Method for improving biomass of brassica napus through BnaA01. JAM3 gene overexpression and application

Abstract

The invention relates to the technical field of plant genetic engineering application, in particular to a method for improving the biomass of brassica napus through BnaA01. JAM3 gene overexpression and application. The method comprises the following steps: cloning a gene sequence of BnaA01. JAM3 in a brassica napus selfing line 'K407'; the sequence is over-expressed in a wild type 'K407' by using a transgenic technology. Compared with receptor oilseed rape, the transgenic line has the advantages that overexpression of the BnA01. JAM3 obviously improves the true leaf fresh weight of the receptor oilseed rape and increases the biomass accumulation of the oilseed rape. Meanwhile, indexes such as the euphylla surface area, the total root length, the main root length, the root surface area and the root volume of the overexpressed plant are also remarkably increased. In addition, content analysis of endogenous jasmonic acid (JA) shows that the content of endogenous JA in the overexpressed strain is remarkably reduced. The rape BnaA01. JAM3 gene disclosed by the invention provides a new excellent gene resource for molecular design breeding, and has a good application prospect in the aspect of biomass synthesis of oil crops.

Description

Technical Field

[0001] The patent of this invention relates to the field of plant genetic engineering application technology, specifically, to a method and application of increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene. Background Art

[0002] Rapeseed is a crop of the genus Brassica in the family Cruciferae. It can be divided into three categories based on chromosome composition and genetic background, namely Brassica rapa L., AA, 2n=2x=20, Brassica napus L., AACC, 2n=2x=38 and Brassica juncea L., AABB, 2n=2x=36. Brassica napus is named for its leaf morphology and growth environment, which are similar to those of cabbage. Brassica napus was introduced to my country in the 1830s. Due to its advantages in seed yield and high oil content, it has gradually replaced the production status of Brassica rapeseed and Brassica juncea. At present, the planting area of ​​Brassica rapeseed in my country accounts for about 80% of the total rapeseed planting area, and it is the main cultivated variety in some parts of my country. As the largest oil crop in my country, rapeseed is the largest source of domestic edible vegetable oil. The high-quality edible oil it provides each year accounts for more than 50% of the domestic oil crop output, and it is the core of maintaining the security of the country's edible oil supply. At the same time, rapeseed provides about 8 million tons of high-protein rapeseed meal for my country's animal husbandry industry each year. In addition, rapeseed has multiple functions such as vegetable, nectar source, sightseeing, and fertilizer, and occupies an important position in meeting people's health needs.

[0003] The biomass of rapeseed is of multiple importance to agricultural economy and ecological balance. The biomass of rapeseed is directly related to its oil production and is a key indicator for measuring the production efficiency of rapeseed. High biomass means more oil output, which plays an important role in improving agricultural economic benefits and ensuring the supply of edible oil. As a deep-rooted crop, rapeseed has a well-developed root system that can effectively fix the soil and reduce soil erosion. In addition, rapeseed can improve soil structure, increase soil organic matter content, and improve soil fertility during its growth. Increasing biomass is essential for improving the sustainable utilization of soil and the stability of crop rotation systems. Rapeseed can absorb heavy metals in the soil, such as cadmium and lead, and reduce soil pollution through plant remediation technology, which is of great significance to environmental protection and human health. As a vegetable, rapeseed has the effects of lowering blood lipids, detoxifying and reducing swelling, widening the intestines and promoting bowel movements, and strengthening the body. Increasing its biomass can increase its vegetable value. Therefore, increasing the biomass of rapeseed is of great significance in promoting sustainable agricultural development, protecting the environment, and maintaining human health.

[0004] JAM3 is a basic helix-loop-helix transcription factor (bHLH transcription factor). Studies have found that bHLH transcription factor subfamily IIId members bHLH3, bHLH13, bHLH14 and bHLH17 play a negative regulatory role in the jasmonic acid signal transduction pathway as new targets of JAZ. Subfamily IIId members have redundant functions in negatively regulating JA responses. Members of the IIId subfamily can also interact with JAZ and inhibit JA responses. In addition, members of the IIId subfamily also act downstream of the jasmonic acid signal receptor protein COI1, inhibiting different JA responses by antagonizing different transcriptional activators. Although researchers have isolated the BnJAM3 gene from a variety of plants, the function of BnJAM3 in regulating rapeseed biomass accumulation and jasmonic acid synthesis is still unclear.

[0005] Therefore, exploring the function of BnJAM3 in biomass accumulation and jasmonic acid synthesis in Brassica napus is of great significance for analyzing the regulatory mechanism of plant biomass accumulation and jasmonic acid synthesis and cultivating new varieties of high-biomass rapeseed.

[0006] To this end, the present application provides a method and application for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene, in order to solve the problems of the prior art. Summary of the invention

[0007] The purpose of the present invention is to provide a method and application of increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene, so as to provide valuable gene resources and theoretical basis for rapeseed breeding.

[0008] The above-mentioned purpose of the present invention is achieved like this:

[0009] The scheme of the present invention provides a method for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene, the method comprising: introducing a 35S:BnaA01.JAM3-6HA overexpression vector into the Brassica napus inbred line 'K407' based on the Agrobacterium-mediated hypocotyl genetic transformation method; obtaining more than 10 T1 generation positive transgenic plants from the transformed offspring of each vector through hygromycin resistance screening and PCR identification; and obtaining a T3 generation homozygous transgenic strain through self-pollination, specifically comprising the following steps:

[0010] S1. Acquisition and vector construction of rapeseed gene BnJAM3:

[0011] S1-1. Acquisition of rapeseed gene BnJAM3:

[0012] The nucleotide and protein sequences of the BnaA01.JAM3 gene of Brassica napus were retrieved using the BnPIR database, and the Primer-BLAST online tool of the NCBI database was used to design specific amplification primers for each gene, and vector-specific homology arm sequences were added to the 5′ end of the primers used for constructing plant expression vectors.

[0013] Cloning and vector construction of S1-2 and BnJAM3 genes:

[0014] (1) Cloning of BnaA01.BnJAM3: Total RNA from different tissues of wild-type 'K407' was extracted using the SteadyPure Plant RNA Extraction Kit. One-Step gDNA Removal and cDNA Synthesis SuperMix reverse transcription kit was used to synthesize cDNA; specific primers were designed based on the CDS sequence of the BnaA01.JAM3 gene; wild-type 'K407' cDNA was used as a template and high-fidelity enzymes were used to amplify the target fragment by PCR;

[0015] (2) The plant expression vector pCAMBIA1300-35s-6HA was double-digested with restriction endonucleases in a 37°C water bath for 5 to 6 hours, and the purified target fragment and the linearized vector after restriction digestion were mixed and connected at a molar ratio of 3:1, and reacted at 37°C for 30 minutes to complete the recombination of the target fragment and the linearized vector;

[0016] (3) Extract the recombinant plasmid and place 500 μL of the bacterial solution with the sequence consistent with the target fragment in a pre-filled 8 mL 50 μg / mL Kan + After the culture was expanded in a shaking tube of LB culture solution, plasmid extraction was performed according to the plasmid extraction kit to obtain the 35S:BnaA01.JAM3-6HA overexpression vector;

[0017] S2. Acquisition, screening and identification of transgenic plants:

[0018] S2-1. Obtaining transgenic plants:

[0019] After pre-culturing the Agrobacterium containing the recombinant plasmid with the explants, the positive seedlings after hygromycin selection, differentiation and rooting were defined as T1 transgenic plants;

[0020] S2-2. Screening and identification of transgenic plants:

[0021] The genomic DNA of young rapeseed leaves was extracted using a plant genomic DNA extraction kit;

[0022] First, the T1 generation overexpressing transgenic plants were used to identify the presence of the target gene by PCR, and the transcription level of the target gene was detected at the same time;

[0023] Then, six T1 positive seedlings with higher transcription levels are selected for further sowing and planting until all the offspring seedlings of a certain T2 generation offspring are identified to contain the target gene fragment. At this time, the seeds harvested from the offspring of the single plant are T3 generation homozygous seeds.

[0024] Furthermore, the primers and sequences in step S1-2 are:

[0025] 35S:BnaA01.JAM3–6HA-KpnⅠ-F:

[0026] TCTAGAGGATCCCCGGGTACCATGGGTCAAAAGTTCTGGGAC;

[0027] 35S:BnaA01.JAM3–6HA-SpeⅠ-R:

[0028] GTATGGGTAACTAGAACTAGTCTGTGCGAGAGAGGTGAGGAG;

[0029] P1300-F: GTCACTTTATTGTGAAGATAGTGG;

[0030] P1300-R: AGTTTGCGCGCTATATTTTGTT.

[0031] Furthermore, the PCR reaction system for amplifying the target fragment in S1-2 is shown in the following table:

[0032]

[0033] ;

[0034] The PCR reaction conditions for amplifying the target fragment are shown in the following table:

[0035]

[0036] After the reaction is completed, agarose gel electrophoresis is performed to determine whether the size of the target gene is correct based on the DNA marker; and the band of the correct size is quickly cut out of the gel.

[0037] Another aspect of the present invention provides a method for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene and its application in breeding new varieties of high-biomass rapeseed.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] The method of the present invention clones the gene sequence of BnaA01.JAM3 in the inbred line 'K407' of Brassica napus, and over-expresses the sequence in the wild type 'K407' by using transgenic technology. Compared with the recipient rapeseed, the over-expression of BnA01.JAM3 in the transgenic strain significantly increases the fresh weight of the true leaves of the recipient rapeseed and increases the accumulation of rapeseed biomass; at the same time, the true leaf surface area, total root length, main root length, root surface area, root volume and other indicators of the over-expressed plant are also significantly increased; in addition, analysis of the endogenous jasmonic acid (JA) content shows that the endogenous JA content in the over-expressed strain is significantly reduced; the rapeseed BnaA01.JAM3 gene provided by the method of the present invention provides a new excellent gene resource for molecular design breeding, and has good application prospects in the biomass synthesis of oil crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Figure 2 is the creation, screening and identification process of the overexpression material K40735S:BnaA01.JAM3-6HA (A is the schematic diagram of the structure of the BnaA01.JAM3 gene in the binary overexpression vector P1300-2×35S for plant transformation, RB represents the right border; LB represents the left border; 35S-pro represents the 35S strong promoter; NOS-pro represents the promoter; NOS-ter represents the nopaline synthase gene terminator; Hygrmycin represents hygromycin; B is the PCR identification of the K40735S:BnaA01.JAM3-6HA transgenic plants using specific primers, Cas represents the plasmid, i.e., the positive control (35S:BnaA01.JAM 3-6HA overexpression vector), wild type 'K407' is a negative control; C is the expression of BnaA01.JAM3 in the transgenic plant K40735S:BnaA01.JAM3-6HA analyzed by fluorescence quantitative PCR technology; D is the expression of BnaA01.JAM3 in the transgenic plant K40735S:BnaA01.JAM3-6HA at the protein level using plant tissue protein extraction and protein immunoblotting technology (Western blot). We selected K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2 with higher expression levels for subsequent experiments);

[0041] Figure 2The phenotypic effects of the BnaA01.JAM3 gene on the growth and development of true leaves and roots of rapeseed (A is the plant type and true leaf phenotype of the wild type 'K407' and the overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2; B is the statistical data of the wild type 'K407' and the overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2 in true leaf length, true leaf width, true leaf surface area and true leaf fresh weight; C is the statistical data of the wild type 'K407' and the overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2 in true leaf length, true leaf width, true leaf surface area and true leaf fresh weight. 1. Root scanning of JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2; D is the statistical data of total root length and taproot length of wild type 'K407' and overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2; E is the statistical data of root surface area and root volume of wild type 'K407' and overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2; F is the statistical data of root surface area and root volume of wild type 'K407' and overexpression transgenic lines K407 Data statistics of root tip number and root branch number of 35S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2);

[0042] Figure 3 The data of jasmonic acid content in wild type 'K407' and overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2 are statistically shown. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0044] First of all, it should be noted that in the following examples, the reagents used are all from commercial channels unless otherwise specified, and the test methods, detection methods, etc. involved, unless otherwise specified, are all conventional test methods and detection methods already available in the prior art.

[0045] The following combination Figure 1-Figure 3 The implementation of the present invention is described in detail with reference to the accompanying drawings and specific embodiments.

[0046] Example: The embodiment of the present invention provides a method and application of increasing the biomass of Brassica napus by overexpression of the BnaA01.JAM3 gene. The present invention introduces the 35S:BnaA01.JAM3-6HA overexpression vector into the Brassica napus inbred line 'K407' based on the Agrobacterium-mediated hypocotyl genetic transformation method. Through hygromycin resistance screening and PCR identification, more than 10 T1 generation positive transgenic plants were obtained from the transformed offspring of each vector. And the T3 generation homozygous transgenic strains were obtained by self-breeding. Then, the DNA level and protein level were identified again, and the homozygous strains with significantly higher expression levels than the wild type 'K407' were selected for phenotypic observation.

[0047] Firstly, the true leaf length, true leaf width, true leaf surface area and true leaf fresh weight of the overexpression line K40735S:BnaA01.JAM3-6HA and the wild type 'K407' were measured and compared. It was found that all the values ​​of the overexpression line were significantly higher than those of the wild type, indicating that BnaA01.JAM3 promotes the growth and development of rapeseed leaves.

[0048] Again, the total root length, main root length, root surface area, root volume, number of root tips and number of root branches of the overexpression line K40735S:BnaA01.JAM3-6HA and the wild type 'K407' were measured and compared, and it was found that all the values ​​of the overexpression line were significantly higher than those of the wild type, indicating that BnaA01.JAM3 promotes the growth and development of rapeseed roots.

[0049] Finally, the jasmonic acid content of the overexpression line K40735S:BnaA01.JAM3-6HA and the wild type 'K407' was measured, and it was found that the jasmonic acid content of the overexpression line was significantly reduced compared with the wild type 'K407'.

[0050] Therefore, BnaA01.JAM3 improves rapeseed biomass accumulation by negatively regulating jasmonic acid signal transduction.

[0051] The following is a specific implementation of the embodiment of the present invention:

[0052] 1. Acquisition and vector construction of rapeseed gene BnJAM3

[0053] 1.1. Acquisition of rapeseed gene BnJAM3

[0054] The nucleotide and protein sequences of the BnaA01.JAM3 gene of Brassica napus were retrieved using the Brassica napus pan-genome information resource (BnPIR) database (https: / / cbi.hzau.edu.cn / bnapus / index.php). Then, the NCBI database Primer-BLAST online tool was used to design specific amplification primers for each gene, and vector-specific homology arm sequences were added to the 5′ end of the primers used to construct the plant expression vector.

[0055] 1.2 Cloning of BnJAM3 gene and vector construction

[0056] 1.2.1 Cloning of BnaA01.BnJAM3

[0057] Total RNA from different tissues of wild-type 'K407' was extracted using the SteadyPure Plant RNA Extraction Kit (Accurate Biotechnology, Changsha, China, Code No. AG21019). One-Step gDNARemoval and cDNA Synthesis SuperMix Reverse Transcription Kit (TransGen, Beijing, China, Code No.AE311) was used to synthesize cDNA. Specific primers were designed based on the CDS sequence of the BnaA01.JAM3 gene. The wild-type 'K407' cDNA was used as a template and the target fragment was amplified by PCR using a high-fidelity enzyme. The primers used are shown in Table 1:

[0058] Table 135S: BnaA01.JAM3-6HA vector construction primer information

[0059]

[0060] The PCR reaction system for amplifying the target fragment is shown in Table 2:

[0061] Table 2 PCR amplification of target fragments

[0062]

[0063]

[0064] The PCR reaction conditions for amplifying the target fragment are shown in Table 3:

[0065] Table 3 High-fidelity PCR reaction conditions

[0066]

[0067] After the reaction, agarose gel electrophoresis was performed to determine whether the size of the target gene was correct based on the DNA marker; the band of the correct size was quickly cut, and the target gene fragment was purified and recovered according to the instructions of the universal DNA purification and recovery kit (TIANGEN DP214), and the quality and concentration of the target gene obtained after recovery and purification were detected using the NanoDrop ND-1000 instrument.

[0068] The plant expression vector pCAMBIA1300-35s-6HA was double-digested with restriction endonucleases in a 37°C water bath for 5 to 6 h. The purified target fragment and the linearized vector after restriction digestion were mixed and connected at a molar ratio of 3:1. The reaction was carried out at 37°C for 30 min to complete the recombination of the target fragment and the linearized vector.

[0069] Heat shock transformation of Escherichia coli and identification of expression vectors: the homologous recombination ligation product was added to the competent Escherichia coli DH5α cells, gently pipetted and mixed, placed on ice for 20 min, 42°C water bath for 90 s, quickly placed on ice for 2 min, added 700 μL of LB culture medium, placed on a 37°C shaker for 30 min, and then the bacterial solution was spread on a plate containing 50 μg / mL Kanamycin (Kan + ) on LB solid medium and inverted in a 37°C constant temperature incubator overnight. Pick 10 monoclonal colonies at a time and place them in 7μL ddH2O and mix them evenly. Take 1μL of bacterial solution as a template and use the forward primer (P1300-F) on the vector and the reverse primer of the target fragment to configure the reaction system for PCR amplification. The PCR product was subjected to agarose gel electrophoresis, and the monoclonal colonies with the correct 2 bands were selected in a 50μg / mL Kan + The culture was expanded in LB liquid medium. The bacterial solution was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The sequencing results were consistent with the target sequence, indicating that the BnJAM3 gene in the rapeseed variety 'K407' had been successfully cloned into the plant overexpression vector.

[0070] Extract the recombinant plasmid, take 500 μL of the bacterial solution whose sequencing results are consistent with the target fragment sequence and place it in 8 mL of 50 μg / mL Kan + After expansion culture in a shaking tube containing LB culture medium, plasmid extraction was performed according to the plasmid extraction kit (TIANGEN DP103) to obtain the 35S:BnaA01.JAM3-6HA overexpression vector.

[0071] 2. Acquisition, screening and identification of transgenic plants

[0072] 2.1. Obtaining transgenic plants

[0073] The receptor materials used for rapeseed transformation were all wild type 'K407' of Brassica napus. The BnaA01.JAM3 overexpression strain was obtained by the team of Professor Zhang Yanfeng from the Shaanxi Hybrid Rapeseed Research Center using Agrobacterium-mediated hypocotyl genetic transformation. After pre-culturing Agrobacterium containing the recombinant plasmid with explants, the positive seedlings formed by hygromycin selection, differentiation and rooting were defined as T1 transgenic plants.

[0074] 2.2 Screening and identification of transgenic plants

[0075] The genomic DNA of young rapeseed leaves was extracted using the SteadyPure Plant Genomic DNA Extraction Kit (Cat No. AG21011, Aikerui Biotechnology) according to the instructions provided by the kit. First, the T1 generation overexpression transgenic plants were identified by PCR for the presence of the target gene, and the transcription level of the target gene was detected at the same time. Then, 6 T1 generation positive seedlings with higher transcription levels were selected for continued sowing and planting until all the offspring seedlings of a certain single plant were identified to contain the target gene fragment among the T2 generation offspring single plants. At this time, the seeds harvested from the offspring of the single plant are T3 generation homozygous seeds, which can be used for subsequent experiments.

[0076] The planting method of all rapeseed materials in the present invention is as follows: first, about 30 rapeseed seeds of each genotype are taken and sown in plug trays with nutrient soil (nutrient soil: vermiculite = 4:1) as the matrix, and placed in an artificial climate culture room until two cotyledons are fully developed. The light cycle of the artificial climate culture room is set to 16h light / 8h dark, and the light intensity is set to 300-400μmol·m -2 ·s -1 The day and night temperature was set at 25 / 18°C. Then, the rapeseed seedlings with strong and consistent growth were selected and transplanted into pots with nutrient soil (nutrient soil: vermiculite = 4:1) as the matrix for further cultivation for 4 weeks. Subsequently, the seedlings were moved to the vernalization room for vernalization treatment for 5 weeks. The photoperiod in the vernalization room was set to 16h light / 8h dark, and the light intensity was set to 300-400μmol·m -2 ·s -1 , the temperature was set to 4°C. After vernalization, the plants were moved to the previous artificial climate culture room and continued to be cultured until the seeds matured.

[0077] 3. Effect of BnJAM3 on rapeseed biomass accumulation

[0078] The aboveground phenotypes of the wild type 'K407' and the overexpression plant K40735S:BnaA01.JAM3-6HA of Brassica napus, including true leaf length, true leaf width, true leaf surface area, true leaf fresh weight, and root phenotypes, including total root length, taproot length, root surface area, root volume, root tip number, and root branch number, were comprehensively analyzed. The results showed that compared with the wild type 'K407', the biomass and various indices of the aboveground and underground parts of the overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2 were significantly increased.

[0079] 4. Effect of BnJAM3 on endogenous jasmonic acid content

[0080] The endogenous jasmonic acid content of the above-mentioned wild type 'K407' and overexpression plant K40735S:BnaA01.JAM3-6HA was comprehensively analyzed (Suzhou Mengxi Biopharmaceutical Technology Co., Ltd., high performance liquid chromatography). The results showed that compared with the wild type 'K407', the endogenous jasmonic acid content of the overexpression transgenic lines K40735S:BnaA01.JAM3-6HA#1 and K40735S:BnaA01.JAM3-6HA#2 increased significantly.

[0081] In summary, BnaA01.JAM3 promotes rapeseed biomass accumulation by negatively regulating jasmonic acid signal transduction.

[0082] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene, characterized in that: The method comprises: introducing a 35S:BnaA01.JAM3-6HA overexpression vector into the Brassica napus inbred line 'K407' based on an Agrobacterium-mediated hypocotyl genetic transformation method; obtaining more than 10 T1 generation positive transgenic plants from the transformed offspring of each vector through hygromycin resistance screening and PCR identification; and obtaining a T3 generation homozygous transgenic line through self-pollination, and specifically comprising the following steps: S1. Acquisition and vector construction of rapeseed gene BnJAM3: S1-1. Acquisition of rapeseed gene BnJAM3: The nucleotide and protein sequences of the BnaA01.JAM3 gene of Brassica napus were retrieved using the BnPIR database, and the Primer-BLAST online tool of the NCBI database was used to design specific amplification primers for each gene, and vector-specific homology arm sequences were added to the 5′ end of the primers used for constructing plant expression vectors. Cloning and vector construction of S1-2 and BnJAM3 genes: (1) Cloning of BnaA01.BnJAM3: Total RNA from different tissues of wild-type 'K407' was extracted using the SteadyPure Plant RNA Extraction Kit. One-Step gDNA Removal and cDNA SynthesisSuperMix reverse transcription kit was used to synthesize cDNA; specific primers were designed based on the CDS sequence of the BnaA01.JAM3 gene; wild-type 'K407' cDNA was used as a template and high-fidelity enzymes were used to amplify the target fragment by PCR; (2) The plant expression vector pCAMBIA1300-35s-6HA was double-digested with restriction endonucleases in a 37°C water bath for 5 to 6 hours, and the purified target fragment and the linearized vector after restriction digestion were mixed and connected at a molar ratio of 3:1, and reacted at 37°C for 30 minutes to complete the recombination of the target fragment and the linearized vector; (3) Extract the recombinant plasmid and place 500 μL of the bacterial solution with the sequence of the target fragment in a pre-filled 8 mL 50 μg / mL Kan + After the culture was expanded in a shaking tube of LB culture solution, plasmid extraction was performed according to the plasmid extraction kit to obtain the 35S:BnaA01.JAM3-6HA overexpression vector; S2. Acquisition, screening and identification of transgenic plants: S2-1. Obtaining transgenic plants: After pre-culturing the Agrobacterium containing the recombinant plasmid with the explants, the positive seedlings after hygromycin selection, differentiation and rooting were defined as T1 transgenic plants; S2-2. Screening and identification of transgenic plants: The genomic DNA of young rapeseed leaves was extracted using a plant genomic DNA extraction kit; First, the T1 generation overexpressing transgenic plants were used to identify the presence of the target gene by PCR, and the transcription level of the target gene was detected at the same time; Then, six T1 positive seedlings with higher transcription levels are selected for further sowing and planting until all the offspring seedlings of a certain T2 generation offspring are identified to contain the target gene fragment. At this time, the seeds harvested from the offspring of the single plant are T3 generation homozygous seeds.

2. The method for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene according to claim 1, characterized in that: The primers and sequences in step S1-2 are: 35S:BnaA01.JAM3–6HA-KpnⅠ-F: TCTAGAGGATCCCCGGGTACCATGGGTCAAAAGTTCTGGGAC; 35S:BnaA01.JAM3–6HA-SpeⅠ-R: GTATGGGTAACTAGAACTAGTCTGTGCGAGAGAGGTGAGGAG; P1300-F: GTCACTTTATTGTGAAGATAGTGG; P1300-R: AGTTTGCGCGCTATATTTTGTT.

3. The method for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene according to claim 1, characterized in that: The PCR reaction system for amplifying the target fragment in S1-2 is shown in the following table: ； The PCR reaction conditions for amplifying the target fragment are shown in the following table: After the reaction is completed, agarose gel electrophoresis is performed to determine whether the size of the target gene is correct based on the DNA marker; and the band of the correct size is quickly cut out of the gel.

4. Use of the method for increasing the biomass of Brassica napus by overexpressing the BnaA01.JAM3 gene according to any one of claims 1 to 4 in cultivating new varieties of high-biomass rapeseed.

Images