Application of MCT3 gene and its encoding protein in improving rice resistance to low temperature stress

By constructing and expressing a recombinant vector of the MCT3 gene, the cold resistance of rice was regulated, solving the problem of the lack of cold-resistant genes in rice bud stage and achieving the effect of improving the cold resistance of rice bud stage.

CN119736316BActive Publication Date: 2026-04-24CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2025-02-18
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

There are few successfully cloned cold-resistant genes for rice budding stage in existing technologies, which cannot meet the needs of breeding and production. As a result, low temperature damage during the rice budding stage has become a key factor limiting the seedling rate.

Method used

By constructing and expressing recombinant plant expression vectors of the MCT3 gene, the expression level of the MCT3 gene can be increased or the function of the MCT3 protein can be enhanced, or the expression level of the MCT3 gene can be reduced by mutation to regulate the resistance of rice to low temperature stress.

Benefits of technology

Experiments have shown that overexpression of the MCT3 gene improves the cold tolerance of rice during the budding stage, while knockout of the MCT3 gene reduces the cold tolerance of rice during the budding stage, providing a genetic engineering method for breeding rice varieties resistant to low temperature stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736316B_ABST
    Figure CN119736316B_ABST
Patent Text Reader

Abstract

The application discloses an MCT3 gene and application of coded protein thereof in improving rice resistance to low-temperature stress, relates to the technical field of genetic engineering, and provides a new rice gene MCT3, the MCT3 gene has the purpose of improving the cold resistance of rice bud stage, and experiments prove that when the MCT3 gene is overexpressed, the cold resistance of rice bud stage is improved; when the MCT3 gene is knocked out, the cold resistance of rice bud stage is reduced. The MCT3 gene can be applied to the agricultural field, improve the tolerance of rice to low-temperature stress, and provide a candidate gene for genetic engineering of low-temperature stress resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the application of the MCT3 gene and its encoded protein in improving the resistance of rice to low-temperature stress. Background Technology

[0002] MYB family transcription factors possess a conserved MYB domain. Their protein structures include a conserved N-terminal MYB-DNA binding domain and a diverse C-terminal regulatory region responsible for regulating MYB protein activity. Scientists have identified 183 genes encoding MYB proteins in the rice genome. These transcription factors are involved in the regulation of almost every stage of rice development. Furthermore, scientists have discovered that MYB transcription factors play a crucial role in regulating rice's resistance to abiotic stresses, such as drought, salt, cold, and high-temperature stress.

[0003] With global climate change and the promotion of direct seeding technology for rice, chilling injury during the rice germination stage is becoming one of the key factors limiting rice seedling survival rates. Studying the mechanism of cold tolerance during the rice germination stage and breeding cold-resistant rice varieties are fundamental ways to solve the problem of low-temperature chilling injury during this period. However, currently, very few cold-resistant genes for rice germination have been successfully cloned, which cannot meet the needs of breeding and production. Summary of the Invention

[0004] To address the aforementioned shortcomings of existing technologies, this invention provides an application of the MCT3 gene and its encoded protein in improving the resistance of rice to low-temperature stress.

[0005] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0006] The gene MCT3, which regulates rice resistance to low temperature stress, is provided. The nucleotide sequence of the MCT3 gene is shown in SEQ ID No. 1.

[0007] The MCT3 protein encoded by the aforementioned gene MCT3 is provided, and the coding sequence of the MCT3 protein is shown in SEQ ID No. 2.

[0008] Primer pairs for amplifying the MCT3 gene are provided, including upstream primer MCT3-OE-F and downstream primer MCT3-OE-R;

[0009] The nucleotide sequence of the upstream primer MCT3-OE-F is shown in SEQ ID NO.3;

[0010] The nucleotide sequence of the downstream primer MCT3-OE-R is shown in SEQ ID NO.4.

[0011] A kit for determining whether rice has the ability to resist low temperature stress is provided. The kit includes the primer pairs and PCR amplification reagents mentioned above.

[0012] This study aims to provide applications of the MCT3 gene and its encoded protein in regulating rice resistance to low-temperature stress by overexpressing the MCT3 gene in rice, increasing the expression level of the MCT3 gene, or enhancing the function or activity of the MCT3 protein, thereby improving the rice's resistance to low-temperature stress.

[0013] Mutating the MCT3 gene in rice can reduce its expression or impair the normal function of the MCT3 protein, thereby reducing the rice's resistance to low-temperature stress.

[0014] A method for breeding rice varieties resistant to low-temperature stress is provided, comprising the following steps:

[0015] S1: Construct a recombinant plant expression vector containing the MCT3 gene as described in claim 1;

[0016] S2: Transform the constructed recombinant plant expression vector into recipient rice tissues or rice cells;

[0017] S3: Breed and screen transgenic rice with improved resistance to low temperature stress.

[0018] Furthermore, the recombinant plant expression vector is transformed into recipient rice tissues or rice cells by transferring the recombinant plant expression vector into Agrobacterium, and then transfecting rice with the obtained Agrobacterium to construct the vector.

[0019] Furthermore, the specific steps of step S1 are as follows:

[0020] S11: Reverse transcribe the plasmid containing the target gene to obtain cDNA containing the target gene;

[0021] S12: PCR amplification was performed using cDNA as a template, employing primer pair MCT3-OE-F / R; the amplification system was as follows:

[0022] 2×Phanta Max Mix 15μl cDNA template 5μl Primer MCT3-OE-F 2μl Primer MCT3-OE-R 2μl <![CDATA[ddH2O]]> 6μl

[0023] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and finally annealing at 72℃ for 5 min, and stored at 4℃.

[0024] S13: The PCR amplification product was ligated with the vector pCAMBIA1301 to obtain the recombinant vector OE-MCT3.

[0025] The beneficial effects of this invention are as follows:

[0026] This invention proposes a new rice gene, MCT3, which can improve the cold tolerance of rice during the budding stage. Experiments have shown that overexpression of the MCT3 gene increases the cold tolerance of rice during the budding stage, while knockout of the MCT3 gene decreases the cold tolerance of rice during the budding stage.

[0027] The MCT3 gene can be applied in agriculture to improve rice's tolerance to low-temperature stress and provides a candidate gene for low-temperature stress resistance genetic engineering. Attached Figure Description

[0028] Figure 1 This is a diagram showing the results of cold-resistant phenotype identification in transgenic positive plants from Example 4.

[0029] Figure 2 This is a diagram showing the results of identifying the cold-resistant phenotype of positive transgenic plants overexpressing in Example 4. Detailed Implementation

[0030] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0031] Example 1: Construction of rice MCT3 gene knockout vector

[0032] In targetDesign, sequences with high specificity, low off-target rate, and GC content of 50%–70% in the CDS region of the MCT3 gene were screened as target sites. The selected sgRNA target sequence was 5'-CCGGTGGCAACT GGATCGCGCTC-3'. Based on the sgRNA target sequence, specific primers U6aT1 and gRT1 were designed and generated. The sequence of primer U6aT1 is 5'-GAGCGCGATCCAGTTGCCACCGGCGGCAGCCAAG CCAGCACC-3' (SEQ ID NO.7); the sequence of primer gRT1 is 5'-CCGGTGGCAACT GGATCGCGCTCGTTTTAGAGCTAGAAATAG-3' (SEQ ID NO.8).

[0033] Using pYLgRNA-OsU6a plasmid as a template, target fragment 1 was amplified using universal primer UF and specific primer U6aT1. Simultaneously, using pYLgRNA-OsU6a plasmid as a template, target fragment 2 was amplified using specific primer gRT1 and universal primer gR-R. The sequence of primer UF is 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO. 9), and the sequence of primer gR-R is 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO. 10).

[0034] Fragment 1 and fragment 2 were mixed together as a template and amplified using universal primers U-GAL and Pgs-GAR to obtain fragment 3; the U-GAL primer sequence is: 5'-ACCGGTAAGGCGCGCCGTA GTGCTCGACTAGTATGGAATCGGCAGCAAAGG-3' (SEQ ID NO.11); the Pgs-GAR primer sequence is: 5'-TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCC ATCCACTCCAAGCTCTTG-3' (SEQ ID NO.12);

[0035] The reaction systems for both amplifications were:

[0036] 2×Phanta Max Mix 15μl template 5μl Primers 2μl Primers 2μl <![CDATA[ddH2O]]> 6μl

[0037] The amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and finally annealing at 72℃ for 5 min, and stored at 4℃.

[0038] The product from the second amplification was detected by 1.2% agarose gel electrophoresis, and the amplified band of approximately 600 bp was recovered from the gel. The CRISPR / Cas9 vector was digested with the restriction endonuclease Bsa I to obtain the digested vector. The linear vector fragment after digestion was recovered from the gel, and the purified fragment 3 was ligated to the linear vector fragment using a homologous recombinase. The ligation product was transformed into *E. coli* DH5α for screening and sequencing. The recombinant vector with correct sequencing was named KO-MCT3. The recombinant vector KO-MCT3 was transformed into *Agrobacterium* EHA105 to obtain *Agrobacterium* EHA105 containing the recombinant vector KO-MCT3, also known as *Agrobacterium* EHA105 / KO-MCT3.

[0039] Example 2: Construction of rice MCT3 gene overexpression vector

[0040] Primer pair MCT3-OE-F / R was designed based on the full-length CDS sequence of the MCT3 gene. Restriction endonuclease BamHI and SacI recognition sites and vector homologous recombination fragments were introduced at both ends of the primers, respectively.

[0041] The nucleotide sequence of primer MCT3-OE-F is 5'-TTCTGCAGGTCGACTCTAGAGGATC C ATGGGGAGGGCGCCGTGCTG-3'(SEQ ID NO.3); where the underlined bases are the homologous recombination fragments of the restriction endonuclease BamHI recognition site and the vector;

[0042] The nucleotide sequence of primer MCT3-OE-R is 5'- GAGCGGCCGCCACCGCGGTGGAGC TC TCATGTCAGGCTGTGGCA-3'(SEQ ID NO.4); where the underlined bases are the homologous recombination fragments of the vector at the restriction endonuclease Sac I recognition site;

[0043] Total RNA was extracted from leaves of the Dongxiang wild rice introgression line D2 (this rice variety is recorded in "Zhao Qian, Preliminary mapping of QTLs for cold tolerance during budding stage in common wild rice in Dongxiang, Jiangxi, Master's thesis, 2015", which can be obtained from the Rice Research Center of the College of Agriculture, China Agricultural University) using TRIZOL reagent. Using this RNA as a template, cDNA was obtained by reverse transcription using SuperScript II reverse transcriptase (Invitrogen, Cat no. 18064-014).

[0044] Using cDNA as a template, primers MCT3-OE-F and MCT3-OE-R were used to amplify the cDNA and amplify the CDS sequence of the rice MCT3 gene; the amplification system was as follows:

[0045] 2×Phanta Max Mix 15μl cDNA template 5μl Primer MCT3-OE-F 2μl Primer MCT3-OE-R 2μl <![CDATA[ddH2O]]> 6μl

[0046] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, followed by annealing at 72℃ for 5 min, and storage at 4℃. The PCR products were detected by 1.2% agarose gel electrophoresis, and the amplified band of approximately 1000 bp was recovered from the gel. The vector pCAMBIA1301 was double-digested with BamHI and SacI enzymes to obtain the digested vector. The linear vector fragment was recovered from the gel, and the purified PCR product was ligated to the linear vector fragment using homologous recombinase. The ligation product was transformed into *E. coli* DH5α for screening and sequencing. The recombinant vector with correct sequencing was named OE-MCT3. The recombinant vector OE-MCT3 was transformed into *Agrobacterium* EHA105 to obtain *Agrobacterium* EHA105 containing the recombinant vector OE-MCT3, also known as *Agrobacterium* EHA105 / OE-MCT3.

[0047] Example 3: Screening of rice infected with ZH17 and recombinant MCT3 genes

[0048] The conventional japonica rice variety Zhonghua 17 (ZH17) was selected for inoculation to prepare mature embryo callus tissue. The specific steps are as follows:

[0049] ① Select unopened rice seeds with no obvious fungal spots on the seed surface and place them in a 42℃ oven for 2 days to break dormancy;

[0050] ② Remove the outer shell of the rice seeds using a threshing machine, and select seeds with normal endosperm and no bacterial spots on the surface and place them in a 100mL Erlenmeyer flask;

[0051] ③ Add 75% alcohol for 3 minutes to disinfect, then discard the 75% alcohol. Next, add 20% sodium hypochlorite solution and shake in a 37°C incubator for 20 minutes to disinfect.

[0052] ④ In the laminar flow hood, pour out the sodium hypochlorite solution, rinse the seeds 5-6 times with sterile deionized water until the water used to wash the seeds is relatively clear, and place them in a petri dish lined with 6 layers of sterile filter paper to air dry.

[0053] ⑤ Place the dried seeds on the NB basic culture medium with a spoon, and spread the seeds evenly on the NB culture medium with tweezers, about 30-50 seeds per dish; the formula of NB basic culture medium is shown in Table 1.

[0054] ⑥ Cultured in the dark in a constant temperature incubator at 28℃ for 7 days until pale yellow callus tissue grows. Peel off the induced callus and place it on NB basic medium (pH 5.85~6.0) to recover for 2 days to obtain mature embryo callus tissue.

[0055] Table 1

[0056]

[0057] Mature embryo callus tissue of the japonica rice variety ZH17 prepared above was individually infected with Agrobacterium EHA105 / KO-MCT3 and EHA105 / OE-MCT3 obtained in Examples 1 and 2, respectively. Three rounds of screening were performed using NB medium containing 50 mg / L hygromycin, with each round lasting 20 days. The screening time could be adjusted according to the state of the callus tissue. After screening, resistant callus (dense, hard, large granular, or blocky callus tissue) was transferred to pre-differentiation medium and cultured for 10 days, then transferred to differentiation medium for approximately 20 days of differentiation. The differentiated seedlings were then transferred to rooting medium and cultured for 10–15 days until they grew into seedlings. Knockout transgenic positive lines and overexpression transgenic positive lines were obtained, respectively.

[0058] The above transgenic lines were identified by PCR using hygromycin primer sequences and target gene fragment sequences. Fifteen T0 generation knockout transgenic positive plants (obtained by EHA105 / KO-MCT3 infection) were named KO-MCT3-1 to 15, respectively; and thirteen T0 generation overexpression transgenic positive plants (obtained by EHA105 / OE-MCT3 infection) were named OE-MCT3-1 to 13, respectively.

[0059] The primers for hygromycin PCR identification and detection are:

[0060] T.HYG-F: 5'-TACTTCTACACAGCCATC-3' (SEQ ID NO. 13);

[0061] T.HYG-R: 5'-CGTCTGTCGAGAAGTTTC-3' (SEQ ID NO. 14);

[0062] The primers for PCR identification of knockout transgenic positive plants are:

[0063] T.KO-MCT3-F: 5'-GACAAGGCGAGCGTGAAGAG-3' (SEQ ID NO. 15);

[0064] T.KO-MCT3-R: 5'-ATGATGGACCACCTGCGATT-3' (SEQ ID NO. 16);

[0065] Transgenic plants overexpressing the gene were amplified by PCR and then run on a gel electrophoresis gel. Samples showing two bands were considered positive. The T.OE-MCT3-F / R primer pair was used for detection.

[0066] T.OE-MCT3-F: 5'-CCCTCTACAACTCCATCGGA-3' (SEQ ID NO.5);

[0067] T.OE-MCT3-R: 5'-GGCGGCTGATGATGATGATG-3' (SEQ ID NO. 6).

[0068] Example 4: Identification of cold-resistant phenotype in rice seedlings using the recombinant MCT3 gene

[0069] Three knockout transgenic positive plants obtained in Example 3 were continuously self-crossed to obtain seeds of T1 generation knockout transgenic positive plants. Seeds of T1 generation homozygous knockout transgenic positive lines named KO-MCT3-1 (hereinafter referred to as KO-MCT3-1 line seeds), T1 generation homozygous knockout transgenic positive lines named KO-MCT3-2 (hereinafter referred to as KO-MCT3-2 line seeds), and T1 generation homozygous knockout transgenic positive lines named KO-MCT3-3 (hereinafter referred to as KO-MCT3-3 line seeds) were used for subsequent experiments.

[0070] Three positive overexpression transgenic plants obtained in Example 3 were self-crossed to obtain seeds of T1 generation positive overexpression transgenic plants. These seeds were named OE-MCT3-1 (abbreviated as OE-MCT3-1 line seeds), OE-MCT3-2 (abbreviated as OE-MCT3-2 line seeds), and OE-MCT3-3 (abbreviated as OE-MCT3-3 line seeds) for subsequent experiments.

[0071] Take plump seeds from the KO-MCT3-1, KO-MCT3-2, KO-MCT3-3, OE-MCT3-1, OE-MCT3-2, OE-MCT3-3 lines, and control ZH17, and bake at 50℃ for 2 days to break dormancy; sterilize with 20% NaClO solution for 30 minutes, rinse 3-5 times with deionized water until there is no odor; incubate in a dark incubator at 37℃. Soak seeds under the following conditions for 2 days to promote germination, changing the deionized water daily; transfer the seeds to a culture medium lined with filter paper and cultivate under light, adding water to cover half of the seeds, and cultivate for 2-3 days until the seeds show white sprouts, obtaining KO-MCT3-1, KO-MCT3-2, KO-MCT3-3, OE-MCT3-1, OE-MCT3-2, OE-MCT3-3 and control ZH17 sprouts;

[0072] Seeds with sprouts about 3 mm in length were subjected to low-temperature treatment. 30 seeds were placed in each half-petal, and the treatment was repeated 3 times. The seeds were then placed in a 4℃ low-temperature incubator for 14 days in the dark, and then placed in a 28℃ incubator to recover growth for 7 days. The survival rate was counted and the average value was calculated.

[0073] The results of low-temperature treatment of the knockout strains are as follows Figure 1 As shown, where, Figure 1 A shows the comparison of the survival rate of each knockout line and the control group. Figure 1 B represents the macroscopic characteristics of each young shoot; the results of low-temperature treatment of the overexpression lines are as follows: Figure 2 As shown, where, Figure 2 A shows the comparison of the survival rate of each knockout line and the control group. Figure 2 B represents the macroscopic characteristics of each bud; by Figure 1 and Figure 2 It was found that after treatment at 4℃ for 14 days and recovery at 28℃ for 7 days, the survival rate of the knockout lines KO-MCT3-1, KO-MCT3-2, and KO-MCT3-3 was significantly lower than that of the control ZH17; after treatment at 4℃ for 14 days and recovery at 28℃ for 7 days, the survival rate of the overexpression lines OE-MCT3-1, OE-MCT3-2, and OE-MCT 3-3 was significantly higher than that of the control ZH17.

Claims

1. MCT3 The application of genes and their encoded proteins in regulating rice germination stage resistance to low temperature stress is characterized by, As shown in SEQ ID NO.1 MCT3 The gene was overexpressed in rice, increasing MCT3 Increasing gene expression levels enhances rice's resistance to low-temperature stress.

2. A method for cultivating rice varieties resistant to low-temperature stress during the germination stage, characterized in that, Includes the following steps: S1: Construct a system containing the structure shown in SEQ ID NO.1 MCT3 Recombinant plant expression vectors for genes; S2: Transform the constructed recombinant plant expression vector into recipient rice tissues or rice cells; S3: Transgenic rice with improved resistance to low temperature stress during the budding stage was obtained through breeding and screening.

3. The method according to claim 2, characterized in that, The recombinant plant expression vector is transformed into recipient rice tissues or rice cells by transferring the recombinant plant expression vector into Agrobacterium, and then transfecting rice with the resulting Agrobacterium to construct the vector.

4. The method according to claim 2, characterized in that, The specific steps of step S1 are as follows: S11: Reverse transcribe the plasmid containing the target gene to obtain cDNA containing the target gene; S12: PCR amplification was performed using cDNA as a template, employing primer pairs. MCT3 -OE-F / R; the amplification system is: The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and finally annealing at 72℃ for 5 min, and stored at 4℃. S13: The PCR amplification product was ligated with the vector pCAMBIA1301 to obtain the recombinant vector OE- MCT3 .

Citation Information

Patent Citations

  • RGN1 protein related to grain number per spike of rice and coding gene and application thereof

    CN111499709A