtSgAbd-2 After co-administration of dsRNA BtSgAbd-2 Gene expression measurement

[0116] Matrine LC 50 Solution, EGFP dsRNA / SPc (the amount of EGFP dsRNA added to each worm is 125ng and BtSgAbd-2 dsRNA / SPc+Matrine (the amount of EGFP dsRNA added to each worm was 125 ng, and the concentration of matrine was LC 50 ) were used to treat whitefly nymphs. The surviving nymphs were collected 24 h and 48 h after treatment and divided into three groups to extract RNA for qPCR detection.

[0117] The results are as followsFigure 5 As shown, EGFP Compared with the dsRNA control group, treatment with matrine for 24 h resulted in BtSgAbd- 2 The gene expression level increased by 6.74 times, and after combined treatment BtSgAbd-2 The expression level dropped to 2.23 times. Similarly, after 48 hours of treatment, BtSgAbd-2 The expression level decreased from 4.79 to 0.87 times. This suggests that the combined use of the two may reduce BtSgAbd-2 Gene expression levels can be used to further increase the mortality of whiteflies.

[0118] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of double-stranded RNA molecules or biological materials related to the double-stranded RNA molecules, characterized in that: The double-stranded RNA molecule targets the BtSgAbd-2 Gene, BtSgAbd-2 The coding sequence of the gene is SEQ ID NO: 3, and the application is selected from at least one of B1) to B4): B1) Application in the control of whitefly; B2) Use in the preparation of products for controlling Bemisia tabaci; B3) Application in reducing the survival rate of whiteflies; B4) Use in the preparation of products for reducing the survival rate of whiteflies.

2. The use according to claim 1, characterized in that: The double-stranded RNA molecule consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is SEQ ID NO:

2.

3. The use according to claim 1, characterized in that: The biological material associated with the double-stranded RNA molecule is selected from at least one of A1) to A5): A1) a DNA molecule encoding the double-stranded RNA molecule; A2) an expression cassette containing the DNA molecule described in A1); A3) a recombinant vector containing the DNA molecule described in A1) or a recombinant vector containing the expression cassette described in A2); A4) a recombinant microorganism containing the DNA molecule described in A1) or a recombinant microorganism containing the expression cassette described in A2) or a recombinant microorganism containing the recombinant vector described in A3); A5) A transgenic cell line containing the DNA molecule described in A1) or a transgenic cell line containing the expression cassette described in A2) or a transgenic cell line containing the recombinant vector described in A3).

4. A method for reducing the survival rate of whiteflies, characterized in that: include: contacting the double-stranded RNA molecule with the whitefly, and reducing the survival rate of the whitefly after the double-stranded RNA molecule enters the body of the whitefly; The double-stranded RNA molecule targets the BtSgAbd-2 Gene, BtSgAbd-2 The coding sequence of the gene is SEQ ID NO:

3.

5. The method according to claim 4, characterized in that The double-stranded RNA molecule consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is SEQ ID NO:

2.

6. The method according to claim 4, characterized in that The method further comprises: mixing the double-stranded RNA molecule with a double-stranded RNA molecule delivery carrier and / or an insecticide and then contacting the mixture with Bemisia tabaci.

7. The method according to claim 6, characterized in that The double-stranded RNA molecule delivery carrier is a polymer carrier shown in Formula 1: ; In formula 1, R1 and R2 are each independently selected from H, CH3, CH2CH3 or CH2CH2CH3; n1, n2, n3, n4 are each independently 1-100.

8. The method according to claim 6, characterized in that The insecticide is matrine.

9. A method for preventing and controlling plants from being attacked by whiteflies, characterized in that: applying the double-stranded RNA molecule on the surface of the plant, and after the double-stranded RNA molecule contacts with the whitefly and enters the body of the whitefly, the plant is protected from being infested by the whitefly by reducing the survival rate of the whitefly; The double-stranded RNA molecule targets the BtSgAbd-2 Gene, BtSgAbd-2 The coding sequence of the gene is SEQ ID NO:

3.

10. The method according to claim 9, characterized in that The double-stranded RNA molecule consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is SEQ ID NO: 2.

Citation Information

Patent Citations

  • Star polymer as well as preparation method and application thereof

    CN108794710A