Long forest bark beetle population tracing SNP (Single Nucleotide Polymorphism) molecular marker and application

Abstract

The invention discloses a Changlin bark beetle population traceability SNP (Single Nucleotide Polymorphism) molecular marker and application. The method for detecting the SNP traceability site of the Changlin bark beetle population is established by collecting geographical population samples of the Changlin bark beetle at home and abroad and screening the population specific SNP traceability site from a sample genome re-sequencing sequence. The population traceability SNP marker site excavated by the invention is good in genetic stability and reliable in detection result, the affiliation and source of the detected population can be accurately judged by adopting a peak map obtained after amplification of the SNP marker site amplification primer in the detection process, and a single mutation SNP molecular marker is adopted, so that the population source detection process is rapid, simple and convenient.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology detection technology, and in particular to a SNP molecular marker technology used for tracing the origin of a longwood borer population and an application thereof. Background Art

[0002] At present, the molecular identification of samples intercepted during plant quarantine at ports is mainly species identification at the interspecific level, but there is a lack of accurate and effective detection technology for the genetic differentiation characteristics of geographical populations below the species. With the need for precise customs quarantine supervision and technical trade measures, important quarantine pests intercepted at ports need to be traced back to geographical populations to clarify the source of the intercepted samples, including the geographical affiliation of the population and possible transmission routes.

[0003] There are four main technical methods related to population traceability: (1) simplified genome sequencing and analysis, (2) detection and analysis of specific barcode gene fragments (mitochondrial and nuclear genes, etc.), (3) microsatellite (SSR) molecular markers and analysis, and (4) SNP molecular marker technology. The first three technologies have obvious shortcomings in population traceability detection, while the use of SNP molecular markers is mainly used in medical disease diagnosis, molecular markers of agricultural breeding traits, and molecular markers for meat traceability in food. At present, there is no corresponding technology and application for the development of SNP molecular markers for quarantine pest population traceability.

[0004] (1) Simplifying genome sequencing and analysis This technology integrates and analyzes the genetic differentiation characteristics and sources of variation among populations at the genome level by simplifying the genome sequencing of samples from populations of different sources, such as the strain typing and transmission source analysis of the new coronavirus (covid-19) based on the genome sequence, and the study of the rapid expansion mechanism of the invasive weed Mikania micrantha (Liu, Bo; Yan, Jian; Li, Weihua et al. Mikaniamicrantha The advantage of this technology is that the population typing information is comprehensive and accurate. However, this technology requires the use of second-generation (library construction) or third-generation sequencing technology to sequence and analyze population samples, which is labor-intensive, costly, and time-consuming. It is especially not suitable for routine detection of species with large genome data such as port insects. It is difficult to determine the population origin under the condition of a single population sample.

[0005] (2) Detection and analysis of genomic gene fragments (mitochondrial and nuclear genes, etc.) The use of barcode gene fragments as molecular markers is mainly used for species identification, and can also be used for preliminary analysis of population genetic structure, such as the analysis of the genetic structure of geographical populations of the longwood beetle based on the mitochondrial CO1 gene (Oliveira MR C, Correˆa AS, Souza GA d, Guedes RNC, Oliveira LO D. 2013. Mesoamerican Origin and Pre- and Post-Columbian Expansions of the Ranges of Acanthoscelidesobtectus Say, a Cosmopolitan Insect Pest of the Common Bean. PLoS ONE 8(7): e70039) (doi:10.1371 / journal.pone.0070039), but due to the relative conservatism of barcode sequences and the very limited information they can reflect on the diversity of genetic differentiation of populations, as well as the poor stability of the variability marker sites, they are not suitable as molecular markers for tracing the origins of specific populations.

[0006] (3) Microsatellite (SSR) molecular markers and analysis Microsatellite markers, also known as short tandem repeats (STRs) or simple sequence repeats (SSRs), are simple repeat sequences uniformly distributed in the genome of eukaryotes. They are composed of tandem repeat fragments of 2 to 6 nucleotides. Since the number of repetitions of the repeating units shows high variability and abundance among individuals, microsatellite markers are widely used in population genetic molecular markers. Microsatellite loci are usually amplified by PCR, and the amplified products are analyzed by electrophoresis and alleles are separated according to size for detection. However, microsatellites as molecular markers of genetic variability also have poor stability and lack of reliable molecular markers for specific populations. Conventional detection requires the collection of a large number of population samples, and the origin of the population cannot be determined under single sample conditions. In addition, the reliability of detecting the difference of alleles through electrophoresis patterns is poor.

[0007] (4) SNP molecular markers and detection SNP (single nucleotide polymorphism) molecular marker technology refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. This variation may appear in the form of a single base conversion (such as C←→T) or transversion (such as C←→A), or it may be caused by the insertion or deletion of a base. SNP is widely used in many fields such as biology, medicine, and agriculture. In the medical field, SNP research helps to locate, clone, and identify disease genes, and can be used for disease diagnosis and prediction of pathogenic risks, as well as pharmacogenomics and the discovery of new drugs. In the agricultural field, SNP analysis can help breeders better understand the genetic diversity of crops and accelerate the cultivation of excellent varieties. In the food field, SNP molecular markers can be used to trace the variety of meat sold. In the field of plant quarantine, SNP molecular markers have not yet been used to trace the population of quarantine pests. Since the detection and application of SNP molecular markers are not universal, specific SNP molecular marker technology needs to be developed and established by screening genome data for specific species research objects.

[0008] At present, the main focus of molecular routine identification of quarantine pests and diseases at home and abroad is on species identification, while there is a lack of accurate and rapid detection technology for the identification of genetic differentiation characteristics of geographical populations within species (infraspecific units). It is worth noting that for the same biological species, due to long-term geographical division, the intraspecific genetic differentiation will produce genetic differences under the corresponding ecological background conditions (such as biotypes and geographical populations). On the other hand, the encounter of different infraspecific units (biotypes and geographical types, etc.) may produce hybrid dominant populations with stronger ecological adaptability than the original geographical populations themselves, and generate new harmful potential. Therefore, the implementation of species identification at the species level cannot accurately identify the genetic differentiation characteristics of geographical populations of species. It is necessary to develop molecular detection and identification technology at the infraspecific level that can be used for the identification of genetic backgrounds of different geographical species, so as to accurately trace and track their sources of transmission, and help solve the problem of traceability of quarantine pests in international trade.

[0009] Longwood beetle Hylurgusligniperda(Coleoptera: Curculionidae) is native to the Mediterranean coast of Europe and certain islands in the Atlantic Ocean. In the past 90 years, it has spread to all continents, including the whole of Europe, Japan (as early as 1931), South Korea and Sri Lanka (2018) in Asia, Australia (1942) and New Zealand (1974) in Oceania, and the United States, Uruguay, Brazil and Chile (2000-2001) in the Americas. The longwood beetle usually infects newly cut wood and weak wood, and injured healthy trees are also often harmed. In Chile, the longwood beetle was found to harm healthy trees in the dry season and occasionally kill radiata pine seedlings. The longwood beetle can harm more than 20 tree species including radiata pine, black pine and longleaf pine. In China, the longwood beetle was first found in 2020 in Yantai, Shandong, where it infects black pine ( Pinusthunbergii ), and then spread to Weihai, Tai'an, Weifang and Qingdao. At present, the main sources of my country's imported timber include Russia and New Zealand, which are all distribution areas of the longwood borer epidemic. Due to my country's vast territory, rich pine resources, and the introduction of a large number of foreign pines in the form of artificial pure forests, and because my country's geographical location and climatic conditions are similar to the distribution of the insect, and the longwood borer has a strong adaptability to the environment, the insect poses a serious threat to my country's pine forest resources. Since the adults, larvae and eggs of the longwood borer can be spread over long distances with the host materials (logs, wooden packaging), strengthening port quarantine supervision and accurately determining the source of the introduction of the longwood borer intercepted at the port is an important basis for the quarantine and prevention of the insect. Summary of the invention

[0010] In view of the shortcomings of the above-mentioned existing population tracing technology, the present invention develops a group of long forest beetles ( Hylurgusligniperda ) Population tracing SNP molecular markers were developed and applied. Through genome resequencing of samples from populations of different geographical origins of the long forest beetle, specific SNP molecular tracing markers for different geographical populations of the long forest beetle were developed from the comparative analysis of genome sequence data. These markers serve as identification marks for the origins of their specific geographical populations, thus forming a detection method that can be applied to population tracing.

[0011] In order to obtain the SNP sites for tracing the population of the long forest beetle, the present invention first carried out whole genome sequencing of the insect to provide a reference genome for screening the SNP sites for tracing the population of the long forest beetle. The whole genome was sequenced using second and third generation sequencing technologies, and a total sequencing volume of 179.00G of the long forest beetle was measured, with a coverage depth of 108.27X. On this basis, resequencing technology was used to resequence a total of 22 samples from three long forest beetle populations from New Zealand, Russia and Shandong in China. Through bioinformatics analysis, one specific SNP marker and one pair of detection primers were successfully screened and verified from the total genome of each population of about 4 million SNP sites.

[0012] In order to achieve the above-mentioned object of the invention, the present invention provides a SNP molecular marker for tracing the population of the longwood beetle, which includes one or more of the following molecular markers: For the traceability SNP site of the Russian population, the 10581062nd base position on chromosome 10 of the reference genome of the longlin beetle is A; the traceability SNP molecular marker of the Shandong population at this site is C at the 12396414th base position on chromosome 4, and the traceability SNP molecular marker of the New Zealand population at this site is G at the 10512733rd base position on chromosome 1.

[0013] The present invention also provides detection primers for detecting the SNP molecular markers for tracing the population of the longwood borer.

[0014] Specifically, it includes one or more pairs of the following primers: The detection primers for the traceability SNP locus molecular markers of the Russian population are 1062-F / 1062-R, the forward primer sequence is CAGTTGAACGATGGGCCAAT, and the reverse primer sequence is TCACAGTTTTGAGCGCGAAT; The detection primers for the traceability SNP site molecular markers of the Shandong population are 6414-F / 6414-R, the forward primer sequence is TCTATGAGCTTAGTCGTCTGGT, and the reverse primer sequence is GGATTACCGTCACGAGAAGC; The detection primers for the traceability SNP site molecular markers of the New Zealand population are 2733-F / 2733-R, the forward primer sequence is CCTGCATTGAAGGGTTGAGT, and the reverse primer sequence is AACAGAACGTGCAACCATCC.

[0015] The present invention provides the application of the SNP molecular marker for tracing the population of the long forest beetle in the tracing detection of the geographical population of the long forest beetle.

[0016] The present invention also provides the application of the detection primer in the detection of geographical population tracing of the long forest beetle.

[0017] The present invention also provides a method for tracing the origin of a longwood beetle population using a tracing SNP molecular marker, which comprises the following steps: extracting genomic DNA from a single head of a longwood beetle sample, and amplifying it with the detection primers described in any one of claims 2 or 3; sequencing or amplifying the peak graph of the amplified product, and determining the origin of the population to be tested by referring to the genotype of a specific population tracing site; The population of the longwood borer is from Russia, Shandong or New Zealand.

[0018] Specifically, the method for extracting genomic DNA from a single head of a longwood borer sample is performed using a kit suitable for extraction of trace samples.

[0019] More specifically, the traceability site (SNP) sequence amplification conditions were: pre-denaturation at 94°C for 4 min before cycling; denaturation at 94°C for 30 s, annealing at 50°C~58°C (depending on the specific primers) for 30 s, extension at 72°C for 40 s, 30 cycles, and finally extension at 72°C for 10 min. The system temperature was lowered to 12°C to end the PCR amplification.

[0020] Preferably, the amplification system is prepared in 25 µL, the amount of genomic DNA template added is 1 µL (concentration 10 ng / µL~100 ng / µL), and the amount of upstream primer and downstream primer used is 0.3 µL (concentration 20 μM) respectively.

[0021] The present invention provides a method for tracing the origin of a population of a wood bark beetle, wherein the amplified product is used to amplify a target detection sequence of a sample of a wood bark beetle population through one or more primers; the target region is determined on a sequencing peak graph according to the flanking sequence of the SNP, and the source of the sample can be determined according to the SNP type; the specific judgment criteria are as follows: for a sample of a wood bark beetle, genomic DNA is extracted from a single head; the population tracing site detection primers described in any one of claims 1 to 9 are used to amplify a target detection sequence of a sample of a wood bark beetle population; and according to the SNP tracing site amplification peak graph, the genotype of the tracing site of a specific population is referred to determine the origin of the population to be tested.

[0022] The population traceability SNP marker sites developed by the present invention have good genetic stability and reliable detection results. The peak diagram obtained after amplification of the SNP marker site with primers in the detection process can accurately determine the ownership and source of the detected population. Specifically, SNP (single nucleotide polymorphism) molecular markers are used to collect geographical population samples of long forest beetles at home and abroad, and population-specific SNP traceability sites are screened from the sample genome resequencing sequences to establish a detection method for SNP traceability sites of long forest beetle populations to identify the population source of samples intercepted at ports. The technology and application of the present invention are helpful to clarify the population source of intercepted long forest beetles, so as to avoid trade frictions that may be caused by misjudgment of intercepted insect sources, improve the pertinence of port quarantine on imported beans, and effectively ensure the smooth progress of international agricultural product trade and national ecological and agricultural security. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 , Sequencing depth distribution diagram. The horizontal axis is sequencing depth (X), and the vertical axis is the ratio of bases to the genome (fraction of bases).

[0024] Figure 2 , verification and identification peak diagram of the traceability sites of the Russian geographical population of the long forest beetle.

[0025] Figure 3 , verification and identification peak diagram of the traceability sites of the Shandong geographical population of the Changlin borer.

[0026] Figure 4 , verification and identification peak diagram of the traceability sites of the New Zealand geographical population of the longwood beetle. DETAILED DESCRIPTION

[0027] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited by the embodiments.

[0028] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are conventional experimental materials, reagents, instruments and methods in the art and can be purchased through commercial channels.

[0029] Example 1: Mining of tracing sites of the longwood beetle population and design of primers 1. Sequencing and assembly of the reference genome of Microhylidae In order to provide a reference genome for the screening of SNP sites for the tracing of the population of the long-wood beetle, a sample of the long-wood beetle in Shandong, China (HL202404001) was selected to carry out genome sequencing of the insect. Using second-generation and third-generation sequencing technologies, the sequencing output of Rawdata totaled 396.00 G, and the filtered Clean data totaled 348.21 G. The total amount of fragments of the long-wood beetle genome sequencing library was measured to be 80.77G, and the coverage depth was 108.27X (Table 1).

[0030] Based on the sequencing of the whole genome of the long forest beetle, the 179.00G sequencing data of the long forest beetle HL202404001 genome was used to perform denovo assembly on the HL202404001 genome. The total contig length of the assembly result was 518.74Mbp, and the contig N50 length reached 2.11Mbp. The assembly version was evaluated by multiple methods, and the results showed that the genome consistency, completeness and accuracy were all good.

[0031] Table 1. Statistics of the data volume of the genome sequencing library of Microhylidae longlinensis

[0032] The contig N50 of the genome assembly reached 286.86Kbp (sequences larger than 100bp were selected for assembly results). Sequence consistency analysis showed that the small fragment reads were aligned to the genome, the reads alignment rate was about 93.99%, and the genome coverage was about 75.53% ( Figure 1). The genome was assembled by denovo, and the total length of the contigs was 588.59 Mbp, and the length of the contig N50 reached 286.86 Kbp.

[0033] The SNPs analysis and statistics of the measured reference genome of the long forest beetle showed that the genome had a total of 4,004,207 SNP sites, including 4,001,407 heterozygous sites and 2,620 homozygous sites (Table 2).

[0034] Table 2. SNP statistics of the genome of Microhylidae chinensis HL202404001

[0035] Note: All SNPs: All SNPs in the genome, including heterozygous SNPs and homozygous SNPs.

[0036] 2. Resequencing of samples from the traceable population of the long-line beetle The present invention resequenced a total of 22 samples from three geographical populations of L. longissima from New Zealand, Russia and Shandong, China (Table 3). The quality of the library constructed by sample sequencing was good (Table 4). The amount of resequencing data for each sample is shown in Table 5.

[0037] Table 3. Sources of geographical population samples of Microhylidae longifolia

[0038] Table 4. Summary of the quality of the resequencing library data output of the population samples of Microhylidae spp.

[0039] Table 5. Data volume of resequencing of samples of the longlin beetle population

[0040] With reference to the reference genome of D. chinensis, SNPs were screened and analyzed for the resequencing data of the four D. chinensis geographical populations. The vcftools software was used to filter SNPs, remove sites with missing genotypes, and retain sites with SNPs quality values ​​greater than 30. A total of 141,635 SNPs related to population origin were screened. On this basis, the most specific SNPs for China, New Zealand and Russia (100% specific SNPs) and sequences of about 300 bp on both sides of the sites were further selected (used to design SNP site amplification primers). Through site sequence amplification verification, three SNP molecular markers were finally obtained for effectively detecting the origin of D. chinensis from New Zealand, China and Russia (Table 6).

[0041] Table 6. Number of samples and traceability SNP loci of three geographic populations of Microhylidae longifolia

[0042] The list of SNP traceability marker sites and their detection primers for the long forest beetle population established in this way is 7.

[0043] Table 7. Primer sequences for SNP combination site detection in geographical population tracing of Microhylidae

[0044] Example 2: Application and verification of SNP molecular markers for tracing the population of Microhylidae According to the traceability detection sites (Table 6) and their detection primers (Table 7), genomic DNA is extracted individually for samples of the long forest beetle population that may cover the present technical invention; the population traceability site detection primers (Table 7) provided by the present invention are used to amplify (PCR) the sample sequences of the long forest beetle population to be tested.

[0045] The specific steps are as follows: 1. Sample collection: The samples must be insect bodies or tissues whose DNA is not degraded and not infected by pathogens.

[0046] 2. Genomic DNA Extraction Choose a commercial kit suitable for extracting trace samples (such as QIAGEN's DNeasy Blood and Tissue Kit (50)) or other equivalent kits. Refer to the instructions for use for the extraction of single-headed worms. Before elution, try to remove organic solvents such as alcohol from the DNA purified by the separation column. After elution, test the solution for DNA concentration and quality.

[0047] 3. SNP tracing site sequence amplification According to the population samples to be tested, the traceability primers in Table 2 are used to amplify the SNP sites.

[0048] 1) Amplification system and conditions: The amplification system is taken as an example to prepare 25µL (Table 8). If the DNA template concentration is lower than 10ng / µL, increase the amount of template appropriately.

[0049] Table 8. PCR reaction system mixture and dosage of traceability site sequence

[0050] The PCR reaction conditions are: pre-denaturation at 94°C for 4 min before cycling; denaturation at 94°C for 30 s, annealing at 50°C~58°C (depending on the specific primers) for 30 s, extension at 72°C for 40 s, 30 cycles; finally extension at 72°C for 10 min, the system temperature dropped to 12°C, and the PCR amplification was terminated.

[0051] 2) Sequencing of amplified products and determination of SNP sites The amplified product is usually sent to a sequencing company for sequencing. The sequence is opened with SnapGene to open the ab1 sequencing file, and the flanking sequence of the SNP is searched. The target region is determined on the sequencing peak graph based on the flanking sequence of the SNP (usually 10 bp). The source of the sample population can be determined based on the SNP type. The SNP traceability site verification of the three long forest beetle populations is shown in Table 9, and the peak graph of the verification site identification is shown in Figures 2 to 4 shown.

[0052] Table 9. Verification results of SNP detection sites for tracing the population of Microhylidae .

Claims

1. The SNP molecular marker for tracing the population of the long forest beetle is characterized by: Include one or more of the following molecular markers: For the traceability SNP site of the Russian population, the 10581062nd base position on chromosome 10 of the reference genome of the longlin beetle is A; the traceability SNP molecular marker of the Shandong population at this site is C at the 12396414th base position on chromosome 4, and the traceability SNP molecular marker of the New Zealand population at this site is G at the 10512733rd base position on chromosome 1.

2. Detection primers for detecting the SNP molecular marker for tracing the population of the longwood borer as described in claim 1.

3. The detection primer according to claim 2, characterized in that It includes one or more pairs of the following primers: The detection primers for the traceability SNP locus molecular markers of the Russian population are 1062-F / 1062-R, the forward primer sequence is CAGTTGAACGATGGGCCAAT, and the reverse primer sequence is TCACAGTTTTGAGCGCGAAT; The detection primers for the traceability SNP site molecular markers of the Shandong population are 6414-F / 6414-R, the forward primer sequence is TCTATGAGCTTAGTCGTCTGGT, and the reverse primer sequence is GGATTACCGTCACGAGAAGC; The detection primers for the traceability SNP site molecular markers of the New Zealand population are 2733-F / 2733-R, the forward primer sequence is CCTGCATTGAAGGGTTGAGT, and the reverse primer sequence is AACAGAACGTGCAACCATCC.

4. Application of the SNP molecular marker for tracing the population of the longwood beetle according to claim 1 in tracing the geographical population of the longwood beetle.

5. Use of the detection primers as described in any one of claims 2 or 3 in the tracing detection of geographical populations of the longwood borer.

6. A method for tracing the origin of a longwood beetle population using SNP molecular markers, characterized in that: The following steps are involved: Extract genomic DNA from a single head of a sample of the longwood borer, and amplify the DNA using the detection primers described in any one of claims 2 or 3; According to the sequencing or amplification peak diagram of the amplified product, the origin of the population to be tested is determined by referring to the genotype of the specific population traceability site; The population of the longwood borer is from Russia, Shandong or New Zealand.

7. The method for tracing the population of the longwood borer as claimed in claim 6, characterized in that: The method for extracting genomic DNA from a single head of the longlin beetle sample was carried out using a kit suitable for extraction of trace samples.

8. The method for tracing the population of the longwood borer as claimed in claim 6, characterized in that: Traceability site (SNP) sequence amplification conditions: pre-denaturation at 94°C for 4 minutes before cycling; denaturation at 94°C for 30 seconds, annealing at 50°C~58°C (depending on the specific primers) for 30 seconds, extension at 72°C for 40 seconds, 30 cycles, and finally extension at 72°C for 10 minutes. The system temperature was reduced to 12°C to end PCR amplification.

9. The method for tracing the population of the longwood borer as claimed in claim 6, characterized in that: The amplification system was prepared in 25 µL, with 1 µL of genomic DNA template (concentration 10 ng / µL~100 ng / µL), and 0.3 µL of upstream primer and downstream primer respectively (concentration 20 μM).

10. The method for tracing the origin of a population of the longwood beetle according to any one of claims 6 to 9, characterized in that: The amplified product is amplified by one or more primers described in claim 3 to amplify the target detection sequence of the long forest beetle population sample; the target area is determined on the sequencing peak graph according to the flanking sequence of the SNP, and the source of the sample can be determined according to the SNP type; the specific judgment criteria are as follows: for the long forest beetle sample, single-head genomic DNA is extracted; the population traceability site detection primers described in any one of claims 1-9 are used to amplify the target detection sequence of the long forest beetle population sample; According to the SNP tracing site amplification peak graph, the origin of the population to be tested is determined by referring to the genotype of the tracing site of the specific population.

Images