Rice broad-spectrum disease-resistant endogenous small peptide OsBSIP1 and application thereof
Through the basal immune response induced by the endogenous small peptide OsBSIP1 in rice, the problem of insufficient disease resistance in rice was solved, and effective resistance to a variety of pathogenic microorganisms was achieved, especially in the fight against white leaf blight.
Patent Information
- Application Number
- CN202411553748.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-03
- Publication Date
- 2025-04-04
AI Technical Summary
In the prior art, rice has insufficient broad-spectrum disease resistance and limited number of endogenous small peptides whose functions have been identified, making it difficult to effectively deal with the harm of different pathogenic microorganisms.
It provides a small endogenous rice peptide OsBSIP1, whose amino acid sequence is encoded by the rice gene OsBSIP1, which can induce the basal immune response of rice, including reactive oxygen outbreaks, PR gene upregulation expression and MAPK activation, thereby improving the disease resistance of rice.
OsBSIP1 significantly improves the disease resistance of rice, especially in its resistance to white leaf blight, and its gene knockdown significantly reduces the disease resistance of rice.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological agriculture, and in particular relates to a rice OsBSIP1 gene, which encodes an endogenous small peptide OsBSIP1 with a broad spectrum of disease resistance and regulates the basic immune response of plants and their role in disease resistance. Background Art
[0002] In the long-term co-evolution of plants and pathogenic microorganisms, a multi-level immune system has been formed. Pattern recognition receptors (PRRs) trigger plant immune responses (PTI) by recognizing pathogen-associated molecular patterns (PAMPs), which is the first line of defense for plants to respond to biotic stress; intracellular receptor proteins NLRs (nucleotide-binding site and leucine-rich repeat domain receptors) activate plant immune responses (ETI) by recognizing effector factors, which is the second line of defense for plants to respond to biotic stress. The pattern recognition receptors in the first line of defense include receptor-like kinases and receptor-like proteins. After sensing the danger signals on the surface of plants, they initiate a series of downstream immune responses, including accumulation of reactive oxygen species, influx of calcium ions, and up-regulation of related defense genes. In addition, pattern recognition receptors can also recognize plant endogenous small peptides secreted into the apoplast, thereby stimulating PTI downstream immune responses. Rice, as an important food crop, feeds more than half of the world's population and is often harmed by different pathogenic microorganisms. Bioinformatics analysis revealed that the rice genome encodes at least about 300 endogenous small peptides related to rice immunity. However, the number of endogenous small peptides whose functions have been identified is very limited. Summary of the invention
[0003] The purpose of the present invention is to solve the above problems and provide an endogenous small peptide OsBSIP1 with broad-spectrum disease resistance in rice and its application.
[0004] A rice endogenous peptide OsBSIP1, whose amino acid sequence is shown in SEQ ID NO.2; the rice endogenous secretory peptide is obtained by connecting the amino acids encoded by the codons of the rice gene OsBSIP1 through a peptide chain;
[0005] The nucleotide sequence of the rice gene OsBSIP1 encoding the rice endogenous small peptide OsBSIP1 is shown in the sequence table as SEQ ID NO.1.
[0006] Application of an endogenous small peptide OsBSIP1 from rice in inducing basic immune response of rice and improving disease resistance;
[0007] The plant basic immune response is: reactive oxygen burst induced by rice endogenous peptide OsBSIP1, up-regulated expression of PR genes and / or activation of mitogen-activated protein kinase (MAPK);
[0008] The rice endogenous small peptide OsBSIP1 is used in improving rice resistance to bacterial blight.
[0009] The rice gene OsBSIP1 is used in preparing rice varieties that improve basic immunity and disease resistance.
[0010] The rice endogenous secretory small peptide involved in the present invention is a small peptide encoded by rice gene and capable of being secreted into apoplast and its application.
[0011] The expression of the rice endogenous peptide encoding gene OsBSIP1 of the present invention is significantly induced by bacterial flagellin and chitin. The use of the synthesized rice endogenous secretory peptide OsBSIP1 to treat rice can significantly induce the basic immune response of rice, including active oxygen burst, induced expression of pathogenesis-related genes and activation of mitogen-activated protein kinase (MAPK). When the gene encoding the rice endogenous secretory peptide OsBSIP1 in rice is knocked out, its basic immune response and resistance to bacterial blight are significantly reduced. Therefore, the rice endogenous secretory peptide OsBSIP1 can induce basic immune resistance of rice, so it has the potential for broad-spectrum disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 Expression analysis of the rice endogenous secretory peptide gene OsBSIP1; A indicates that the expression of the gene OsBSIP1 is induced by the pathogen-associated molecular pattern bacterial flagellar protein flg22; B indicates that the expression of the gene OsBSIP1 is induced by the pathogen-associated molecular pattern N-acetylhexachitin;
[0013] Figure 2 Rice endogenous secreted peptide OsBSIP1 induces reactive oxygen burst in rice;
[0014] Figure 3 The rice endogenous secreted peptide OsBSIP1 induces the expression of rice pathogenesis-related genes;
[0015] Figure 4 The rice endogenous secreted peptide OsBSIP1 activates the phosphorylation of mitogen-activated protein kinase (MAPK);
[0016] Figure 5Schematic diagram of knocking out the gene OsBSIP1 in the rice Nipponbare (NIP) background using CRISPR / Cas9 gene editing technology;
[0017] Figure 6 Basic immune analysis of OsBSIP1 mutants; A shows the ROS burst of wild-type Nipponbare (NIP) and osbsip1 mutants after treating pathogen-associated molecular pattern bacterial flagellar protein flg22; B shows the ROS burst of wild-type Nipponbare (NIP) and osbsip1 mutants after treating pathogen-associated molecular pattern chitin;
[0018] Figure 7 Resistance analysis of OsBSIP1 mutant to bacterial blight; A represents the phenotype of wild-type Nipponbare (NIP) and osbsip1 mutant after inoculation with bacterial blight pathogen; B represents the statistical results of leaf spot length of wild-type Nipponbare (NIP) and osbsip1 mutant after inoculation with bacterial blight pathogen. DETAILED DESCRIPTION
[0019] Example 1 Cloning of OsBSIP1 gene
[0020] The primer design software Primer Premier 5.0 was used to design cloning primers for the target gene OsBSIP1 (base sequence as shown in the sequence table SEQ ID NO.1), and the specific sequence is as follows. RNA of the rice variety Oryza sativa L. var. Nipponbare (preserved by Jilin Agricultural University) was extracted and reverse transcribed into cDNA. Using this cDNA as a template, PCR amplification was performed with cloning primers to obtain a PCR product of bp in length, which has nucleotides 1 to 267 of the sequence shown in SEQ ID NO:1.
[0021] OsBSIP1-F: ATGGCGTGGTCGTCGTCG;
[0022] OsBSIP1-R:TTACGGCGTCCAGCATTTTC.
[0023] The PCR amplification system was prepared according to the instruction manual of Phusion DNA Polymerase, specifically: 2×PhantaMax Buffer 10 μL, dNTP Mix 0.4 μL, upstream primer (10 μM) 0.8 μL, downstream primer (10 μM) 0.8 μL, cDNA template 400 ng, Phusion DNA Polymerase 0.4 μL, and ddH2O to 20 μL.
[0024] The PCR reaction system was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 15 s, for 32 cycles; and full extension at 72°C for 5 min.
[0025] Example 2 Detection of the expression of the gene OsBSIP1 encoding an endogenous secretory small peptide in rice
[0026] The dehulled mature seeds of wild-type rice Oryza sativa L. cv. Nipponbare were first soaked in 75% ethanol for 1-2 min, then soaked in 50% sodium hypochlorite solution for 40 min for surface sterilization, rinsed with sterile water 6 times, and then placed on sterile filter paper to absorb the water, and then placed on 1 / 2 MS culture medium plates, and cultured at 28°C, 16 h light, 8 h dark for 6 days. Then the rice seedlings were placed in 1 / 2 MS liquid medium containing elicitors (1 μM flg22 or 10 mg / mL N-acetyl hexachitosan) and 0.01% silwet-L77 for 0, 3, 6, 9, and 12 hours, and then the seedlings were immediately frozen in liquid nitrogen, ground into powder, and total RNA was extracted. After mRNA was reverse transcribed into cDNA, real-time fluorescence quantitative RT-PCR was performed to detect the expression of rice OsBSIP1 gene, and OsGADPH was used as the internal reference gene. The PCR amplification primer sequences are as follows:
[0027] OsGADPH-qRT-F:CTGAGAATAAAACGTGGACGGTG;
[0028] OsGADPH-qRT-R:TCCATATCATCAGCATCGTTACAAC
[0029] OsBSIP1-qRT-F:GGCTGCTGGAAGGTGACTT;
[0030] OsBSIP1-qRT-R:GGACCTTGGTGGCAATCATT.
[0031] like Figure 1 As shown, the expression of OsBSIP1, a rice endogenous secretory peptide gene, was significantly induced by flg22 and N-acetylhexachitin. Figure 1 In the figure, A shows the expression of OsBSIP1 in rice seedlings induced by flg22, which first increases and then decreases, with the highest expression level at 6 hours; B shows the expression of OsBSIP1 in rice seedlings induced by N-acetylhexachitin, which first increases and then decreases, with the highest expression level at 9 hours.
[0032] Example 3 Rice endogenous secreted peptide OsBSIP1 induces rice basal immune response
[0033] 1. Construction of prokaryotic expression vector of OsBSIP1 gene
[0034] RNA of wild-type Nipponbare was extracted and reverse transcribed into cDNA. Using this cDNA as a template, PCR amplification was performed with the following primers to obtain a PCR product with a length of 189 bp without the coding signal peptide region, and containing restriction sites of BamHI and EcoRI at both ends. The PCR product has nucleotides 79 to 267 of the sequence shown in SEQ ID NO.1.
[0035] pGEX4T-OsBSIP1 ∆SP -F: atctggttccgcgtggatccATCATGGCGGCGAGGCTG;
[0036] pGEX4T-OsBSIP1 ∆SP -R: tcgagtcgacccgggaattcTTACGGCGTCCAGCATTTTC.
[0037] (The lowercase bases in the primers are homology arms)
[0038] The PCR amplification system was prepared according to the instruction manual of Phusion DNA Polymerase, specifically: 2×PhantaMax Buffer 10 μL, dNTP Mix 0.4 μL, upstream primer (concentration of 10 μM) 0.8 μL, downstream primer (concentration of 10 μM) 0.8 μL, cDNA template 400 ng, Phusion DNA Polymerase 0.4 μL, and dd H2O to 20 μL.
[0039] The PCR reaction system was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, and extension at 72°C for 15 s, for 32 cycles; and full extension at 72°C for 5 min.
[0040] The pGEX4T-1 vector backbone was digested with BamHI and EcoRI to obtain a linearized vector, and the PCR product was connected between the BamHI and EcoRI sites of the pGEX4T-1 vector by homologous recombination to obtain the final vector.
[0041] After sequencing, it was found that the recombinant vector was obtained by ligating the sequence of SEQ ID NO.1 from nucleotide 79 to nucleotide 267 into the BamHI and EcoRI sites of the pGEX4T-1 vector, and was a prokaryotic expression vector of the OsBSIP1 gene.
[0042] 2. In vitro purification of rice endogenous secretory peptide OsBSIP1
[0043] The constructed prokaryotic expression vector of OsBSIP1 gene was transformed into Escherichia coli BL21 strain by heat shock method. Take 2 mL of bacterial solution in 200 mL of antibiotic-free LB liquid medium, shake and culture until OD600 is 0.5-0.6, add 200 μL of 0.5 M IPTG to the bacterial solution, shake and culture for 3 h at 30℃ and 155 rpm, collect the induced bacteria, centrifuge at 6000 rpm at 4℃ for 10 min, discard the supernatant, add 30 mL of GST suspension buffer to resuspend the bacteria, ultrasonicate at 50% intensity for 1 s and stop for 9 s, and the net ultrasonic time is 3 min to break the bacteria, centrifuge at 9000 rpm at 4℃ for 30 min, add 500 μL of GST beads to 30 mL of 1× PBS buffer, rotate and mix at 4℃ in a rotator for 30 min, let stand on ice for 30 min, discard the supernatant, slowly add to the protein purification column, slowly add the obtained supernatant to the protein purification column, repeat twice, add 10 mL of GST washing 10 mL of GSTelution buffer without GSH was added to wash the protein purification column, 300 µL of GST elution buffer containing GSH was added to elute the protein, and the protein was collected in a 1.5 mL centrifuge tube and stored at 4°C.
[0044] 3. Rice endogenous secreted peptide OsBSIP1 activates rice reactive oxygen burst
[0045] Take rice leaves that have grown to an appropriate size, use a hole punch to take a 9 mm diameter leaf disc, put it in sterile water, and place it in the dark overnight to eliminate the reactive oxygen species caused by damage. The next day, add 100 μL of detection reagents, including stimulators (1 μM GST, 1 μM GST-OsBSIP1 ∆SP , 10 μM OsBSIP1 30-48 , 10 μM OsBSIP1 49-88 or distilled water), 20 μg / ml horseradish peroxidase, and 40 μM L-012. Gently pick out three leaf discs with tweezers, immerse them in the liquid in the centrifuge tube, and quickly put them into the Promega GloMax 20 / 20 chemiluminescence detector for active oxygen determination, taking a reading every 1 min for 30 minutes.
[0046] like Figure 2As shown, OsBSIP1 can significantly induce reactive oxygen burst in rice, and the minimum peptide segment that induces reactive oxygen burst is the 49-88 amino acid sequence of OsBSIP1. Figure 2 In the figure, A is the protein GST-OsBSIP1 purified in vitro ∆SP Induced reactive oxygen species burst (ROS) in rice leaves; B is the synthesis of OsBSIP1 30-48 and OsBSIP1 49-88 induced reactive oxygen species burst (ROS) in rice leaves.
[0047] 4. Rice endogenous secreted peptide OsBSIP1 induces rice PR gene expression
[0048] The hulled mature seeds of wild-type rice Oryza sativa L. cv. Nipponbare were first soaked in 75% ethanol for 1-2 min, then soaked in 50% sodium hypochlorite solution for 40 min for surface sterilization, rinsed with sterile water 6 times, and then placed on sterile filter paper to absorb the water, and then placed on 1 / 2 MS culture medium plates, and cultured at 28°C, 16 h light, 8 h dark for 6 days. The rice seedlings were then placed in a culture medium containing an elicitor (0.2 μM OsBSIP1 49-88 ) and 0.01% silwet-L77 1 / 2 MS liquid medium for 6 hours, then the seedlings were immediately frozen in liquid nitrogen, ground into powder and total RNA was extracted, and the mRNA was reverse transcribed into cDNA, and real-time fluorescence quantitative RT-PCR was performed to detect the expression of rice OsPR5 and OsPR10a genes, with OsGADPH as the internal reference gene. The PCR amplification primer sequences are as follows:
[0049] OsGADPH-qRT-F:CTGAGAATAAAACGTGGACGGTG;
[0050] OsGADPH-qRT-R:TCCATATCATCAGCATCGTTACAAC
[0051] OsPR5-qRT-F: CAACAGCAACTACCAAGTCGTCTT;
[0052] OsPR5-qRT-R:CAAGGTGTCGTTTTATTCATCAAC;
[0053] OsPR10a-qRT-F:GACATCGTGGATGGCTACTATGG;
[0054] OsPR10a-qRT-R:TCACTCACTCTAGGTGGGATATAC.
[0055] like Figure 3 As shown, the rice endogenous secreted peptide OsBSIP1 induces the expression of rice PR genes. Figure 3 In the figure, A shows the up-regulated expression of rice PR5 induced by the endogenous secretory peptide OsBSIP1; B shows the up-regulated expression of rice PR10a induced by the endogenous secretory peptide OsBSIP1.
[0056] 5. Rice endogenous secreted peptide OsBSIP1 induces rice MAPK activation
[0057] The hulled mature seeds of wild-type rice Oryza sativa L. cv. Nipponbare were first soaked in 75% ethanol for 1-2 min, then soaked in 50% sodium hypochlorite solution for 40 min for surface sterilization, rinsed with sterile water 6 times, and then placed on sterile filter paper to absorb the water, and then placed on 1 / 2 MS culture medium plates, and cultured at 28°C, 16 h light, 8 h dark for 6 days. The rice seedlings were then placed in a culture medium containing an elicitor (0.2 μM OsBSIP1 49-88 ) and 1 / 2 MS liquid medium containing 0.01% silwet-L77 for 0, 15, and 30 min, then the seedlings were immediately frozen in liquid nitrogen, ground into powder and total protein was extracted, and MAPK activation was detected by Western blot.
[0058] like Figure 4 As shown, the rice endogenous secreted peptide OsBSIP1 activates rice MAPK. Figure 3 In the figure, p42 / 44 is the antibody for detecting MAPK phosphorylation, and CBB is Coomassie Brilliant Blue staining.
[0059] Example 4 Construction of OsBSIP1 gene mutant
[0060] 1. Construction of OsBSIP1 gene mutants using CRISPR / Cas9 gene editing technology
[0061] Using the website http: / / skl.scau.edu.cn / , the editing target site of the target gene OsBSIP1 (the base sequence is shown in the sequence table SEQID NO.1) was designed. The target site location is as follows: Figure 1 As shown in the figure, the target nucleotide sequence is: GATCATGGCGGCGAGGCTGCtgg (the last three bases are PAM sites). The candidate target nucleotide sequence was inserted into the intermediate vector pYLsgRNA-OsU6a, and then the OsU6a-target-sgRNA fragment was inserted into the final vector pYLCRISPR / Cas9P using the BsaI restriction site through Golden Gate cloning. ubi-H (for specific construction steps, please refer to: MaXingliang, Zhang Qunyu, Zhu Qinlong, Liu Wei, Chen Yan, Qiu Rong, Wang Bin, Yang Zhongfang, et al. (2015) A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 8(8), 1274-1284.). The successfully constructed CRISPR / Cas9 vector was transformed into callus induced by immature embryos of wild-type Nipponbare by Agrobacterium-mediated method, and positive transgenic plants were obtained by hygromycin screening.
[0062] 2. Molecular identification of editing forms in positive transgenic plants
[0063] Using the genomic DNA of rice leaves as a template, PCR amplification was performed with the following identification primers, and the amplified products were sequenced by Sanger sequencing to analyze the editing form of the mutant.
[0064] The primers for identifying OsBSIP1 gene mutants are:
[0065] OsBSIP1-CRISPR-F:CAGCTTGGATTCTTGTCTGCC;
[0066] OsBSIP1-CRISPR-R: ATGTCCCTGACTTACCTTGTTCC.
[0067] The PCR amplification system was prepared according to the instruction manual of 2×Es Taq MasterMix (Dye), specifically: 10 μL of 2×Es Taq MasterMix (Dye), 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), 1 μg of DNA template, and ddH2O to 20 μL.
[0068] The PCR reaction system was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 2 min.
[0069] like Figure 5As shown, two homozygous knockout mutant lines, osbsip1-1 and osbsip1-3, were obtained. In the osbsip1-1 and osbsip1-3 mutants, a base T or G was inserted 95 bp downstream of the start codon ATG of the OsBSIP1 gene, resulting in a frameshift mutation, which led to the premature formation of a stop codon at 106-108 bp.
[0070] Example 5 Elicitors in osbsip1 mutants induce production of reactive oxygen species in rice
[0071] Take rice leaves that have grown to an appropriate size, use a cork punch to take a leaf disc with a diameter of 9 mm, put it in sterile water, and place it in the dark overnight to eliminate the reactive oxygen caused by damage. The next day, add 100 μL of detection reagents, including stimulants (10 μM flg22, 10 mg / mL N-acetyl hexachitosan or distilled water), 20 μg / ml horseradish peroxidase, and 40 μM L-012 to a 1.5 mL centrifuge tube. Gently pick out 3 leaf discs with tweezers, immerse them in the liquid in the centrifuge tube, and quickly put them into the Promega GloMax20 / 20 chemiluminescence detector for reactive oxygen determination, and read them every 1 min for 30 minutes.
[0072] like Figure 6 As shown, the accumulation of reactive oxygen species in rice induced by the elicitors flg22 and N-acetylcitol was significantly lower than that in the wild-type Nipponbare (NIP) variety. Figure 3 In the figure, A shows that the accumulation of reactive oxygen species in rice induced by the elicitor flg22 is significantly lower than that in the wild-type Nipponbare (NIP) variety; B shows that the accumulation of reactive oxygen species in rice induced by the elicitor N-acetylhexachitosan is significantly lower than that in the wild-type Nipponbare (NIP) variety.
[0073] Example 6 Identification of resistance to bacterial blight using the leaf clipping inoculation method
[0074] The wild-type Nipponbare (NIP) and knockout mutant lines osbsip1-1 and osbsip1-3 were planted in a greenhouse, and the rice grown for 6 weeks was inoculated with bacterial blight pathogen.
[0075] First, streak the PXO99A strain of Xanthomonas spp. frozen at -80℃ onto a beef extract peptone solid medium plate containing cephalexin antibiotics and culture at 28℃ for one day. Pick a single colony to beef extract peptone liquid medium containing cephalexin antibiotics, shake at 28℃ for 48 hours, and collect the bacteria by centrifugation at 9000 rpm for 3 min. Resuspend the bacteria with 0.1 M MgCl2 solution, centrifuge at 9000 rpm for 3 min, discard the supernatant, repeat once, and finally resuspend the bacteria with 0.1 M MgCl2 solution. Use a spectrophotometer to adjust the OD value of the bacterial suspension to 0.8 for standby use.
[0076] During inoculation, the rice grown for 6 weeks was moved to a place with suitable light and no rain. The bacterial suspension was dipped into sterilized scissors and cut about 10 cm below the tip of the penultimate leaf of each rice plant. The leaves were left for 2 weeks, and the leaves were sprayed with distilled water regularly to keep them moist. The length of the diseased spots was measured after two weeks, and the length of the lesions on the leaves of the wild-type NIP and the knockout mutant lines osbsip1-1 and osbsip1-3 was compared, thus completing the evaluation of the knockout mutant's resistance to bacterial blight.
[0077] like Figure 7 As shown, compared with the wild type, the length of the lesions on the leaves of the knockout mutant lines osbsip1-1 and osbsip1-3 was significantly longer than that of the wild type, indicating that the resistance of the knockout mutant lines osbsip1-1 and osbsip1-3 to bacterial blight was significantly reduced, and the gene OsBSIP1 encoding an endogenous secretory small peptide in rice positively regulates the disease resistance of rice.
Claims
1. A rice endogenous peptide OsBSIP1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.
2.
2. The rice gene OsBSIP1 encoding the rice endogenous small peptide OsBSIP1, the nucleotide sequence of which is shown in the sequence listing SEQ ID NO.
1.
3. Use of the rice endogenous peptide OsBSIP1 according to claim 1 in improving the basic immune response and disease resistance of rice.
4. The use according to claim 3, characterized in that: The basic plant immune response is a burst of reactive oxygen species, up-regulated expression of PR genes and / or activation of mitogen-activated protein kinase (MAPK) induced by the endogenous small peptide OsBSIP1 of rice.
5. Use of the rice endogenous peptide OsBSIP1 according to claim 1 in improving rice resistance to bacterial blight.
6. Use of the rice gene OsBSIP1 according to claim 2 in preparing rice varieties that improve basic immunity and disease resistance.