Application of MCT3 gene and encoded protein thereof in improving low-temperature stress resistance of rice

Abstract

The invention discloses an application of an MCT3 gene and an encoding protein thereof in improving low-temperature stress resistance of rice, relates to the technical field of gene engineering, and provides a novel rice gene MCT3, the MCT3 gene has the application of improving the cold resistance of the rice in the bud stage, and experiments prove that when the MCT3 gene is over-expressed, the cold resistance of the rice in the bud stage is improved; when the MCT3 gene is knocked out, the cold resistance of the rice in the bud stage is reduced. The MCT3 gene can be applied to the field of agriculture, the tolerance of rice to low-temperature stress is improved, and a candidate gene is provided for low-temperature-stress-resistant gene engineering.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to application of MCT3 gene and its encoded protein in improving the resistance of rice to low temperature stress. Background Art

[0002] MYB family transcription factors have a conserved MYB domain, and their protein structure includes a conserved MYB-DNA binding domain at the N-terminus and a diverse regulatory region at the C-terminus responsible for the regulatory activity of MYB proteins. Scientists have identified 183 genes encoding MYB proteins from the rice genome. These transcription factors are involved in the regulation of almost every stage of rice development. In addition, scientists have also found that MYB transcription factors play an important role in regulating rice's resistance to adverse stresses, such as drought stress, salt stress, cold stress, and high temperature stress.

[0003] With global climate change and the promotion of direct seeding technology, cold damage during the rice bud stage is becoming one of the key factors limiting the rice seedling rate. Studying the cold tolerance mechanism of rice buds and cultivating cold-tolerant rice varieties are the fundamental ways to solve the problem of low temperature cold damage during the rice bud stage. However, there are currently few successfully cloned cold tolerance genes for rice buds, which cannot meet the needs of breeding production. Summary of the invention

[0004] In view of the above-mentioned deficiencies in the prior art, the present invention provides an application of an MCT3 gene and its encoded protein in improving the resistance of rice to low temperature stress.

[0005] In order to achieve the above-mentioned object of the invention, the technical solution adopted by the present invention is:

[0006] Provided is a gene MCT3 for regulating rice resistance to low temperature stress, wherein the nucleotide sequence of the MCT3 gene is shown as SEQ ID No.1.

[0007] The MCT3 protein encoded by the above-mentioned gene MCT3 is provided, and the coding sequence of the MCT3 protein is shown in SEQ ID No.2.

[0008] Providing a primer pair for amplifying the MCT3 gene, the primer pair comprising an upstream primer MCT3-OE-F and a downstream primer MCT3-OE-R;

[0009] The nucleotide sequence of the upstream primer MCT3-OE-F is shown in SEQ ID NO.3;

[0010] The nucleotide sequence of the downstream primer MCT3-OE-R is shown in SEQ ID NO.4.

[0011] Provided is a kit for judging whether rice has the ability to resist low temperature stress. The kit comprises the above-mentioned primer pair and PCR amplification reagent.

[0012] Provide the application of MCT3 gene and its encoded protein in regulating the resistance of rice to low temperature stress, overexpress the MCT3 gene in rice, increase the expression amount or expression level of the MCT3 gene, or enhance the function or activity of the MCT3 protein, and improve the resistance of rice to low temperature stress;

[0013] The MCT3 gene in rice is mutated to reduce the expression of the MCT3 gene or to cause defects in the normal function of the MCT3 protein, thereby reducing the rice's ability to resist low temperature stress.

[0014] A method for cultivating a rice variety resistant to low temperature stress is provided, comprising the following steps:

[0015] S1: constructing a recombinant plant expression vector containing the MCT3 gene according to claim 1;

[0016] S2: transforming the constructed recombinant plant expression vector into recipient rice tissues or rice cells;

[0017] S3: Cultivate and screen transgenic rice with improved resistance to low temperature stress.

[0018] Furthermore, the recombinant plant expression vector is transformed into recipient rice tissues or rice cells by transferring the recombinant plant expression vector into Agrobacterium and then transfecting rice with the obtained Agrobacterium.

[0019] Furthermore, the specific steps of step S1 are as follows:

[0020] S11: reverse transcription of the plasmid containing the target gene to obtain cDNA containing the target gene;

[0021] S12: cDNA was used as a template for PCR amplification, and the primer pair MCT3-OE-F / R was used for amplification; the amplification system was:

[0022] 2×Phanta Max Mix 15μl cDNA template 5μl Primer MCT3-OE-F 2μl Primer MCT3-OE-R 2μl <![CDATA[ddH2O]]> 6μl

[0023] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles, and finally renaturation at 72°C for 5 min and storage at 4°C;

[0024] S13: Connect the PCR amplification product with the vector pCAMBIA1301 to obtain the recombinant vector OE-MCT3.

[0025] The beneficial effects of the present invention are:

[0026] The invention provides a novel rice gene MCT3. The MCT3 gene has the purpose of improving the cold tolerance of rice at the bud stage. Experiments have shown that when the MCT3 gene is overexpressed, the cold tolerance of rice at the bud stage is improved; when the MCT3 gene is knocked out, the cold tolerance of rice at the bud stage is reduced.

[0027] The MCT3 gene can be used in the agricultural field to improve rice's tolerance to low temperature stress and provide a candidate gene for genetic engineering of resistance to low temperature stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a diagram showing the cold-tolerant phenotype identification results of the transgenic knockout positive plants in Example 4;

[0029] Figure 2 This is a diagram showing the results of identifying the cold-tolerant phenotype of the transgenic positive plants overexpressing the gene in Example 4. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0031] Example 1 Construction of Rice MCT3 Gene Knockout Vector

[0032] In targetDesign, the CDS region of the MCT3 gene was screened, and sequences with high specificity, low off-target rate, and GC content of 50% to 70% were used as targets. The screened sgRNA target sequence was: 5'-CCGGTGGCAACT GGATCGCGCTC-3'. According to the sgRNA target sequence, specific primers U6aT1 and gRT1 were designed and generated; the sequence of primer U6aT1 was: 5'-GAGCGCGATCCAGTTGCCACCGGCGGCAGCCAAG CCAGCACC-3' (SEQ ID NO.7); the sequence of primer gRT1 was: 5'-CCGGTGGCAACT GGATCGCGCTCGTTTTAGAGCTAGAAATAG-3' (SEQ ID NO.8);

[0033] Using pYLgRNA-OsU6a plasmid as a template, universal primer UF and specific primer U6aT1 were used as primer pairs to amplify target fragment 1; at the same time, using pYLgRNA-OsU6a plasmid as a template, specific primer gRT1 and universal primer gR-R were used as primer pairs to amplify target fragment 2. The sequence of primer UF is: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO.9), and the sequence of primer gR-R is: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO.10);

[0034] Fragment 1 and fragment 2 were mixed together as templates, and amplified using universal primers U-GAL and Pgs-GAR to obtain fragment 3; the sequence of primer U-GAL was: 5'-ACCGGTAAGGCGCGCCGTA GTGCTCGACTAGTATGGAATCGGCAGCAAAGG-3' (SEQ ID NO.11); the sequence of primer Pgs-GAR was: 5'-TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCC ATCCACTCCAAGCTCTTG-3' (SEQ ID NO.12);

[0035] The reaction systems for both amplifications were:

[0036] 2×Phanta Max Mix 15μl template 5μl Primers 2μl Primers 2μl <![CDATA[ddH2O]]> 6μl

[0037] The amplification program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles, and finally renaturation at 72°C for 5 min and storage at 4°C.

[0038] The product of the second amplification was detected by 1.2% agarose gel electrophoresis, and the amplified band of about 600 bp was recovered from the gel. The vector CRISPR / Cas9 was digested with the restriction endonuclease Bsa I to obtain the digested vector. The linear vector fragment after digestion was recovered from the gel, and the purified fragment 3 was connected to the linear vector fragment with a homologous recombinase. The connection product was transferred into Escherichia coli DH5a for screening and sequencing, and the correctly sequenced recombinant vector was named KO-MCT3. The recombinant vector KO-MCT3 was transferred into Agrobacterium EHA105 to obtain Agrobacterium EHA105 containing the recombinant vector KO-MCT3, also known as Agrobacterium EHA105 / KO-MCT3.

[0039] Example 2 Construction of Rice MCT3 Gene Overexpression Vector

[0040] The primer pair MCT3-OE-F / R was designed according to the full-length CDS sequence of the MCT3 gene, and the restriction endonuclease BamH I and Sac I recognition sites and the vector homologous recombination fragment were introduced into both ends of the primers respectively.

[0041] The nucleotide sequence of primer MCT3-OE-F is 5'-TTCTGCAGGTCGACTCTAGAGGATC C ATGGGGAGGGCGCCGTGCTG-3' (SEQ ID NO. 3); wherein the underlined bases are the restriction endonuclease BamH I recognition site and the vector homologous recombination fragment;

[0042] The nucleotide sequence of primer MCT3-OE-R is 5'- GAGCGGCCGCCACCGCGGTGGAGC TC TCATGTCAGGCTGTGGCA-3' (SEQ ID NO. 4); wherein the underlined bases are the restriction endonuclease Sac I recognition site and the vector homologous recombination fragment;

[0043] Total RNA from leaves of Dongxiang wild rice introgression line D2 (this rice variety is recorded in “Zhao Qian, Preliminary Mapping of Cold Tolerance QTLs for Common Wild Rice in Dongxiang, Jiangxi Province at the Bud Stage, Master’s Thesis, 2015”, and is available to the public from the Rice Research Center, College of Agriculture, China Agricultural University) with 9311 background was extracted using TRIZOL reagent, and the RNA was used as a template for reverse transcription using SuperScript II reverse transcriptase (Invitrogen, Cat no. 18064-014) to obtain cDNA;

[0044] Using cDNA as a template, primers MCT3-OE-F and MCT3-OE-R were used to amplify cDNA to amplify the CDS sequence of rice MCT3 gene; the amplification system was:

[0045] 2×Phanta Max Mix 15μl cDNA template 5μl Primer MCT3-OE-F 2μl Primer MCT3-OE-R 2μl <![CDATA[ddH2O]]> 6μl

[0046] The PCR amplification program was as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles, and finally 72°C renaturation for 5 min, and stored at 4°C; the PCR product was detected by 1.2% agarose gel electrophoresis, and the amplified band of about 1000 bp was recovered by gel electrophoresis. The vector pCAMBIA1301 was double-digested with BamH I and Sac I enzymes to obtain the digested vector. The linear vector fragment after digestion was recovered by gel cutting, and the PCR purified product was connected to the linear vector fragment with homologous recombinase. The ligated product was transferred into Escherichia coli DH5a for screening and sequencing, and the correctly sequenced recombinant vector was named OE-MCT3. The recombinant vector OE-MCT3 was transferred into Agrobacterium EHA105 to obtain Agrobacterium EHA105 containing the recombinant vector OE-MCT3, also known as Agrobacterium EHA105 / OE-MCT3.

[0047] Example 3 Screening of rice ZH17 and recombinant MCT3 gene rice

[0048] Select the conventional japonica rice Zhonghua 17 (ZH17) for inoculation, and prepare its mature embryo callus, the specific steps are as follows:

[0049] ① Select unshelled rice seeds with no obvious bacterial spots on the seed surface and place them in a 42℃ oven for 2 days to break dormancy;

[0050] ② Use a thresher to remove the outer shell of rice seeds, select seeds with normal endosperm and no sterile spots on the surface and place them in a 100 mL Erlenmeyer flask;

[0051] ③ Add 75% alcohol to disinfect for 3 minutes, pour out the 75% alcohol, then add 20% sodium hypochlorite solution, shake and disinfect at 37℃ for 20 minutes;

[0052] ④ Pour away the sodium hypochlorite solution in the clean bench, rinse the seeds with sterilized deionized water for 5 to 6 times until the water is clear, and place them in a culture dish covered with 6 layers of sterile filter paper to dry;

[0053] ⑤ Place the dried seeds on the NB basic medium with a spoon, and use tweezers to evenly spread the seeds on the NB medium, about 30-50 seeds per dish; the formula of NB basic medium is shown in Table 1;

[0054] ⑥ Cultivate in a 28℃ constant temperature incubator in the dark for 7 days until light yellow callus grows out, peel off the induced callus and place it on NB basic medium (pH 5.85-6.0) to recover for 2 days to obtain mature embryo callus;

[0055] Table 1

[0056]

[0057] Agrobacterium EHA105 / KO-MCT3 and EHA105 / OE-MCT3 obtained in Example 1 and Example 2 were used to infect the mature embryo callus of the japonica rice variety ZH17 prepared above. Three rounds of screening were performed using NB medium containing 50 mg / L hygromycin, each round of screening was 20 days. In specific implementation, the screening time can be adjusted according to the state of the callus. After the screening, the resistant callus (dense, hard, large granular or blocky callus) was transferred to the pre-differentiation medium for culture for 10 days, and then transferred to the differentiation medium for differentiation for about 20 days. The differentiated seedlings were transferred to the rooting medium for culture for 10 to 15 days, and when they grew into seedlings, the knockout transgenic positive strains and the overexpression transgenic positive strains were obtained respectively.

[0058] The above transgenic strains were identified by PCR using hygromycin primer sequences and target gene fragment sequences, and 15 T0 generation knockout transgenic positive plants (obtained by infection with EHA105 / KO-MCT3) were obtained, which were named KO-MCT3-1 to 15, and 13 T0 generation overexpression transgenic positive plants (obtained by infection with EHA105 / OE-MCT3) were named OE-MCT3-1 to 13.

[0059] The primers for hygromycin PCR identification test are:

[0060] T.HYG-F: 5'-TACTTCTACACAGCCATC-3' (SEQ ID NO. 13);

[0061] T.HYG-R: 5'-CGTCTGTCGAGAAGTTTC-3' (SEQ ID NO. 14);

[0062] The primers for PCR identification of knockout transgenic positive plants are:

[0063] T.KO-MCT3-F: 5'-GACAAGGCGAGCGTGAAGAG-3' (SEQ ID NO. 15);

[0064] T.KO-MCT3-R: 5'-ATGATGGACCACCTGCGATT-3' (SEQ ID NO. 16);

[0065] Overexpressing transgenic plants, run on gel after PCR amplification, samples with double bands are positive strains, and primer pair T.OE-MCT3-F / R is used for detection:

[0066] T.OE-MCT3-F: 5'-CCCTCTACAACTCCATCGGA-3' (SEQ ID NO.5);

[0067] T.OE-MCT3-R: 5'-GGCGGCTGATGATGATGATG-3' (SEQ ID NO. 6).

[0068] Example 4 Identification of cold-tolerance phenotype of rice budding with recombinant MCT3 gene

[0069] The three knockout transgenic positive plants obtained in Example 3 were continuously self-pollinated to obtain seeds of T1 generation knockout transgenic positive plants, and the seeds of T1 generation homozygous knockout transgenic positive strains named KO-MCT3-1 (referred to as KO-MCT3-1 series seeds), the seeds of T1 generation homozygous knockout transgenic positive strains named KO-MCT3-2 (referred to as KO-MCT3-2 series seeds), and the seeds of T1 generation homozygous knockout transgenic positive strains named KO-MCT3-3 (referred to as KO-MCT3-3 series seeds) were used for subsequent experiments;

[0070] The three overexpression transgenic positive plants obtained in Example 3 were self-pollinated to obtain seeds of T1 generation overexpression transgenic positive plants, which were named as seeds of T1 generation overexpression transgenic positive strain OE-MCT3-1 (referred to as OE-MCT3-1 series seeds), seeds of T1 generation overexpression transgenic positive strain OE-MCT3-2 (referred to as OE-MCT3-2 series seeds), and seeds of T1 generation overexpression transgenic positive strain OE-MCT3-3 (referred to as OE-MCT3-3 series seeds) for subsequent experiments;

[0071] Take the plump seeds of KO-MCT3-1 series seeds, KO-MCT3-2 series seeds, KO-MCT3-3 series seeds, OE-MCT3-1 series seeds, OE-MCT3-2 series seeds, OE-MCT3-3 series seeds and the control ZH17, bake at 50℃ for 2 days to break dormancy; disinfect with 20% NaClO solution for 30 minutes, rinse with deionized water 3 to 5 times until there is no odor; incubate at 37℃ in a dark incubator The seeds were soaked and germinated for 2 days under the conditions, and the deionized water was replaced every day; the seeds were transferred to the culture medium with filter paper for light culture, and the amount of water added was more than 1 / 2 of the seeds. The seeds were cultured in the open air for 2 to 3 days to obtain KO-MCT3-1 series sprouts, KO-MCT3-2 series sprouts, KO-MCT3-3 series sprouts, OE-MCT3-1 series sprouts, OE-MCT3-2 series sprouts, OE-MCT3-3 series sprouts and control ZH17 sprouts;

[0072] Seeds with young sprouts about 3 mm long were treated with low temperature. 30 seeds were placed in each half of the culture dish, and the process was repeated 3 times. They were moved to a 4℃ low-temperature box for dark treatment for 14 days, and then placed in a 28℃ incubator to resume growth for 7 days. The survival rate was counted and its average value was calculated.

[0073] The results of low temperature treatment of knockout strains are as follows Figure 1 As shown, Figure 1 A is the comparison of the survival rate of each knockout strain and the control group. Figure 1 B is the macroscopic representation of each young shoot; the results of low temperature treatment of overexpression lines are as follows Figure 2 As shown, Figure 2 A is the comparison of the survival rate of each knockout strain and the control group. Figure 2 B is the macroscopic representation of each sprout; Figure 1 and Figure 2 It can be seen that after treatment at 4℃ for 14 days and recovery growth at 28℃ for 7 days, the viable seedling rates of the knockout strains KO-MCT3-1, KO-MCT3-2, and KO-MCT3-3 were significantly lower than those of the control ZH17; after treatment at 4℃ for 14 days and recovery growth at 28℃ for 7 days, the viable seedling rates of the overexpression strains OE-MCT3-1, OE-MCT3-2, and OE-MCT 3-3 were significantly higher than those of the control ZH17.

Claims

1. A gene MCT3 that regulates rice resistance to low temperature stress, characterized in that: The nucleotide sequence of the MCT3 gene is shown as SEQ ID No.

1.

2. The MCT3 protein encoded by the gene MCT3 according to claim 1, characterized in that: The coding sequence of the MCT3 protein is shown in SEQ ID No.

2.

3. A primer pair for amplifying the MCT3 gene according to claim 1, characterized in that: The primer pair includes an upstream primer MCT3-OE-F and a downstream primer MCT3-OE-R; The nucleotide sequence of the upstream primer MCT3-OE-F is shown in SEQ ID NO.3; The nucleotide sequence of the downstream primer MCT3-OE-R is shown in SEQ ID NO.

4.

4. A kit for determining whether rice has the ability to resist low temperature stress, characterized in that: The kit includes a detection primer pair T.OE-MCT3-F / R and a PCR amplification reagent; The nucleotide sequence of the primer T.OE-MCT3-F is shown in SEQ ID NO.5; The nucleotide sequence of the primer T.OE-MCT3-R is shown in SEQ ID NO.

6.

5. The application of MCT3 gene and its encoded protein in regulating rice resistance to low temperature stress, characterized in that: Overexpressing the MCT3 gene in rice to increase the expression amount or expression level of the MCT3 gene, or enhancing the function or activity of the MCT3 protein, thereby improving the resistance of rice to low temperature stress; The MCT3 gene in rice is mutated to reduce the expression of the MCT3 gene or to cause defects in the normal function of the MCT3 protein, thereby reducing the rice's ability to resist low temperature stress.

6. A method for cultivating a rice variety resistant to low temperature stress, characterized in that: The steps include: S1: constructing a recombinant plant expression vector containing the MCT3 gene according to claim 1; S2: transforming the constructed recombinant plant expression vector into recipient rice tissues or rice cells; S3: Cultivate and screen transgenic rice with improved resistance to low temperature stress.

7. The method according to claim 6, characterized in that The recombinant plant expression vector is transformed into recipient rice tissue or rice cell by transferring the recombinant plant expression vector into Agrobacterium and then transfecting rice with the obtained Agrobacterium to obtain the construct.

8. The method according to claim 6, characterized in that The specific steps of step S1 are as follows: S11: reverse transcription of the plasmid containing the target gene to obtain cDNA containing the target gene; S12: cDNA was used as a template for PCR amplification, and the primer pair MCT3-OE-F / R was used for amplification; the amplification system was: The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles, and finally renaturation at 72°C for 5 min and storage at 4°C; S13: Connect the PCR amplification product with the vector pCAMBIA1301 to obtain the recombinant vector OE-MCT3.

Images