Molecular marker for identifying long-hairy-strand Zhongwei goat and application of molecular marker

Abstract

The invention belongs to the technical field of genetic breeding, and particularly relates to a molecular marker for identifying long-hair-strand Zhongwei goats and application of the molecular marker. The molecular marker comprises a first site or a second site or a third site. The nucleotide sequence of the molecular marker containing the site I is as shown in SEQ ID NO.1, and mutation from T to G occurs at the 102bp position in the SEQ ID NO.1; the nucleotide sequence of the molecular marker containing the site II is as shown in SEQ ID NO.2, and mutation from A to G occurs at the 102bp position in the SEQ ID NO.2; the nucleotide sequence of the molecular marker containing the site 3 is as shown in SEQ ID NO.3, and mutation from T to G occurs at the 102bp position in the SEQ ID NO.3. The molecular marker can be used for breeding the Zhongwei goats with the long feathers.

Description

Technical Field

[0001] The invention relates to the technical field of genetic breeding, and in particular to a molecular marker for identifying long-haired Zhongwei goats and an application thereof. Background Art

[0002] Zhongwei goat is the only goat breed in the world that produces white fur. In recent years, due to changes in livestock and poultry industry demand and feeding conditions, the current core population of Zhongwei goats is seriously insufficient. The problems of too few sheep in the core production area, low reproduction rate, and degradation of excellent germplasm traits have become the difficulties in the protection of the germplasm resources of this breed. Zhongwei goat is not only famous for its high-quality cashmere, but its fur also has certain economic value. Sand fur refers to the fur obtained from Zhongwei goats around 40 days old. This fur is white, shiny like jade, neatly curved, and beautiful inflorescence. It is valued for its unique texture and characteristics. Therefore, improving the fur quality of Zhongwei goats and cultivating Zhongwei goats with excellent sand fur quality is one of the urgent problems to be solved in the current Zhongwei goat conservation work. The natural length of the hair strand is an important indicator of the sand fur trait of goats, but the existing technology has yet to study the natural length of goat hair strands at the genetic level. Summary of the invention

[0003] In order to solve the above technical problems, the present invention provides a molecular marker for identifying long-haired Zhongwei goats, which can be used to identify the natural length trait of goat hair strands and to breed goats with long-haired strands.

[0004] The technical solution provided by the present invention is as follows: In a first aspect, the present invention provides a molecular marker for identifying a long-haired Zhongwei goat, wherein the molecular marker comprises site one, site two or site three; The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1; The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp; The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

[0005] Wherein, the site 1 is located at position 6521711 on chromosome 16 of the Zhongwei goat genome; The second locus is located at position 6525211 on chromosome 16 of the Zhongwei goat genome; The site three is located at position 6529012 on chromosome 16 of the Zhongwei goat genome.

[0006] The second aspect of the present invention provides an application of the molecular marker in identifying the natural length trait of Zhongwei goat hair strands.

[0007] As a preferred embodiment of the present invention, the method for identifying the natural length trait of Zhongwei goat wool strands comprises the following steps: The base at the 102 bp position in the molecular marker of the goat to be tested is detected. When the base at the position is G, the natural length of the goat's hair strand is greater than the natural length of the goat's hair strand when the base at the position is T or A.

[0008] The third aspect of the present invention provides an application of the molecular marker in the genetic breeding of Zhongwei goats.

[0009] As a preferred embodiment of the present invention, the molecular marker is used to breed long-haired Zhongwei goats.

[0010] A fourth aspect of the present invention provides a genetic breeding method for long-haired Zhongwei goats, comprising the following steps: The genotype of Zhongwei goats at the 102 bp position in the molecular marker was detected, and individuals with the GG genotype were selected as parents to increase the natural length of the hair strands of the offspring.

[0011] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides three SNP sites that affect the natural length of Zhongwei goat hair strands and molecular markers respectively comprising the three different SNP sites. By selecting GG genotype individuals at the SNP sites and using them as the father or mother, the natural length of the hair strands of the offspring can be increased. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 For the principal component analysis graph, the first three explained variance percentages, PC1, PC2, and PC3, are used as the X, Y, and Z axes; Figure 2 It is a visualization diagram of G matrix; Figure 3 This is the distribution diagram of SNPs in the 1Mb window of chromosome after quality control. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size; Figure 4 The GWAS results of the natural length of the hair strands of Zhongwei goats are shown for Manhattan Plots (A) and QQ-plots (B). DETAILED DESCRIPTION

[0013] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0014] Zhongwei goats are the only goat breed in the world that produces white fur. Zhongwei goats are not only famous for their high-quality cashmere, but their fur also has certain economic value. The natural length of the hair strands is an important indicator of the characteristics of goat fur, but the existing technology has yet to study the natural length of goat hair strands at the genetic level.

[0015] Based on this, the present invention provides a molecular marker for identifying long-haired goats, wherein the molecular marker comprises site one, site two or site three; The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1; The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp; The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

[0016] By using this molecular marker and selecting individuals with the GG genotype as the father or mother, the natural length of the hair strands of the offspring can be increased.

[0017] Example 1 Source of experimental animals and phenotypes: The test goats of the present invention are all from the Zhongwei goat breeding farm in Ningxia Hui Autonomous Region. The phenotypic records of natural hair length in 2022 were measured, and the results are shown in Table 1. Ear tissue samples of 367 Zhongwei goats were collected, and all samples were immediately stored in liquid nitrogen after collection, and stored at -80°C for a long time after being transported to the laboratory.

[0018] Table 1 Description of the natural length of Zhongwei goat wool strands

[0019] 1. Genomic DNA extraction and quality inspection The phenol-chloroform method was used to extract DNA from ear tissue samples. A spectrophotometer (NanoDrop 2000) was used to measure DNA concentration, the absorption wavelength ratio of the highest absorption peaks of nucleic acids, proteins and phenolic substances (260nm / 280nm), and the absorption wavelength ratio of the highest absorption peak of carbohydrates (260nm / 230nm). 1% agarose gel was used to evaluate DNA quality.

[0020] 2. Library construction and sequencing After the qualified genomic DNA samples were processed, the genomic DNA was randomly sheared into 350 bp fragments using a Covaris ultrasonic crusher. The DNA fragments were repaired at the end, polyA was added, sequencing adapters were added, purified, and PCR amplified to complete the entire library preparation. After the library construction was completed, Qubit2.0 was used for preliminary quantification, and the effective concentration of the library was accurately quantified using the qPCR method to ensure the quality of the library. After the library quality test was qualified, the sequencing was performed using the BGI-T7 sequencing platform, and the sequencing mode was PE150 mode.

[0021] 3. Identification, screening and annotation of variant sites Fastp software version V0.20.0 was used to filter the Raw reads data into Clean reads data, and a genome index was established for the reference genome. The quality-controlled Clean reads data were aligned with the goat reference genome ARS1, GCF_001704415.1 using Burrows-Wheeler Aligner software version V0.7.17. The aligned sam files were converted into bam files and sorted using SAMtools software version V1.8-20. The MarkDuplicates program in GenomeAnalysis Toolkit software version V3.8 was used to remove duplicate data from the sorted bam files to obtain the final bam files. The final bam files were indexed, and the HaplotypeCaller module in the GATK software was used to detect SNP variations. After obtaining the vcf file, the VariantFiltration module was used for filtering. The ANNOVAR software package is used to perform functional annotation on the detected gene variants. Based on the position of the variant site on the reference genome and the gene position information on the reference genome, the region where the variant site occurs in the genome, including intergenic regions, intronic regions or CDS regions, and the impact of the variant can be obtained.

[0022] 4. Data quality control and population stratification correction The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with genotype detection rate < 98%, SNPs with detection rate < 98%, SNPs with minimum allele frequency < 5%, and Hardy-Weinberg equilibrium test P value < 10 were excluded. -6 The first three principal components were calculated using the "-pca 3" parameter of Plink V1.90 software. The PCA graph was drawn using R language V3.6.0. The results are shown in the figure. Figure 1 As shown in the figure, there is no population stratification in the test samples, and there is no need to correct the population stratification phenomenon of Zhongwei goats. Plinkv1.90 was used to perform genetic distance analysis based on IBS and genomic kinship analysis based on G matrix. The results are shown in the figure. Figure 2 As shown, Figure 2 Each small square in the figure represents the kinship value between the first and last samples. The larger the value is and the closer it is to dark green, the closer the kinship between the two individuals is. Figure 2 This shows that the average genetic distance between Zhongwei goat individuals is relatively far.

[0023] A total of 32,219,876 SNPs were involved in quality control and filtered by SNP detection rate, Hardy-Weinberg equilibrium, minimum allele frequency, and individual detection rate. The filtering conditions were -geno 0.02, -maf 0.05, and -hwe 1e -6 , -mind 0.1. A total of 15,817,002 SNPs were obtained for subsequent analysis, and these sites were evenly distributed on the 29 pairs of autosomes of goats, such as Figure 3 shown.

[0024] 5. Genome-wide association analysis The fastGWA-mlm model in GCTA V1.94.0beta software was used to perform association analysis between SNP and natural hair length traits.

[0025] y=X snp β snp +X c β c +g+e where y is an n×1 phenotype vector; X snp is a genotype vector with effects β snp ;X c is the correlation matrix with gender as a fixed covariate, and its corresponding coefficient is β c ; g is the vector of total genetic effects captured by the SNP-derived genetic relationship matrix, g ~ N(0, ), π is the genetic relationship matrix vector derived from SNPs, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).

[0026] The Bonferroni correction method was used to determine the significance threshold of the GWAS. The genomic expansion factor λ of the test statistic was calculated by the slope of the linear regression between the observed quantile and the theoretical quantile in R language V3.6.0. The λ value for the natural length trait of the hair strand was calculated to be 1.111, indicating that there was no genomic expansion. Based on the resequencing data of 367 Zhongwei goats, 76 significant SNP loci associated with the natural length trait of the hair strand were detected, which were located on chromosomes 2, 3, 4, 7, 9, 11, 13, 16, 19, 21, 24, and 29, as shown in Table 2, Supplementary Table 2 and Figure 4 shown. Figure 4 Genome-wide significant SNPs are shown in red.

[0027] Table 2 Significant SNP loci associated with natural strand length traits

[0028] Supplementary Table 2 Significant SNP loci associated with natural hair strand length traits

[0029] 6. SNPs that affect the natural length of Zhongwei goat wool Further study of SNPs that reached the genome-wide significance level revealed that the T→G mutation at position 6521711 on chromosome 16 of the Zhongwei goat genome can significantly affect the natural length trait of the hair strands of the Zhongwei goat.

[0030] The association analysis between the SNP locus at position 6521711 on chromosome 16 of the Zhongwei goat genome and the natural length of the hair strands is shown in Table 3: Table 3 Polymorphisms at position 6521711 on chromosome 16 of Zhongwei goat genome

[0031] Note: Different letters indicate significant differences ( P <0.05, the same letter indicates no significant difference ( P >0.05).

[0032] It can be seen from Table 3 that for individuals with genotype GG, the natural length of their hair strands is the longest.

[0033] In the whole genome association analysis, the SNP molecular marker at position 6521711 on chromosome 16 of the Zhongwei goat genome reached the genome-wide significant level, indicating that the marker was significantly associated with the natural hair strand length trait of the Zhongwei goat, and when the marker mutated to G, it was beneficial for the Zhongwei goat to have a longer natural hair strand length, see Table 4.

[0034] Table 4 SNP gene frequency and genotype frequency at position 6521711 on chromosome 16 of Zhongwei goat genome

[0035] The nucleotide sequence of the molecular marker containing the T→G mutation site at position 6521711 on chromosome 16 is shown in SEQ ID NO.1, specifically: CCCTGAGCCATACAGCAAATTCCCACCGGCTATCTGTTTTACATGTGGTAATGTATATGTTTCAGTGCATGCGACTCTCTCAAACATCCCACTTTCTCCTTSTCCACTGTATCCACAAGTCTGTTCTCTATGTCTGTGATGCAGATACTGTCACGGTATTTGAGGCTGTTTCATCCACAGGCTGGAAAGTCACAGTGAGAGAG, where S is T / G.

[0036] Further study of SNPs that reached the genome-wide significance level revealed that the A→G mutation at position 6525211 on chromosome 16 of the Zhongwei goat genome can significantly affect the natural length trait of the hair strands of the Zhongwei goat.

[0037] The association analysis between the SNP locus at position 6525211 on chromosome 16 of the Zhongwei goat genome and the natural length of the hair strands is shown in Table 5: Table 5 Polymorphism of position 6525211 on chromosome 16 of Zhongwei goat genome

[0038] Note: Different letters indicate significant differences ( P <0.05, the same letter indicates no significant difference ( P >0.05).

[0039] It can be seen from Table 5 that for individuals with genotype GG, the natural length of their hair strands is the longest.

[0040] In the whole genome association analysis, the SNP molecular marker at position 6525211 on chromosome 16 of the Zhongwei goat genome reached the genome-wide significant level, indicating that the marker was significantly associated with the natural hair strand length trait of the Zhongwei goat, and when the marker mutated to G, it was beneficial for the Zhongwei goat to have a longer natural hair strand length, see Table 6.

[0041] Table 6 SNP gene frequency and genotype frequency at position 6525211 on chromosome 16 of Zhongwei goat genome

[0042] The nucleotide sequence of the molecular marker containing the A→G mutation site at position 6525211 on chromosome 16 is shown in SEQ ID NO.2, specifically: TAGACTGCAATGTAAATAAAGCAACTATATTTCTTTAAAAAAAATCCATGGGTATTAATTCTGTTTTTATTGTTTGGACTCTACAGTACTTGGTCTTTTTASAATTTCACATTCTGCTATAAAAGTGTGGTTTAAACAAAAACTATGTAGAAATATTCCTGTATATTTTTATAATCTACCTTACATGGATTTTAATTCAAGGA, where S is A / G.

[0043] Further study of SNPs that reached the genome-wide significance level revealed that the T→G mutation at position 6529012 on chromosome 16 of the Zhongwei goat genome can significantly affect the natural length trait of the hair strands of the Zhongwei goat.

[0044] The association analysis between the SNP locus at position 6529012 on chromosome 16 of the Zhongwei goat genome and the natural length of the hair strands is shown in Table 7: Table 7 Polymorphism at position 6529012 on chromosome 16 of Zhongwei goat genome

[0045] Note: Different letters indicate significant differences ( P <0.05, the same letter indicates no significant difference ( P >0.05).

[0046] It can be seen from Table 7 that for individuals with genotype GG, the natural length of their hair strands is the longest.

[0047] In the whole genome association analysis, the SNP molecular marker at position 6529012 on chromosome 16 of the Zhongwei goat genome reached the genome-wide significant level, indicating that the marker was significantly associated with the natural hair strand length trait of the Zhongwei goat, and when the marker mutated to G, it was beneficial for the Zhongwei goat to have a longer natural hair strand length, see Table 8.

[0048] Table 8 SNP gene frequency and genotype frequency at position 6529012 on chromosome 16 of Zhongwei goat genome

[0049] The nucleotide sequence of the molecular marker containing the T→G mutation site at position 6529012 on chromosome 16 is shown in SEQ ID NO.3, specifically: TAGCTTTCTGTCAGAAATCTTCATGAATACTTATCATAAAATGTACTTACAGTTCCAATCTTGGAGCTGACAGAAGCTTATTAAAACACATGTACACTTGSGGCTGAGTCATGTCAATGTATGGGAAAACCACCACAATATTATAAAGTAATTAGTCTCCAATTAAAATAAATAAATTAAGTTTAAAAATGTATTTATTTTA, S is T / G.

[0050] It can be seen from this that Zhongwei goats with naturally long hair strands can be bred through the T→G mutation at position 6521711 on chromosome 16 of the Zhongwei goat genome, or through the A→G mutation at position 6525211 on chromosome 16 of the Zhongwei goat genome, or through the T→G mutation at position 6529012 on chromosome 16 of the Zhongwei goat genome, and the natural hair strand length of Zhongwei goat offspring can be increased by selecting individuals with GG genotype as the father or mother.

[0051] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0052] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0053] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A molecular marker for identifying long-haired Zhongwei goats, characterized in that: The molecular marker comprises site one, site two or site three; The nucleotide sequence of the molecular marker comprising site 1 is shown in SEQ ID NO.1, and a mutation from T to G occurs at 102 bp in SEQ ID NO.1; The nucleotide sequence of the molecular marker comprising site 2 is shown in SEQ ID NO.2, in which a mutation from A to G occurs at 102 bp; The nucleotide sequence of the molecular marker containing site three is shown in SEQ ID NO.3, in which a mutation from T to G occurs at the 102 bp position.

2. Use of the molecular marker for identifying the long-haired strands of Zhongwei goats as claimed in claim 1 in identifying the natural length trait of hair strands of Zhongwei goats.

3. The use according to claim 2, characterized in that: The method for identifying the natural length of Zhongwei goat hair strands includes the following steps: The base at the 102 bp position in the molecular marker of the goat to be tested is detected. When the base at the position is G, the natural length of the goat's hair strand is greater than the natural length of the goat's hair strand when the base at the position is T or A.

4. The use according to claim 3, characterized in that: The detection of the base at the 102 bp position in the molecular marker of the goat to be tested is carried out by using a whole genome resequencing method.

5. Use of the molecular marker for identifying long-haired Zhongwei goats as claimed in claim 1 in genetic breeding of Zhongwei goats.

6. The use according to claim 5, characterized in that: The molecular marker is used for breeding long-haired Zhongwei goats.

7. A genetic breeding method for long-haired Zhongwei goats, characterized in that: The following steps are involved: The genotype of Zhongwei goats at the 102 bp position in the molecular marker of claim 1 is detected, and individuals with the GG genotype are selected as parents to increase the natural length of the hair strands of the offspring.

Images