Ganoderma lucidum strain L4905 and cultivation method and application thereof

Abstract

The invention relates to a ganoderma lucidum strain L4905 and a cultivation method and application thereof, and belongs to the technical field of biology. The ganoderma lucidum strain L4905 is preserved in Guangdong Microbial Culture Collection Center on October 9, 2023, and the preservation number is GDMCC No: 63866. The ganoderma lucidum strain L4905 is short in growth cycle and stable in character. The strain has the characteristics of high gloss of sporocarp paint sample, kidney-shaped pileus, thick mushroom pulp, high yield of sporocarp and spore powder, stable cultivation character, high polysaccharide content and the like, and is suitable for substitute cultivation and popularization in most areas of Yunnan.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a Ganoderma lucidum strain L4905 and a cultivation method and application thereof. Background Art

[0002] The medicinal use of Ganoderma lucidum in my country has been recorded and applied for more than 2,000 years. For thousands of years, it has been regarded as a panacea for all diseases by the Chinese people and listed as one of the nine great Chinese herbs. In the 1950s, the No. 1 Ganoderma lucidum specimen collected from Qingdao was domesticated and cultivated by researchers from the Institute of Microbiology, Chinese Academy of Sciences, and Ganoderma lucidum was successfully cultivated for the first time. Since then, the scale of Ganoderma lucidum cultivation in my country has continued to expand, and it has rapidly developed into a major producer and exporter of Ganoderma lucidum on the market. To date, China has a history of more than 60 years of artificial cultivation of Ganoderma lucidum. The cultivation technology has been continuously developed and the scale has become larger and larger. There has been a diversification of cultivation varieties, technologies, models and raw materials. With the continuous improvement of people's living standards, the demand for Ganoderma lucidum products has continued to increase. Wild Ganoderma lucidum resources are difficult to meet the current market demand. The rational development and utilization of wild Ganoderma lucidum resources will help the healthy and sustainable development of the Ganoderma lucidum industry.

[0003] Ganoderma lucidum is included as a medicinal material in the 2020 edition of the Chinese Pharmacopoeia, and its legal Chinese medicinal material is Ganoderma lucidum Ganoderma lucidum and Ganoderma lucidum Ganoderma sinensis The dried fruiting body of Ganoderma lucidum. Ganoderma lucidum is widely used in China because of its wide distribution and high content of active ingredients such as polysaccharides and triterpenes. At present, Ganoderma lucidum is cultivated in batches all over the country. There are two cultivation methods: basswood cultivation and substitute material cultivation. The cultivation technology is becoming more and more mature, and the output is increasing year by year, achieving good economic and social benefits.

[0004] In the Ganoderma lucidum industry in Yunnan Province, there is a shortage of excellent Ganoderma lucidum cultivars, and there are currently no local specialty Ganoderma lucidum varieties bred in Yunnan Province. The cultivation suitability, yield and bioconversion rate of mature Ganoderma lucidum varieties and technologies introduced from outside the province are unstable in Yunnan Province with a multi-dimensional climate, which hinders the large-scale promotion of Ganoderma lucidum cultivated with substitute materials. At present, the supporting cultivation technologies of various varieties are relatively backward. In the actual production process, there is no supporting strain production and cultivation technology, resulting in uneven strain quality, uneven mushroom production after cultivation, and even abnormal mushroom production. The fruiting body yield is not stable enough. Therefore, it is urgent to select and breed excellent local Ganoderma lucidum varieties in Yunnan and match them with corresponding substitute cultivation management technologies. It is an urgent problem to solve in the field of microbial technology to obtain the best cultivation and management technology for Ganoderma lucidum strains through experimental research to overcome the shortcomings of existing technologies. Summary of the invention

[0005] The purpose of the present invention is to solve the deficiencies of the prior art and to provide a Ganoderma lucidum strain L4905 and a cultivation method and application thereof.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows: The first aspect of the present invention provides a Ganoderma lucidum strain L4905, wherein the Ganoderma lucidum strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0007] The second aspect of the present invention provides a cultivation method of the above-mentioned Ganoderma lucidum strain L4905, comprising the following steps: Step (1), mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, and place it in a 24°C incubator for constant temperature culture for 7-10 days; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 26°C culture room for constant temperature culture for 25-30 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 72-74 parts of sawdust, 23-25 ​​parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a constant temperature culture room at 26°C for 25-30 days, to obtain cultivated seeds; The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (4), soil-covered cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base and continues to ripen under shade conditions for 5-7 days. Then, the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and stipe differentiation stage, and at 2000-3000 Lux during the cap differentiation stage. When the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spores are bagged to collect spore powder or the fruiting bodies are collected.

[0008] Furthermore, in step (4), the cultivation base is a greenhouse or under a commercial forest; 3,000 to 4,000 bags are planted per acre under the commercial forest, and 6,000 to 8,000 bags are planted per acre in a greenhouse.

[0009] Furthermore, in step (4), the greenhouse adjusts the light intensity by means of a shade net; the commercial forest adjusts the light intensity by means of tending, felling or building a small arch shed; In step (4), the seeds can be harvested 58-60 days after planting and covering with soil.

[0010] The third aspect of the present invention provides a cultivation method of the above-mentioned Ganoderma lucidum strain L4905, comprising the following steps: Step A, mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, place it in a constant temperature culture at 24°C for 7-10 days to obtain mycelium blocks; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5°C for 7-10 days to obtain seed liquid; The shake flask seed culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 1.9-2.1 parts of yeast powder, 0.19-0.21 parts of ferric chloride, 990-1010 parts of water, and a pH of 6.0-7.0; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, culturing at 23.5-24.5° C. for 8-11 days, to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of glucose, 90-110 parts of peptone, 90-110 parts of yeast powder, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of ferric chloride, 99000-101000 parts of water, and the pH is 6.0-7.0; Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 26°C for constant temperature cultivation for 25-30 days; The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 17-19 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.5-0.8 parts of lime powder; pH value 6-8, water content 55-65%; Step E, soil covering cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base, and continues to ripen for 5-7 days under shade conditions, and then the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and the stipe differentiation stage, and the light intensity is controlled at 2000-3000 Lux during the cap differentiation stage; when the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spore powder is collected by bagging or the fruiting body is collected.

[0011] Furthermore, in step E, the cultivation base is a greenhouse or under a commercial forest; 3,000 to 4,000 bags are planted per acre under the commercial forest, and 6,000 to 8,000 bags are planted per acre in a greenhouse.

[0012] Furthermore, in step E, the greenhouse adjusts the light intensity through a shade net; the light intensity under the commercial forest is adjusted by nurturing, felling or building a small arch shed; in step E, the crops can be harvested 58-60 days after planting after covering the soil.

[0013] Furthermore, in step E, the greenhouse maintains soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration less than 0.05%; the tree density under the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.

[0014] A fourth aspect of the present invention provides the use of mycelium, fermentation broth, fruiting body or spore powder of the above-mentioned Ganoderma lucidum strain L4905 in the preparation of anti-tumor drugs or tranquilizers and sleep-promoting drugs.

[0015] A fifth aspect of the present invention provides the use of mycelium, fermentation broth, fruiting body or spore powder of the above-mentioned Ganoderma lucidum strain L4905 in the preparation of whitening and anti-inflammatory products.

[0016] The red radish strain L4905 of the present invention contains a high content of ganoderma lucidum polysaccharides and ganoderma lucidum triterpenoids. The detection method of ganoderma lucidum polysaccharide determination and ganoderma lucidum triterpenoid determination (in terms of oleanolic acid) was used for detection. The wild ganoderma lucidum strain L4905 had a polysaccharide content of 1.2% and a triterpenoid content of 3.9%. The cultivated red radish strain L4905 had a significantly improved polysaccharide content of 1.37% and a triterpenoid content of 4.28%. Ganoderma lucidum polysaccharides have a wide range of pharmacological activities, such as lowering blood sugar, lowering blood lipids, anti-thrombosis, anti-oxidation, scavenging free radicals, anti-aging, anti-radiation, anti-tumor, promoting blood circulation, regulating immunity, regulating nucleic acid and protein metabolism, promoting DNA synthesis, and promoting the proliferation of human cord blood LAK cells. Ganoderma lucidum triterpenoids have anti-inflammatory, analgesic, sedative, anti-aging, tumor cell killing, and anti-hypoxia effects.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The red ganoderma strain L4905 of the present invention has thick mycelium, fast fungus growth, less pollution and strong anti-weed ability; the fruiting body is yellow-brown, lacquer-like high gloss, the cap is kidney-shaped and the properties are stable; the mushroom shape is large, the fruiting body is thick and fleshy, and the color is grayish white to light brown; the mushroom fragrance is strong, the triterpenoid and polysaccharide content is high, the nutrients are rich, the yield and active ingredients are higher than those of the control strain, the fruiting body and the spore powder yield are high, the application value is high, and the market prospect is good.

[0018] Since the wild species of Ganoderma lucidum strain L4905 originated from Yunnan Province, the strain has a strong adaptability to the three-dimensional climate characteristics of Yunnan Province, which is specifically manifested in a wide range of temperature adaptation. The mycelium can grow normally between 10 and 32 degrees Celsius, and fruiting bodies can be produced in the temperature range of 10 to 35 degrees Celsius. The altitude adaptation range is wide, and mushrooms can be produced normally at an altitude of 1000-3000 meters. In addition, the strain is drought-resistant. Yunnan is severely drought-prone in winter and spring, and the rainy season generally comes from the end of May to the beginning of June. Therefore, it is dry and hot in early April, and the air humidity is very low, only 30%-50%. Some Ganoderma lucidum varieties introduced from other provinces and the bright-capped Ganoderma lucidum varieties bred by this unit appeared deformed in the bud stage in April, but the deformity rate of Ganoderma lucidum strain L4905 is almost 0.

[0019] The consistency and stability of the red ganoderma strain L4905 of the present invention are very good. The research team planted the red ganoderma strain L4905 of the present invention at 5 locations in Yunnan in 2023 and 2024. The ganoderma in each location grew neatly, with kidney-shaped caps, double kidneys or single kidneys, matured at the same time, and the cultivation traits were extremely stable.

[0020] The red ganoderma strain L4905 of the present invention is suitable for all cultivation methods. The research team has tried greenhouse planting, planting under native forests or walnut forests, stacking planting, planting with substitute materials covered with soil or planting with logs, and all of them can grow well. According to experimental research, planting at a 45-degree angle with a small hole in the bag is the best and has the highest yield.

[0021] The Ganoderma lucidum strain L4905 of the present invention is easy to plant, has strong adaptability, strong anti-weeding ability, and high polysaccharide and triterpene content, and is an excellent Ganoderma lucidum strain suitable for large-scale promotion and planting in Yunnan Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 For Ganoderma lucidum strain L4905 based on ITS+nrLSU+ TEF1 -α+ RPB 2. Sequence multi-gene phylogenetic tree; Figure 2 Polyacrylamide gel image of SSR molecular markers of Ganoderma lucidum strain L4905 Figure 3 The results of the antagonism test; Figure 4This is the wild strain morphology of Ganoderma lucidum L4905; among them, ab: fruiting body morphology; cd: cap section; e: cortical cells; fg: flesh skeleton hyphae; h: tube-bound hyphae; i: tube reproductive hyphae; jk: basidia or pseudo-basidiospores; lo: basidiospores; scale bars: eg is 20 mm; hl is 10 µm; mo is 5 µm.

[0023] Figure 5 These are the multi-point demonstration cultivation maps of Ganoderma lucidum strain L4905; among them, A is the demonstration cultivation map of Songming County, Kunming City; B is the demonstration cultivation map of Panlong District, Kunming City; C is the demonstration cultivation map of Wuding County, Chuxiong Prefecture; D is the demonstration cultivation map of Xundian County, Kunming City; Figure 6 The results of antagonistic culture between Ganoderma lucidum and Aspergillus versicolor; (a) is the picture of antagonistic culture of Ganoderma lucidum strain L4905 against Aspergillus versicolor; (b) is the picture of antagonistic culture of Ganoderma lucidum strain L4287 against Aspergillus versicolor; Figure 7 The Ganoderma lucidum strain L4905 was planted in small-hole bags with a 45-degree tilt and covered with soil; A was planted in oblique bags; B was planted in horizontal bags; and C was planted in vertical bags. Figure 8 This is the result diagram of the effect of carbon source on mycelium growth rate; Fig. 9 This is the result diagram of the effect of nitrogen source on mycelium growth rate; Fig.10 This is the result diagram of the effect of inorganic salts on the mycelium growth rate; Fig.11 This is the result diagram of the effect of temperature on the mycelium growth rate; Fig.12 This is the result diagram of the effect of pH on mycelial growth rate; In the figure, different lowercase letters indicate that there is a significant difference between the two (P < 0.05), and the same lowercase letters indicate that there is no significant difference between the two (P > 0.05).

[0024] The red ganoderma strain L4905 of the present invention is classified and named as: Ganoderma sp . , was deposited in Guangdong Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866. The deposit address is the Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with embodiments.

[0026] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0027] Example 1

[0028] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0029] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step (1), mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, and place it in a 24°C incubator for constant temperature culture for 8 days; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and the bottle is placed in a culture room at 26°C for 28 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 73 parts of sawdust, 24 parts of bran, 1 part of white sugar, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 60%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a constant temperature culture room at 26°C for 28 days, to obtain cultivated seeds; The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 17 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 60%; Step (4), soil-covered cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base and continued to ripen under shade conditions for 6 days. Then, the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and stipe differentiation stage, and at 2000-3000 Lux during the cap differentiation stage. When the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spores are bagged to collect spore powder or the fruiting bodies are collected.

[0030] Example 2

[0031] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0032] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step (1), mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, and place it in a 24°C incubator for constant temperature culture for 7 days; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and the bottle is placed in a 26°C culture room for constant temperature culture for 25 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 72 parts of sawdust, 23 parts of bran, 0.9 parts of sugar, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 6, water content 55%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 26°C for constant temperature culture for 25 days to obtain cultivated seeds; The cultivation substrate in the cultivation bag includes the following raw materials by weight: 77 parts of sawdust, 16 parts of wheat bran, 1.9 parts of bean cake powder, 0.9 parts of gypsum powder, and 0.8 parts of lime powder; pH value 6, water content 55%; Step (4), soil-covered cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base and continued to ripen under shade conditions for 5 days. Then, the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and stipe differentiation stage, and at 2000-3000 Lux during the cap differentiation stage. When the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spores are bagged to collect spore powder or the fruiting bodies are collected.

[0033] In step (4), the cultivation base is a greenhouse or under a commercial forest; 3,000 bags are planted per acre under the commercial forest, and 6,000 bags are planted per acre in a greenhouse.

[0034] In step (4), the greenhouse adjusts the light intensity through the shade net; the commercial forest adjusts the light intensity through the form of tending, felling or building a small arch shed; In step (4), the seeds can be harvested 58 days after planting and covering with soil.

[0035] Example 3

[0036] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0037] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step (1), mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, and place it in a 24°C incubator for constant temperature culture for 10 days; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a constant temperature culture room at 26°C for 30 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 74 parts of sawdust, 25 parts of bran, 1.1 parts of sugar, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 8, water content 65%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a culture room at 26°C for 30 days to obtain cultivated seeds; The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 79 parts of miscellaneous sawdust, 18 parts of wheat bran, 2.1 parts of bean cake powder, 1.1 parts of gypsum powder, and 1.2 parts of lime powder; pH value 8, water content 65%; Step (4), soil-covered cultivation: After the cultivation bag is fully grown with mycelium, it is transported to the cultivation base and continued to mature under shade conditions for 7 days. Then, the bag is opened with small holes and covered with soil at an angle of 45° for cultivation. The light intensity is controlled at 1000-1300 Lux during the bud stage and stipe differentiation stage, and at 2000-3000 Lux during the cap differentiation stage. When the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spores are bagged for harvesting spore powder or fruiting bodies.

[0038] In step (4), the cultivation base is a greenhouse or under a commercial forest; 4,000 bags are planted per mu of land under the commercial forest, and 8,000 bags are planted per mu of land in a greenhouse.

[0039] In step (4), the greenhouse adjusts the light intensity through the shade net; the commercial forest adjusts the light intensity through the form of tending, felling or building a small arch shed; In step (4), the seeds can be harvested 60 days after planting and covering with soil.

[0040] Example 4

[0041] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0042] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step (1), mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, and place it in a 24°C incubator for constant temperature culture for 8 days; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and the bottle is placed in a culture room at 26°C for 28 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 73 parts of sawdust, 24 parts of bran, 1 part of white sugar, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 60%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a constant temperature culture room at 26°C for 28 days, to obtain cultivated seeds; The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 17 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 1 part of lime powder; pH value 7, water content 60%; Step (4), soil-covered cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base and continued to ripen under shade conditions for 6 days. Then, the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and stipe differentiation stage, and at 2000-3000 Lux during the cap differentiation stage. When the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spores are bagged to collect spore powder or fruiting bodies are collected.

[0043] In step (4), the cultivation base is a greenhouse or under a commercial forest; 3,600 bags are planted per mu of land under the commercial forest, and 7,000 bags are planted per mu of land in a greenhouse.

[0044] In step (4), the greenhouse adjusts the light intensity through the shade net; the commercial forest adjusts the light intensity through the form of tending, felling or building a small arch shed; In step (4), the seeds can be harvested 59 days after planting and covering with soil.

[0045] Example 5

[0046] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0047] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step A, mother culture propagation: under sterile conditions, Ganoderma lucidum strain L4905 was inoculated into the mother culture PDA medium, and cultured at 24°C for 8 days to obtain mycelium blocks; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28°C for 8 days to obtain seed liquid; The shake flask culture medium includes the following raw materials by weight: 200 parts of potatoes, 20 parts of glucose, 2 parts of yeast powder, 0.2 parts of ferric chloride, 1000 parts of water, and the pH is 6.5; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24° C. for 9 days to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of glucose, 100 parts of peptone, 100 parts of yeast powder, 120 parts of potassium dihydrogen phosphate, 60 parts of ferric chloride, and 100,000 parts of water, with a pH of 6.5; Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 26°C for 28 days; The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 18 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 0.7 parts of lime powder; pH value 7, water content 60%; Step E, soil covering cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base, and continues to ripen for 6 days under shade conditions, then the bag is opened with small holes and covered with soil at an angle of 45 degrees for planting, the light intensity is controlled at 1000-1300 Lux during the bud stage and the stipe differentiation stage, and the light intensity is controlled at 2000-3000 Lux during the cap differentiation stage; when the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spore powder is collected by bagging or the fruiting body is collected.

[0048] Example 6

[0049] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0050] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step A, mother culture propagation: under sterile conditions, Ganoderma lucidum strain L4905 was inoculated into the mother culture PDA medium, and cultured at 24°C for 7 days to obtain mycelium blocks; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19 parts of glucose, 19 parts of agar powder, and 990 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5°C for 7 days to obtain seed liquid; The shake flask seed culture medium includes the following raw materials by weight: 200 parts of potatoes, 19 parts of glucose, 1.9 parts of yeast powder, 0.19 parts of ferric chloride, 990 parts of water, and the pH is 6.0; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, culturing at 23.5° C. for 8 days, to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350 parts of glucose, 90 parts of peptone, 90 parts of yeast powder, 115 parts of potassium dihydrogen phosphate, 59 parts of ferric chloride, and 99,000 parts of water, with a pH of 6.0; Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 26°C for 25 days; The cultivation substrate in the cultivation bag includes the following raw materials in parts by weight: 77 parts of sawdust, 17 parts of wheat bran, 1.9 parts of bean cake powder, 0.9 parts of gypsum powder, and 0.5 parts of lime powder; pH value 6, water content 55%; Step E, soil covering cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base, and continues to ripen for 5 days under shade conditions, and then the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and the stipe differentiation stage, and the light intensity is controlled at 2000-3000 Lux during the cap differentiation stage; when the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spore powder is collected by bagging or the fruiting body is collected.

[0051] In step E, the cultivation base is a greenhouse or under a commercial forest; 3,000 bags are planted per acre under the commercial forest, and 6,000 bags are planted per acre in the greenhouse.

[0052] In step E, the greenhouse adjusts the light intensity through the shade net; the light intensity is adjusted under the commercial forest through nurturing, felling or building small arch sheds; in step E, the crops can be harvested 58 days after planting after covering the soil.

[0053] In step E, the greenhouse maintains soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration less than 0.05%; the tree density under the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.

[0054] Example 7

[0055] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0056] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step A, mother culture propagation: under sterile conditions, Ganoderma lucidum strain L4905 was inoculated into the mother culture PDA medium and cultured at 24°C for 10 days to obtain mycelium blocks; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 21 parts of glucose, 21 parts of agar powder, and 1010 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28.5°C for 10 days to obtain seed liquid; The shake flask seed culture medium includes the following raw materials by weight: 200 parts of potatoes, 21 parts of glucose, 2.1 parts of yeast powder, 0.21 parts of ferric chloride, 1010 parts of water, and the pH is 7.0; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24.5° C. for 11 days to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2450 parts of glucose, 110 parts of peptone, 110 parts of yeast powder, 125 parts of potassium dihydrogen phosphate, 61 parts of ferric chloride, and 101,000 parts of water, with a pH of 7.0; Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 26°C for 30 days; The cultivation substrate in the cultivation bag includes the following raw materials in parts by weight: 79 parts of sawdust, 19 parts of wheat bran, 2.1 parts of bean cake powder, 1.1 parts of gypsum powder, and 0.8 parts of lime powder; pH value 8, water content 65%; Step E, soil covering cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base, and continues to ripen for 7 days under shade conditions, and then the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and the stipe differentiation stage, and the light intensity is controlled at 2000-3000 Lux during the cap differentiation stage; when the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spore powder is collected by bagging or the fruiting body is collected.

[0057] In step E, the cultivation base is a greenhouse or under a commercial forest; 4,000 bags are planted per acre under the commercial forest, and 8,000 bags are planted per acre in the greenhouse.

[0058] In step E, the greenhouse adjusts the light intensity through the shade net; the light intensity is adjusted under the commercial forest through nurturing, felling or building small arch sheds; in step E, the crops can be harvested 60 days after planting after covering the soil.

[0059] In step E, the greenhouse maintains soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration less than 0.05%; the tree density under the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.

[0060] Example 8

[0061] A red ginseng strain L4905, the red ginseng strain L4905 ( Ganoderma sp . ) was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

[0062] The cultivation method of the Ganoderma lucidum strain L4905 in this embodiment comprises the following steps: Step A, mother culture propagation: under sterile conditions, Ganoderma lucidum strain L4905 was inoculated into the mother culture PDA medium, and cultured at 24°C for 9 days to obtain mycelium blocks; The mother seed PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 20 parts of glucose, 20 parts of agar powder, and 1000 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 28°C for 8 days to obtain seed liquid; The shake flask culture medium includes the following raw materials by weight: 200 parts of potatoes, 20 parts of glucose, 2 parts of yeast powder, 0.2 parts of ferric chloride, 1000 parts of water, and the pH is 6.7; Step C, fermentation culture in a liquid fermentation tank: inoculating the seed liquid obtained in step B into a fermentation liquid culture medium, and culturing at 24° C. for 10 days to obtain a liquid strain; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2400 parts of glucose, 100 parts of peptone, 100 parts of yeast powder, 120 parts of potassium dihydrogen phosphate, 60 parts of ferric chloride, and 100,000 parts of water, with a pH of 6.7; Step D, preparation of culture seeds: inoculate the liquid culture seeds cultured in step C into a culture bag, and place it in a culture room at 26°C for 28 days; The cultivation substrate in the cultivation bag includes the following raw materials by weight: 78 parts of sawdust, 18 parts of wheat bran, 2 parts of bean cake powder, 1 part of gypsum powder, and 0.7 parts of lime powder; pH value 7, water content 60%; Step E, soil covering cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base, and continues to ripen for 6 days under shade conditions, then the bag is opened with small holes and covered with soil at an angle of 45 degrees for planting, the light intensity is controlled at 1000-1300 Lux during the bud stage and the stipe differentiation stage, and the light intensity is controlled at 2000-3000 Lux during the cap differentiation stage; when the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spore powder is collected by bagging or the fruiting body is collected.

[0063] In step E, the cultivation base is a greenhouse or under a commercial forest; 3,500 bags are planted per acre under the commercial forest, and 7,000 bags are planted per acre in the greenhouse.

[0064] In step E, the greenhouse adjusts the light intensity through the shade net; the light intensity is adjusted under the commercial forest through nurturing, felling or building small arch sheds; in step E, the crops can be harvested 59 days after planting after covering the soil.

[0065] In step E, the greenhouse maintains soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration less than 0.05%; the tree density under the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.

[0066] Application Examples 1. Origin of Ganoderma lucidum L4905 strain On August 17, 2019, the breeding team collected wild Ganoderma lucidum strains in Mengzi County, Honghe Prefecture, Yunnan Province, and obtained a pure strain, Ganoderma lucidum strain L4905, through tissue separation and purification.

[0067] 1.1 Isolation and purification (tissue separation) Small pieces of wild Ganoderma lucidum internal tissue were cut near an alcohol lamp and placed on a PDA culture medium for germination and purification to obtain pure strains. Under the same culture conditions, mycelium growth indicators such as growth rate, thickness and density were compared, and strains with weak mycelium were eliminated. Effective strains with the best mycelium growth and the ability to grow fruiting bodies were screened out to obtain the Ganoderma lucidum strain L4905, which was named "Yunling No. 1".

[0068] 1.2 Molecular identification Scrape an appropriate amount of pure culture mycelium, grind it with liquid nitrogen (or grinder), and use a plant genomic DNA extraction kit (Shanghai Shenggong Biotechnology Co., Ltd.) to extract total DNA according to the steps in the kit manual. Use RNA polymerase chain reaction (PCR) technology to select four gene fragments: ITS, nLSU, TEF-1α , RBP 2 for amplification. The base composition of the specific primers is shown in Table 1. The PCR amplification system uses a 25 μL reaction system, which includes: 12.5 μL of 2×T5 Super PCR Mix, 1 μL of each forward and reverse primer (both at a concentration of 0.1 mmoL / μL), 1 μL of DNA template, and 9.5 μL of sterile ddH2O. Then PCR amplification is performed.

[0069] Table 1 Primers and base compositions used in PCR amplification

[0070] Note: The bases include a, t, c, and g. Other letters in the primer represent degenerate bases.

[0071] The PCR reaction program for ITS was as follows: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 53°C for 30 s, and 72°C for 50 s; and finally extension at 72°C for 10 min.

[0072] The PCR reaction program for nLSU was as follows: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min.

[0073] The PCR reaction procedure for TEF1-α was as follows: initial denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, 55°C for 30 s, and 72°C for 50 s, repeated for 35 cycles, and extended at 72°C for 10 min.

[0074] RPB The PCR reaction program of 2 was as follows: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 50 s, and extension at 72°C for 10 min.

[0075] The amplified products were stored at 4°C.

[0076] Use an electronic balance to accurately weigh 1g of agarose and dissolve it in 100mL of 0.5×TBE buffer (Tris-borate-EDTA). Heat it in a microwave oven for 2.0 min on medium heat to make it clear and transparent. When the temperature reaches 65°C, add 1μL of nucleic acid dye and shake it thoroughly. Pour it into a silica gel plate, cool it for later use, put it into an electrophoresis pool and use a pipette to spot the sample. The spotting volume is 5μL. The voltage during electrophoresis is 160V, the current is 90A, and the time is 15min. After electrophoresis in 1.0×TBE buffer, observe, take pictures and record the results on a UV gel imager, detect the concentration of the extracted DNA, and send the positive products to Shanghai Bioengineering for sequencing.

[0077] The ITS sequence is: (SEQ ID NO.9) The nLSU sequence is: gcagttttgctgtccgagttgtaatctggagaagtgtcttccgcgttggaccgtgtacaagtctcttggaatagagcgtcatagagggtgagaatcccgtccatgacacggactaccaatgctctgtgatacactttctaagagtcgagttgtttgggaatgcagctcaaaatgggtggtaaattccatctaaagctaaatattggcgagagaccgatagcgaacaagtaccgtgagggaaagatgaaaagcactttggaaagagagttaaacagtacgtgaaattgttgaaagggaaacgcttcaagtcagtcgcgtcttactagactcagctttgcttcggcttagtgtacttctaataagacgggtcaacatcaattttggtcggtggaaaaaggtttgagaaatgtagcgtatcttcgggtacgtgttatagtctcttactgtatacactggctgggattgaggtctgcagcacgcctttatggccagggttcgcccatgtaacgtgcttaggatgttggcataatggctttaagcgacccgtcttgaaacacggaccaaggagtctaacatgcctgcgagtattagggtggaaaacccttgtgcgtaatgaaagtgaaagttgggaactctcgcaagggagtgcaccgacgcccggccctgaagtttacggacggtgctgcggtagagcatgtatgttgggacccgaaagatggtgaactatgcctgaatagggtgaagccagag (SEQ ID NO.10) TEF1-αThe sequence is: ttgacatcaccactcttgcctgtcttagtccagcccttgtaccatttagctctacagcgatattgtaagctttatgttaagataattaatatttgaagttagagcttactcttccaaggtggtctcctcaatcatattgtcaccttcgaaaccggaaatagggacaaacggaacgctcttagggttgtatccgaccttcttaatgaagttagaagtttccgtgacaatttcaaggaaacgtttctcctcccacttaaaggagaagcttcagcaacaaaaaggtaagaagaaagtaatatgactgaccttgacggagtccattttgttgacggcaacgatgagttgtcgtacaccgagagtgaacgcaagtagtgcgtgttcacgagtctggccatccttggagataccggcctcgaattcacccgtaccaccagcaatgatgaggataga (SEQ ID NO.11) RBP The sequence of 2 is: (SEQ ID NO.12) According to the four gene fragments (ITS, nrLSU, TEF1 -α, RPB 2) Based on the results of Blast alignment on NCBI data, the sequences of 4 gene fragments of 9 species of Ganoderma were downloaded from GenBank, aligned using Mafft and spliced ​​using SequenceMatrix, and Tomophagus colossus was used as the outgroup. Based on the combined gene sequences of the above 4 fragments, the maximum likelihood tree was constructed using RaxML and repeated 100 times, and the support rate greater than 70% was marked on the branch nodes. Figure 1 As shown in the figure, the phylogenetic analysis results showed that the Ganoderma lucidum strain L4905 and the control strain L4287 (Golden Ganoderma lucidum, which is a Ganoderma lucidum variety approved by the Sichuan Academy of Agricultural Sciences in 2008) are both Ganoderma lucidum ( G.lingzhi ) has a support rate of 100%.

[0078] 1.3 SSR molecular markers (1) DNA extraction The tested strains were transferred to potato dextrose agar solid medium and cultured at 25°C for 15 days before collecting mycelia. The genomic DNA of mycelia was extracted using the DE711-50 kit of Jinsha Biotechnology, and the purity and concentration of the DNA were detected by agarose gel electrophoresis and biospectrophotometer.

[0079] Among them, potato glucose agar solid culture medium: 200 g potatoes (peeled), 20 g glucose, 16 g agar, 2 g yeast powder, 2 g peptone, 0.2 g potassium dihydrogen phosphate, and 0.2 g magnesium sulfate.

[0080] (2) Genome sequencing After DNA extraction, purification and library construction, the samples were sequenced using sequencing technology based on a sequencing platform to search for SSR sites in the genome sequence of Ganoderma lucidum strain L4905.

[0081] (3) Development of SSR primers based on genome sequencing results Based on the Ganoderma lucidum genome data, six pairs of SSR primers were developed and screened: primer set 1, primer set 2, primer set 3, primer set 4, primer set 5, and primer set 6 to distinguish the Ganoderma lucidum strain L4905 from the control L4287. The detailed marker information is shown in Table 2.

[0082] Table 2 SSR marker primer information

[0083] (4) PCR amplification The extracted DNA was amplified by PCR using SSR markers.

[0084] The PCR amplification system was as follows: total volume 25 μL, including: 12.5 μL of Biotech 2XT5 Super PCR Mix (with Bule Dye); 1 μL of SSR marker forward primer and reverse primer (both at a concentration of 0.1 mmoL / μL), 1 μL of template DNA, 9.5 μL of sterile ddH2O; 2 μL of SSR marker forward primer and reverse primer (both at a concentration of 0.1 mmoL / μL), 2 μL of template DNA. PCR reaction conditions: 95 ℃ 2 min; 95 ℃ 30 s, 53 ℃ 30 s, 72 ℃ 30 s, 38 cycles; 72 ℃ 5 min. To ensure the accuracy of identification, the experiment was repeated three times. The L4287 strain was used under the above conditions and repeated three times as a control.

[0085] (5) Electrophoresis Polyacrylamide gel electrophoresis was performed, and silver staining was performed after electrophoresis to show bands.

[0086] Mix the following reagents: 48 mL of 1×TBE solution; 12 mL of Acr-Bis (19:1); 1 mL of 10% APS solution; 100 μL of 10% TEMED; After mixing, pour the gel immediately to remove bubbles. After the gel solidifies, perform electrophoresis; the sample volume is 2 μL per well, and the electrophoresis condition is 270 V constant voltage for 1 h. After the electrophoresis is completed, wash the gel twice with distilled water; add 400 mL of 10% silver nitrate solution and shake on a shaker for 8 minutes; after silver staining, wash it twice with water; add sodium hydroxide and formaldehyde for color development (NaOH 6 g, distilled water 400 mL, formaldehyde solution 2 mL).

[0087] Table 3 Comparison of the amplified fragment sizes of primers in Ganoderma lucidum strain L4905 and control (CK)

[0088] from Figure 2 As shown in Table 3, under the same PCR conditions, after PCR amplification using SSR primer set 1, primer set 2, primer set 3, primer set 4, primer set 5, and primer set 6, Ganoderma lucidum strains L4905 and L4287 showed different band patterns. The six pairs of SSR primers can be used to distinguish Ganoderma lucidum strains L4905 and L4287.

[0089] 1.4 Antagonism experiment The antagonistic test was conducted on the isolated Ganoderma lucidum strain L4905 and the control strain, Ganoderma lucidum strain L4287. The results showed that Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287 had a strong antagonistic reaction and no affinity, forming a "raised" antagonistic line ( Figure 3). This indicates that the two are different strains of Ganoderma lucidum. The mycelium of Ganoderma lucidum strain L4905 grows faster.

[0090] 2. Fruiting body morphological characteristics 2.1 Morphological observation results Morphological observations Figure 4 As shown, fruiting body: Basidiocarps are annual or perennial, stalked, corky, odorless, bitter when fresh, becoming corky or woody after drying. Caps are fan-shaped to rounded, 5–11 cm long, 3.5–8 cm wide, and 1.1 cm thick. The surface of the cap is yellow-brown to reddish brown without lacquer-like luster. The surface of the cap usually has concentric rings, which are more obvious near the edge, and there are usually fine (radial) grooves in the middle, and they do not crack. The edges are obvious, sharp or blunt, sometimes slightly curled, and the color is variable, light yellow, light yellow-brown to yellow-brown when young, and becomes yellow-brown to reddish brown when mature. The flesh can be up to 0.4 cm thick, and the color is usually stratified, with the upper layer being light brown and the lower layer being dark brown. It is corky, without concentric rings, and sometimes has black exocarp lines in mature basidiocarps. The tube can be up to 0.6 cm long, brown or dark brown, corky, and not stratified. There are 5-7 pores per millimeter, which are angular, nearly round or round, with slightly thick or thick tube walls, most of which are entire; the surface of the pores turns sulfur color when mature, turns brown or dark brown after being touched, and is light yellow when dry. The stipe is 5.0-13 cm×1.6-2.8 cm, lateral, dorsal or eccentric, flat or nearly cylindrical, smooth on the surface, with a strong lacquer-like luster, orange-yellow to light yellow-brown when young, and turns reddish brown to purple-black wood or cork when mature.

[0091] Three types of hyphae: reproductive hyphae with a diameter of 1-2.5 μm, with lock-like union, thin wall, colorless, uncommon; skeleton hyphae with a diameter of 2-5 μm, thick wall to sub-solid, mostly bifurcated, light brown to brown, accounting for the vast majority; winding hyphae with a diameter of 1-3 μm, thick wall, often intertwined branches, light yellow, thick wall and narrow lumen, to sub-solid rare; the above three types of hyphae are IKI - CB + ; The tissue color turns black in KOH reagent.

[0092] Pericarp cells: 22-40×7-10 μm in length and width, club-shaped, bright yellow, thick-walled to sub-solid, and in mature basidiocarps the pericarp cells usually have a strong starch reaction.

[0093] Basidiospore: (40 / 2 / 2) 9.0- 10.0- 11.0(12.0)×(5.0)5.5- 6.1-6.5(7.0) μm, Q=(1.50)1.51–1.90(2.02), Qm=1.68±0.13 (including umbilicus); oval to broad elliptical, with umbilicus, which becomes obviously truncated after falling off, light yellow-brown, KI - , C.B. + , with starch reaction, double wall, smooth outer wall, inner wall surface with moderately rough dotted patterns. Basidia broadly clavate to bladder-shaped, transparent, with lock-like joints and four basidia, 9-12×7-10 μm; pseudo-basidia pear-shaped to fusiform, 8-12×7-11 μm.

[0094] 3. Bacteria culture 3.1 Mother culture medium and its preparation (1) Mother culture medium ① The mother PDA culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; (2) Preparation of mother culture medium ① The production process of mother culture medium: material selection → accurate weighing (according to the formula) → material processing → quantitative preparation → filling in test tubes → sterilization and placement on a slope.

[0095] ② Preparation of mother culture medium A. Cooking: Peel, wash and slice potatoes, weigh 200 g, add 1000 mL of water, heat and boil until the potato slices are crisp but not mushy, and filter through six layers of gauze; B. Proportion: Add 20 g glucose and 20 g agar to the filtrate, add water to make up to 1 L, and stir to dissolve; C. Packaging and sterilization: After dissolving, pack into test tubes while hot. The general amount is 1 / 5-1 / 4 of the length of the test tube. After packing, plug with cotton plugs, 5 in a pack, and wrap one end of the test tube with kraft paper and tie it tightly. After the test tube is wrapped, put it into the autoclave and sterilize at 121℃ for 20 minutes. D. Slanted placement: After sterilization, take out the test tube while it is still hot and place it on the workbench to form a slope. Usually the length of the slope is 1 / 2 of the test tube. After it solidifies, place it in a clean and dry place for use.

[0096] ③ The mother strain is separated by tissue separation method, which has the advantages of being simple and convenient, stable genetic traits of strains, and strong regeneration ability. You only need to take the fruiting body tissue block under sterile conditions, put it on the slant culture medium, and promote it to develop into the vegetative growth stage to obtain a good strain.

[0097] A. For the fruiting bodies to be separated from the tissue, choose those that are large, thick, free of pests and diseases, slightly hard in texture, and strong in growth and development.

[0098] B. Collect fresh fruiting bodies and scrape off the impurities at the base with a knife, wipe with a cotton ball squeezed with alcohol solution, put in a culture dish, move to a clean bench, disinfect hands, burn the inoculation needle, tweezers, blade, etc. over the flame of an alcohol lamp for later use. Use a scalpel to cut a suitable size of tissue block and insert it into the culture medium. The separation site should be selected as much as possible at the junction of the stipe and the cap, because the base tissue cells have strong regeneration ability and it is easy to obtain strains with excellent traits.

[0099] C. Wrap the inoculated test tube with sealing film and place it in a constant temperature incubator at 24 ℃ for cultivation. During the cultivation process, check the growth of mycelium every day and remove any foreign bacteria in time. 24 hours after inoculation, short and weak mycelium grows around the inoculation block, which is white. Generally, the test tube can be fully grown in 7 to 10 days.

[0100] 3.2 Production of original seeds and cultivars (1) Culture matrix formula The stock culture matrix in the stock culture bottle includes the following raw materials by weight: 72-74 parts of sawdust, 23-25 ​​parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; The cultivation substrate in the cultivation bag includes the following raw materials by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; (2) Production of original seeds and cultivated seeds ① Ingredients and pretreatment: Weigh the ingredients according to the formula. Among them, the sawdust and wheat bran need to be pre-wetted with water in advance and then mixed with other auxiliary materials; buckwheat needs to be soaked in water with 0.2% lime added in advance.

[0101] ② Mix the materials and bottle (bag): Mix the processed main ingredients with other ingredients, and make sure the water content is 55-65%. Use breathable cover tissue culture bottles for original species and fungus bags for cultivated species. Fill the bottles (bags) and compact them. A hole can be punched in the center for easy inoculation.

[0102] ③Sterilization: Before sterilization, cold air must be completely removed to ensure that the bacteria in the sterilization package are completely killed. The original seed bottle is placed in an autoclave at 121°C and 0.103 MPa for 2 hours.

[0103] ④ Inoculation: Inoculation and culture of original seed. The sterilized original seed bottle is placed in the inoculation room. It should be sterilized with an ultraviolet disinfection lamp for half an hour before inoculation. During operation, the aseptic operation procedures should be strictly followed. Cut the mother seed into small pieces, inoculate the central hole of the culture medium, and connect the fruiting body small pieces to the surface. After inoculation, move all the original seed bottles into the culture room and control the temperature at 26 ℃. Check whether the original seed bottle is contaminated by bacteria at least once a week. If so, the contaminated culture bottle should be removed from the culture room in time, and the mycelium growth of the Ganoderma lucidum variety should be recorded.

[0104] 3.3 Liquid culture preparation Liquid strains can be inoculated quickly, 10 to 20 days faster than traditional solid strains. Using liquid strains to propagate the culture can shorten the production cycle and cultivate a large number of strains in a short period of time, thereby saving cultivation costs and meeting production needs. Liquid strains have the advantages of good quality, consistent bacterial age, convenient inoculation, and low cost.

[0105] Shake flask liquid culture preparation formula (1 L): 200 g potatoes, 20 g glucose, 2 g yeast powder, 0.2 g ferric chloride, 1000 mL water, pH 7.0; Seed solution preparation: Prepare liquid culture medium according to the formula, divide into 500 mL Erlenmeyer flasks, sterilize at 121 ℃ for 20 minutes, inoculate Ganoderma lucidum mycelium blocks into the liquid culture medium after cooling, and culture at 27.5-28.5 ℃ for 7-10 days to use as seed liquid.

[0106] ③ Fermentation tank production: The liquid culture formula (100L) is: 600 g soluble starch, 2400 g glucose, 100 g peptone, 100 g yeast powder, 120 g potassium dihydrogen phosphate, 60 g ferric chloride, 100000 g water, pH 7.0; B. Prepare fermentation liquid according to the recipe and cool it for later use; C. Add 1% of the cooled fermented liquid to the fermentation tank containing the seed liquid of Ganoderma lucidum strain L4905; D. After inoculation, the fermenter can be used after incubation at 23.5-24.5℃ for 8-11 days.

[0107] 3.4 Cultivation Bag Production (1) Cultivation medium formula The cultivation substrate in the cultivation bag includes the following raw materials by weight: 77-79 parts of sawdust, 17-19 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, 0.5-0.8 parts of lime powder; pH value 6-8, water content 55-65%; (2) Production of cultivation bags ①Ingredients and pretreatment: Weigh the ingredients according to the formula. Among them, miscellaneous sawdust and wheat bran need to be pre-wetted with water 24 hours in advance; dissolve the required bean cake powder, gypsum and lime in water first, then sprinkle them on the sawdust and bran, stir while adding water, pile them and simmer for 1 hour, and stir again until uniform.

[0108] ②Bagging: Use 17cm×35cm×0.05 cm polypropylene bags for bagging. The tightness should be appropriate when filling. Compact the culture medium while adding. Fill tightly. Then use a hole-guiding rod to punch a hole with a diameter of 1.5~2.0cm in the center of the material surface. The bag height is about 20cm after bagging. Put on the ring and lid. Each bag of culture medium has a dry weight of 0.5kg and a wet weight of 1.0~1.2kg.

[0109] Sterilization: Use normal pressure steam for sterilization, and exhaust cold air in advance during the heating process. When the temperature reaches 110℃, start timing and maintain this temperature for 8~10 hours. Then stop heating and let it cool down naturally. When the temperature inside the sterilizer drops below 60℃, the bags can be transferred to the cooling room for natural cooling.

[0110] Inoculation of cultivation bags: The cultivation bags and the cultivated varieties are placed in the inoculation room and sterilized with an ultraviolet disinfection lamp for half an hour before inoculation. During operation, the aseptic operation procedures should be strictly followed. First, carefully disinfect your hands, cultivation bags and tools with 75% alcohol cotton balls, burn and cool the scalpel and tweezers on the alcohol lamp, and then use the scalpel to transfer the cultivation varieties at a 1:20 expansion ratio or 20 mL / bag of liquid strains, and seal with a sterilized sponge. After inoculation, move the cultivation bag into the culture room, control the temperature at 26 ℃ for dark culture, and the bag will be full in 25-30 days. During the culture process, cultivation bags infected with miscellaneous bacteria should be selected and eliminated in time.

[0111] 4. Small test screening Ganoderma lucidum was used as a substitute for soil cultivation. According to the requirements of GB / T 21125-2007 Edible Fungi Breeding Specifications, the design of the small-scale initial screening test was 12 bags per group, with 3 replicates. Each bag contained 550 g of substrate dry material, liquid inoculation was used, and the inoculation volume per bag was 10 mL. The method of soil cultivation with a small opening at a 45-degree angle was adopted, and 6.6 kg of dry material was planted in each bag.

[0112] 4.1 Experimental design There were 12 bags in each group, and the inoculation volume of liquid culture in each group was 120 mL. The dry material for bag planting in each group was 6.6 kg. There were 3 replicates. The liquid culture volume of Ganoderma lucidum strain L4905 was 360 mL, and the dry material for bag planting was 19.8 kg.

[0113] 4.2 Results and Analysis Table 4 Statistics on mushroom yield and characteristics of Ganoderma lucidum strain L4905 in the initial screening test

[0114] Note: "M±SD" stands for mean ± standard deviation. Five bags were randomly selected from each group, and the average weight of each bag was measured for yield. For fruiting body traits, 10 fruiting bodies were randomly selected to calculate the average value.

[0115] As can be seen from Table 4, the initial screening test group of Ganoderma lucidum strain L4905 had good fruiting conditions. The yield measurement results showed that the average yield of group 1 was 63 g / bag, group 2 was 71 g / bag, group 3 was 68 g / bag, and the average yield of the three groups was 67.33 g / bag. The experimental results were good, the fruiting was more uniform, the cap was larger, the flesh was thick, the surface was yellow-brown white to light yellow with obvious edges, obvious ring patterns and radial longitudinal ridges, the average cap length was 13.10 cm, the average width was 5.12 cm; the stipe was long, oblate, brown-red, lateral, and the average length was 10.17 cm; the average fresh weight of a single fruiting body was 67.33 g, and the biological efficiency was 12.24%.

[0116] 5. Small test re-screening Ganoderma lucidum was cultivated with soil as a substitute material. According to the requirements of GB / T 21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi, the design of the small-scale re-screening test was 30 bags per group, with 3 replicates. Each bag contained 550 g of dry material, and liquid inoculation was used. The inoculation volume per bag was 10 mL, so the inoculation volume per group was 300 mL, and each group of bagged dry material was 16.5 kg.

[0117] 5.1 Experimental design There were 30 bags in each group, 300 mL of liquid culture inoculation volume in each group, 16.5 kg of bagged dry materials in each group, 3 replicates, 900 mL of liquid culture volume of Ganoderma lucidum strain L4905, and 49.5 kg of bagged dry materials.

[0118] 5.2 Results Analysis Table 5 Statistics on mushroom yield and characteristics of Ganoderma lucidum strain L4905 in small-scale rescreening

[0119] Note: "M±SD" stands for mean±standard deviation. Five bags were randomly selected from each group, and the average weight of the fruiting bodies in a single bag was measured for yield. For fruiting body traits, 20 fruiting bodies were randomly selected to calculate the average value.

[0120] As can be seen from Table 5, the red gingiva strain L4905 had good fruiting conditions in the small-scale re-screening, good uniformity of fruiting, stable cultivation traits, yellow-brown fruiting bodies, lacquer-like high gloss on the cap surface, large caps, thick flesh, with obvious ring patterns and radial longitudinal ridges, average cap length 12.37 cm, width 6.18 cm, brown fleshy layer, average thickness 1.5 cm, average stipe length 10.47 cm, average fresh weight of fruiting bodies per bag 72 g, average dry weight 28.33 g, average spore yield 20.72 g, average biological efficiency 13.09%.

[0121] 6. Intermediate Experiment Ganoderma lucidum was cultivated with soil as substitute material. According to GB / T 21125-2007 Technical Specification for Selection and Breeding of Edible Fungi, the number of cultivation in each group was 1200 bags, with 3 replicates. Each bag contained 550g of dry material, and liquid inoculation was used. The inoculation volume of each bag was 10mL, so the inoculation volume of each group was 12L, and each group of bagged dry material was 660kg.

[0122] 6.1 Experimental Design There are 1200 bags in each group, the inoculation volume of liquid culture in each group is 12L, and the bag-planted dry material in each group is 660kg. After three repetitions, the liquid culture of Ganoderma lucidum strain L4905 is 36L, and the bag-planted dry material is 1980kg.

[0123] 6.2 Results and Analysis Table 6 Statistics of mushroom yield and characteristics of Ganoderma lucidum strain L4905 in the intermediate experiment

[0124] Note: "M±SD" stands for mean ± standard deviation. Thirty bags were randomly selected from each group, and the average weight of each bag was measured for yield. Thirty fruiting bodies were randomly selected from each group to calculate the average value.

[0125] As shown in Table 6, the yield of Ganoderma lucidum strain L4905 is relatively high, the fruiting body is yellow-brown, the average cap length is 13.37 cm, the width is 6.53 cm; the average thickness is 1.52 cm, the texture is relatively soft; the stipe is reddish brown, the average length is 10.37 cm, the average fresh weight of the fruiting body is 77.67 g, the average dry weight is 30 g, the biological efficiency is 14.12%, from the initial screening of the small test, the re-screening of the small test, to the intermediate test, due to the increasingly mature artificial domestication and cultivation management technology, the average 59 days of growth and maturity began to eject spores, and the yield increased steadily. This shows that the Ganoderma lucidum strain L4905 has good stability, short fruiting cycle, high fruiting rate, high yield, and high spore powder yield.

[0126] 7. Multi-year demonstration cultivation 7.1 Experimental Design Ganoderma lucidum strain L4905 was planted in soil-covered bags as a substitute material. According to the requirements of GB / T 21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi Varieties, the number of cultivation bags in each group of the demonstration cultivation test design was 10,000 bags (three replicates at each point, and the number of repeated cultivations was about 3,600 bags). Each bag contained 550 g of dry material, and liquid inoculation was used. The inoculation volume of each bag was 10 mL, so the inoculation volume of each group was 36.0 L, and the dry material of each bag cultivation was 1,980 kg. Ganoderma lucidum strain L4287 was used as a control. Each point used the same batch of strains and cultivation bags to ensure the same strain volume and consistent demonstration cultivation management technology.

[0127] 7.2. Demonstration Site Selection Songming County, Kunming City, Yunnan Province, Panlong District, Kunming City, Wuding County, Chuxiong Prefecture, and Xundian County, Kunming City.

[0128] 7.3 Cultivation methods 1) Season selection According to natural conditions and the growth characteristics of Ganoderma lucidum, seed production (bags) begins from mid-December to early March of the following year. The cultivation season for Ganoderma lucidum is from early April to mid-June each year, and the Ganoderma lucidum harvesting season is from late June to mid-September. Ganoderma lucidum can be cultivated at natural (ambient) temperature.

[0129] 2) Site selection The cultivation sites are mostly solar greenhouses, and the sites should be sunny, leeward, dry, sanitary, and close to water sources. The sites for imitation wild Ganoderma cultivation should be selected in mountains and forests with convenient transportation, no pollution, dense forests, gentle slopes, high humidity, and deep soil.

[0130] 3) Ganoderma lucidum cultivation method ①Formula selection: The cultivation matrix in the cultivation bag includes the following raw materials by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; ② Culture material configuration Ingredients: Weigh various ingredients according to the formula. The sawdust and wheat bran need to be pre-wetted in advance.

[0131] Mixing materials: Pre-wet the raw materials, dissolve the required bean cake powder, lime and gypsum in water first, then sprinkle them on the sawdust and bran, add water while stirring, use quicklime to adjust the pH, pile it for 1 hour, and stir again until it is uniform.

[0132] Bagging: Use 17 cm × 35 cm × 0.05 cm polypropylene bags. The tightness should be appropriate when filling. Compact the culture medium while adding. Fill tightly. Then use a hole-drilling rod to punch a hole with a diameter of 1.5~2.0 cm in the center of the material surface. The bag height is about 20 cm after bagging. Put on the ring and lid. Each bag of culture medium has a dry weight of 0.55 kg and a wet weight of 1.0~1.2 kg.

[0133] Sterilization: Use normal pressure steam for sterilization. Expel cold air in advance during the heating process. When the temperature reaches 100°C, start timing and maintain the temperature for 8 to 10 hours. Then stop heating and allow the temperature to drop naturally. When the temperature inside the sterilizer drops below 60°C, the bags can be transferred to the cooling room for natural cooling.

[0134] Cooling: After sterilization, take it out and place it in the pre-cooling room or inoculation room for cooling.

[0135] ③ Vaccination When the temperature of the bag cools down to about 25 ℃, it is moved to the inoculation table and operated aseptically. One person is responsible for opening the plastic cover, removing the ring cover and pulling out the inoculation stick, and another person uses the inoculator to insert the bacteria, cover the ring and cover, mark the different varieties, and then place them in the culture room for culture.

[0136] ④Mycelium culture The inoculated cultivation bags were placed on the culture rack and cultured in the dark at room temperature with the air humidity maintained at 60-65%. The bags were observed once a week, contaminated cultivation bags were selected and discarded, and the relevant growth conditions were recorded.

[0137] Planting and management of shrubs After the fungus is cultivated, the bags are transported to the cultivation base (which can be a greenhouse or commercial forest), and continue to ripen under shade conditions for 5-7 days. Then, the bags are opened with small holes and covered with soil at a 45° angle for planting (such as Figure 7 ), 3000-4000 bags are planted per mu of land under commercial forests, and 6000-8000 bags are planted per mu of land in greenhouses. The light intensity is adjusted by tending or building small arch sheds under the forest, and the light intensity is adjusted by shade nets in the greenhouse. The light intensity is controlled at 1000-1300Lux during the bud stage and stipe differentiation stage, and at 2000-3000Lux during the cap differentiation stage. The greenhouse maintains soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration less than 0.05%, and allows it to grow naturally under the forest. When the light yellow growth circle on the edge of the cap disappears and a small amount of spores are ejected, start bagging and harvesting spore powder.

[0138] Harvest The harvesting standard of mature Ganoderma lucidum is: the cap of Ganoderma lucidum stops growing, the yellow or white color on the edge of the cap disappears completely, the single fruiting body changes from light yellow to yellow-brown, the cap begins to become leathery, and the pores under the cap begin to eject basidiospores outward. The fruiting body can be harvested when the spores are released and the color deepens. When harvesting, you can cut the stipe with a sharp blade, leaving 0.4-0.6 cm. If the main purpose is to collect spore powder, bag the powder, continue to maintain the soil humidity at 20-30%, the air humidity at 70-80%, and collect the powder for 40-50 days. When there is no more spore powder ejection, cut the Ganoderma lucidum fruiting body along the base of the stipe and collect the spore powder.

[0139] ⑥Statistics In different years, each demonstration site was surveyed and statistically analyzed. The main characteristics of the tested strains were observed and the yield was statistically analyzed. The yield was statistically analyzed after harvest. At the same time, a qualified testing company was commissioned to measure the content of main nutrients, heavy metals, pesticide residues, etc.

[0140] 7.4 Results and Analysis The results of the demonstration cultivation are shown in Figure 5 and Tables 7 to 9.

[0141] Table 7 Yield and cultivation cycle of Ganoderma lucidum strain L4905 at the demonstration site

[0142] Table 8 Main agronomic traits of Ganoderma lucidum strain L4905

[0143] Table 9 Main agronomic characteristics of Ganoderma lucidum strain L4287

[0144] Notes to Tables 7-9: “M±SD” stands for mean±standard deviation. Thirty bags were randomly selected from each group, and the average weight of each bag was used to measure the yield. Thirty fruiting bodies were randomly selected from each group to calculate the average value.

[0145] Specificity: The demonstration results of four places in two years from 2023 to 2024 showed that compared with the red ginseng strain L4287, the red ginseng strain L4905 has the characteristics of good fruiting body traits, high yield, high cultivation stability, high mushroom yield rate, and high conversion rate. The fruiting body is yellow-brown, the cap is kidney-shaped, most of them are single kidney or double kidney, with obvious ring patterns and radial longitudinal ridges, the average cap length is 13.08 cm, and the cap width is 7.32 cm; the flesh is grayish white to grayish brown, the average thickness of the flesh is 1.44 cm, and the texture is soft; the stipe is reddish brown, the average length is 10.85 cm, the color is darker than the cap, the average diameter is 1.73 cm, the average fresh weight of a single mushroom is 81.28 g, the average dry weight is 31.51 g, the biological conversion rate is 14.78%, the average spore powder yield is 24.9 g, and the average cultivation period is 59 days. Compared with the control Ganoderma lucidum strain L4287, the overall fruiting effect of Ganoderma lucidum strain L4905 was better, the cycle was shorter, the mushroom shape was larger and the flesh was thicker, the stipe was longer and the diameter was larger; the bag-grown fruiting bodies of Ganoderma lucidum strain L4287 had more heads, short stipes, and thin caps, with an average cap length of 11.03 cm and a cap width of 6.59 cm; the flesh was brown to dark brown, with an average flesh thickness of 1.08 cm, the average fresh weight of a single fruiting body was 73.60 g, the average dry weight was 29.66 g, the average spore powder yield was 21.19 g, the biological efficiency was 13.38%, and the average cultivation cycle was 65 days; therefore, Ganoderma lucidum strain L4905 can be promoted and applied as a new variety of Ganoderma lucidum, and can also realize short-cycle and high-quality under-forest and facility cultivation of Ganoderma lucidum.

[0146] Consistency: Through observations from 2 years of cultivation demonstrations, the Ganoderma lucidum strain L4905 has consistency.

[0147] Stability: Ganoderma lucidum strain L4905 is consistent and stable in principle.

[0148] 8. Variety resistance identification 8.1. Identification Method Determination of high and low temperature growth rate of mycelium: The Ganoderma lucidum strain L4905 grown on PDA medium and the control strain, Ganoderma lucidum strain L4287, were punched with a 0.5 cm hole puncher and placed on a new PDA medium for a temperature gradient growth experiment. 11 culture temperatures were set, namely 5 ℃, 10 ℃, 15 ℃, 20 ℃, 22 ℃, 24 ℃, 26 ℃, 28 ℃, 30 ℃, 32 ℃, and 35 ℃, with 3 replicates at each temperature, and the growth rate was measured after 5 days of culture.

[0149] Growth rate =

[0150] Where, R: colony growth diameter (mm); T: culture time (d); PDA medium formula: 200 g potatoes (peeled), 16 g agar, 20 g glucose, 2 g yeast powder, 2 g peptone, 0.2 g potassium dihydrogen phosphate, and 0.2 g magnesium sulfate.

[0151] Method for testing the resistance of Aspergillus versicolor: First, the Ganoderma lucidum strain L4905, Ganoderma lucidum strain L4287, and Aspergillus versicolor grown on PDA medium were punched with a hole with a diameter of 0.5 cm. Then they were placed on a new PDA plate, with Ganoderma lucidum strain on one side and Aspergillus versicolor on the other side. Each resistance experiment was repeated 3 times, and the inhibition rate was calculated.

[0152]

[0153] Among them, R CK : Normal growth radius of bacteria (cm); R1: Growth radius of bacteria in two-point confrontation experiment (cm) 8.2 Low temperature resistance test results Table 10 Mycelial growth rate of Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287 (unit: mm / d)

[0154] Results of low temperature resistance test: As can be seen from Table 10, the mycelial growth rate of Ganoderma lucidum strain L4905 was slightly stronger than that of the control strain, Ganoderma lucidum strain L4287, after being cultured for 5 days at 5 ℃, 10 ℃, 15 ℃, 20 ℃, 22 ℃ and 24 ℃; after being cultured for 5 days at low temperatures of 5 ℃ and 10 ℃, it can be seen that the mycelial germination and growth of both strains were relatively slow. After being cultured for 5 days at 15 ℃, the mycelial growth rate of Ganoderma lucidum strain L4905 was slightly higher than that of Ganoderma lucidum strain L4287. The results of culture under 20 ℃, 22 ℃ and 24 ℃ showed that the growth rules of Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287 were consistent under low temperature conditions, and the growth rate difference was small. Compared with Ganoderma lucidum strain L4287, Ganoderma lucidum strain L4905 was easier to germinate under low temperature conditions and had stronger low temperature resistance.

[0155] 8.3 High temperature resistance test results Table 11 Mycelial growth rate of Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287 (unit: mm / d)

[0156] Results of high temperature resistance test: As can be seen from Table 11, after being cultured at 26 ℃, 28 ℃, 30 ℃, 32 ℃, 35 ℃ and 40 ℃ for 5 days, the mycelium growth rate of Ganoderma lucidum strain L4905 was faster than that of Ganoderma lucidum strain L4287 as a whole, and the mycelium showed obvious slow growth or no growth as the temperature increased; under the temperature conditions of 26 ℃~28 ℃, there was no obvious difference in the growth of mycelium of Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287, and the mycelium of Ganoderma lucidum strain L4905 was denser and whiter than that of Ganoderma lucidum strain L4287; as the temperature increased, the growth rate of both tended to slow down. Under the condition of 30 ℃, the mycelium growth rate of Ganoderma lucidum strain L4905 was still faster than that of Ganoderma lucidum strain L4287. When the temperature reached 32 ℃ and 35 ℃, the mycelial growth rate of Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287 slowed down, but the growth rate of Ganoderma lucidum strain L4905 was still better than that of Ganoderma lucidum strain L4287; at 40 ℃, both did not germinate.

[0157] Combined with the results of the low-temperature resistance test, it can be found that the optimum temperature for mycelium culture of Ganoderma lucidum strain L4905 is 28℃~30℃, and the optimum temperature for mycelium culture of Ganoderma lucidum strain L4287 is 28℃~30℃. Ganoderma lucidum strain L4905 is more resistant to high temperatures than Ganoderma lucidum strain L4287.

[0158] 8.4 Results of the test against Aspergillus versicolor Table 12 Antibacterial rate of Ganoderma lucidum strain L4905 and Ganoderma lucidum strain L4287 against Aspergillus versicolor

[0159] Results: From Table 12 and Figure 6 It can be seen that in the antibacterial test of Ganoderma lucidum against Aspergillus versicolor, the antibacterial rate of Ganoderma lucidum strain L4905 is higher than that of Ganoderma lucidum strain L4287, indicating that Ganoderma lucidum strain L4905 has stronger resistance to foreign bacteria. In addition, Ganoderma lucidum strain L4905 has a low contamination rate in seed production, fast feeding speed, and is not easily infected by foreign bacteria, and has strong resistance to foreign bacteria; in the multi-batch cultivation test of breeding, foreign bacteria infection and pests and diseases are less likely to occur. Therefore, it was recorded that Ganoderma lucidum strain L4905 has a strong ability to resist diseases.

[0160] 8.5 Conclusion The mycelium of Ganoderma lucidum strain L4905 has strong growth potential, fast germination speed, fast growth rate, higher antibacterial rate against Aspergillus versicolor than that of Ganoderma lucidum strain L4287, and strong stress resistance. Mycelium can grow normally between 10~32 ℃. Cultivated at 22~32 ℃ for 4 days, the mycelium growth rate of Ganoderma lucidum strain L4905 was faster than that of Ganoderma lucidum strain L4287, and the mycelium was denser; the fruiting temperature was 10~30 ℃, and the control was 15~28 ℃; the optimum fruiting temperature was 22~28 ℃, and the control was 20~26 ℃.

[0161] 9. Distinctive identification 9.1. Solid culture characteristics After the mother strain PDA medium is prepared and mixed, it is sterilized at 121°C and 0.103MPa for 30 min and poured into a 90 mm culture dish to make a plate. After the Ganoderma lucidum strain L4905 is activated, it is transferred to the mother strain PDA medium and set aside after the mycelium fills the culture dish.

[0162] 9.1.1 Carbon source single factor screening test The basic culture medium includes the following raw materials in parts by weight: 200 parts of potato, 20 parts of glucose, 2 parts of peptone, 0.2 parts of magnesium sulfate, and 1000 parts of water; On the basis of the basic culture medium, glucose was not added as a blank control, and maltose, lactose, sucrose, and soluble starch were added to replace glucose as the test culture medium. A 7 mm diameter puncher was used to punch holes, and the bacterial block was inoculated into the center of the solid culture medium and placed in a 22 ℃ constant temperature incubator to avoid light. Each group of experiments was set up with 5 replicates. The colony diameter was measured once every 24 h using the cross-line method; the mycelial morphology and growth were observed and recorded. The data results were compared with the Duncan method of SPSS20.0 software for significant differences (P<0.05), and Excel 2019 was used to make a mycelial growth rate bar chart. The formula for mycelial growth rate (V) is: (1) Where: L: colony diameter (cm); D: culture days (d); 7: The diameter of the inoculated bacteria block is 7 mm.

[0163] 9.1.2 Nitrogen source single factor screening test On the basis of the basal culture medium, without adding peptone as a blank control, ammonium chloride, ammonium sulfate, yeast powder, and urea were used as test culture medium instead of peptone. The methods of inoculation, culture, setting of replicates, and data processing were the same as those in 9.1.1.

[0164] 9.1.3 Inorganic salt single factor screening test On the basis of the basic culture medium, magnesium sulfate was not added as a blank control, and ferric chloride, calcium carbonate, zinc sulfate heptahydrate, and sodium chloride were used as test culture medium instead of magnesium sulfate. The methods of inoculation, culture, setting of replicates, and data processing were the same as those in 9.1.1.

[0165] 9.1.4 Temperature single factor screening test Inoculate the bacterial block into the basic culture medium and culture it in a constant temperature incubator at 20 ℃, 22 ℃, 24 ℃, 26 ℃, and 28 ℃ in the dark. The methods of inoculation, culture, setting of replicates, and data processing are the same as those in 1.1.

[0166] 9.1.5 pH single factor screening test Using HCl (1 mol·L -1 ) and NaOH (1 mol·L -1 ) Adjust the pH of the basal culture medium to 5.0, 5.5, 6.0, 6.5, and 7.0 respectively as the test culture medium. The methods of inoculation, cultivation, setting of replicates, and data processing are the same as those in 9.1.1.

[0167] 9.2 Results Analysis 9.2.1 Effect of carbon source on mycelial growth rate and morphology The results of the effects of different carbon sources on mycelial growth rate and morphology are shown in Figure 8 .

[0168] Depend on Figure 8 It can be seen that when glucose was used as the carbon source, the mycelium was the whitest and densest, and the growth rate was the fastest at (15.00±0.17) mm·d -1 , and there was no significant difference with sucrose. When lactose was used as the carbon source, the mycelial growth rate was the slowest, at (7.25±0.37) mm·d -1 There was no significant difference with soluble starch, and the mycelium growth was whiter and denser than that under other carbon source conditions.

[0169] 9.2.2 Effect of nitrogen source on mycelial growth rate The results of the effects of different carbon sources on mycelial growth rate and morphology are shown in Fig. 9 .

[0170] Depend on Fig. 9 It can be seen that when yeast powder is used as a nitrogen source, the mycelium is the whitest and densest, and the growth rate is the fastest, which is (7.77±0.49) mm / d, and there is no significant difference with ammonium chloride, peptone, and ammonium sulfate. When urea is used as a nitrogen source, the mycelium growth rate is the slowest, which is (1.60±0.40) mm / d, which is significantly different from other nitrogen source conditions.

[0171] 9.2.3 Effect of inorganic salts on mycelial growth rate Depend on Fig.10 It can be seen that when ferric chloride is used as an inorganic salt, the growth rate is the fastest, which is (14.83±0.22) mm / d, which has no significant difference with sodium chloride, but has significant differences with other inorganic salts. When ferrous sulfate is used as an inorganic salt, the mycelium growth rate is the slowest, which is (8.67±0.67) mm / d.

[0172] 9.2.4 Effect of temperature on mycelium growth rate Depend on Fig.11 It can be seen that as the temperature gradually increased, the mycelial growth rate first increased and then decreased; when the temperature was 30 ℃, the mycelial growth rate was the fastest at (7.28±0.21) mm·d -1 There was no significant difference in growth rate when the temperature was 28℃. Mycelium did not germinate at 5℃, 10℃, and 40℃. When the temperature was 15℃~26℃ and 35℃, the growth rate was relatively slow, and there was a significant difference at 30℃ and 32℃. 9.2.5 Effect of pH on mycelium growth rate The results of the effects of different pH conditions on mycelial growth rate are shown in Fig.12 .

[0173] Depend on Fig.12 It can be seen that the mycelium growth rate was fastest when the pH value was 5.5, which was (14.8±0.15) mm·d -1 , which was significantly different from the other pH conditions. When the pH value was 5.0, the mycelium was the whitest and densest, but the growth rate was the slowest, at (12.17±0.16) mm·d -1 , which was significantly different from the other pH conditions.

[0174] Later research found that the best mycelium growth effect was achieved when glucose was used as the carbon source, yeast powder was used as the nitrogen source, ferric chloride was used as the inorganic salt, the temperature was 28°C, and the pH was 6.0-7.0.

[0175] 10. Quality analysis Ganoderma lucidum strain L4905 and control CK (L4287) - Jindi Ganoderma lucidum are Ganoderma lucidum varieties approved by Sichuan Province in 2008. Statistical analysis of nutrients and functional components; quality analysis report is shown in Table 13.

[0176] Table 13 Statistical table of components of Ganoderma lucidum strain L4905 and Ganoderma lucidum (L4287)

[0177] Note: *Essential amino acids The Ganoderma lucidum strain L4905 and Ganoderma lucidum grown to maturity in 2023 were sampled and low-temperature dried, and the dried products were sent to the Guangdong Provincial Microbiological Analysis and Testing Center for testing. The total amount of 16 kinds of amino acids in Ganoderma lucidum L4905 was 8.84 g / 100g, and that in Jindi Ganoderma lucidum was 10.50 g / 100 g; the protein in Ganoderma lucidum L4905 was 12.3 g / 100 g, and that in Jindi Ganoderma lucidum was 13.70 g / 100 g; the fat in Ganoderma lucidum L4905 was 1.4 g / 100 g, and that in Jindi Ganoderma lucidum was 2.40 g / 100 g; the polysaccharide content in Ganoderma lucidum L4905 was 1.37%, and that in Jindi Ganoderma lucidum was 1.07%; the triterpenes and sterols in Ganoderma lucidum L4905 were 4.28%, and that in Jindi Ganoderma lucidum were 4.64%; the polysaccharide content in Ganoderma lucidum L4905 was higher than that in Jindi Ganoderma, while the triterpenes and sterols were lower than those in Jindi Ganoderma.

[0178] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A Ganoderma lucidum strain L4905, characterized in that The red ganoderma strain L4905 is classified and named Ganoderma sp . , was deposited in Guangdong Provincial Microbiological Culture Collection Center on October 9, 2023, with the deposit number GDMCC No: 63866.

2. The cultivation method of the red ganoderma strain L4905 according to claim 1, characterized in that: The steps include: Step (1), mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, and place it in a 24°C incubator for constant temperature culture for 7-10 days; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step (2), stock seed preparation: the mother seed cultured in step (1) is inoculated into a stock seed culture bottle, and placed in a 26°C culture room for constant temperature culture for 25-30 days to obtain the stock seed; The original seed culture matrix in the original seed culture bottle includes the following raw materials in parts by weight: 72-74 parts of sawdust, 23-25 ​​parts of bran, 0.9-1.1 parts of sugar, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (3), preparation of cultivated seeds: inoculating the original seeds cultured in step (2) into a cultivation material bag, placing it in a constant temperature culture room at 26°C for 25-30 days, to obtain cultivated seeds; The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 16-18 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.8-1.2 parts of lime powder; pH value 6-8, water content 55-65%; Step (4), soil-covered cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base and allowed to mature for 5-7 days under shade conditions. Then, the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud and stipe differentiation stages, and at 2000-3000 Lux during the cap differentiation stage. When the yellowish growth ring on the edge of the cap disappears and spores begin to eject, the spores are bagged for collection of spore powder or fruiting bodies.

3. The cultivation method of the red ganoderma strain L4905 according to claim 2, characterized in that: In step (4), the cultivation base is a greenhouse or under a commercial forest; 3000-4000 bags are planted per mu of land under the commercial forest, and 6000-8000 bags are planted per mu of land in a greenhouse.

4. The cultivation method of the red ganoderma strain L4905 according to claim 3, characterized in that: In step (4), the greenhouse adjusts the light intensity through the shade net; the commercial forest adjusts the light intensity through the form of tending, felling or building a small arch shed; In step (4), the seeds can be harvested 58-60 days after planting and covering with soil.

5. The cultivation method of the red ganoderma strain L4905 according to claim 1, characterized in that: The steps include: Step A, mother culture propagation: under sterile conditions, take the Ganoderma lucidum strain L4905 and inoculate it into the mother culture PDA medium, place it in a constant temperature culture at 24 ℃ for 7-10 days to obtain mycelium blocks; The mother seed PDA culture medium comprises the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 19-21 parts of agar powder, and 990-1010 parts of water; Step B, liquid shake flask culture: inoculate the mycelium block cultured in step A into the sterilized shake flask seed culture medium, and culture in a shaker at 27.5-28.5°C for 7-10 days to obtain seed liquid; The shake flask seed culture medium includes the following raw materials in parts by weight: 200 parts of potatoes, 19-21 parts of glucose, 1.9-2.1 parts of yeast powder, 0.19-0.21 parts of ferric chloride, 990-1010 parts of water, and a pH of 6.0-7.0; Step C, liquid fermentation tank fermentation culture: inoculate the seed liquid obtained in step B into the fermentation liquid culture medium, and culture at 23.5-24.5° C. for 8-11 days to obtain liquid strains; The fermentation medium includes the following raw materials by weight: 600 parts of soluble starch, 2350-2450 parts of glucose, 90-110 parts of peptone, 90-110 parts of yeast powder, 115-125 parts of potassium dihydrogen phosphate, 59-61 parts of ferric chloride, 99000-101000 parts of water, and the pH is 6.0-7.0; Step D, preparation of cultivar: inoculate the liquid cultivar cultured in step C into a cultivation bag, and place it in a culture room at 26°C for constant temperature cultivation for 25-30 days; The cultivation matrix in the cultivation bag includes the following raw materials in parts by weight: 77-79 parts of sawdust, 17-19 parts of wheat bran, 1.9-2.1 parts of bean cake powder, 0.9-1.1 parts of gypsum powder, and 0.5-0.8 parts of lime powder; pH value 6-8, water content 55-65%; Step E, soil covering cultivation: after the cultivation bag is fully grown with mycelium, it is transported to the cultivation base, and continues to ripen for 5-7 days under shade conditions, and then the bag is opened with small holes and covered with soil at an angle of 45 degrees. The light intensity is controlled at 1000-1300 Lux during the bud stage and the stipe differentiation stage, and the light intensity is controlled at 2000-3000 Lux during the cap differentiation stage; when the light yellow growth circle on the edge of the cap disappears and spores begin to eject, the spore powder is collected by bagging or the fruiting body is collected.

6. The cultivation method of the red ganoderma strain L4905 according to claim 5, characterized in that: In step E, the cultivation base is a greenhouse or under a commercial forest; 3,000 to 4,000 bags are planted per acre under the commercial forest, and 6,000 to 8,000 bags are planted per acre in a greenhouse.

7. The cultivation method of the red ganoderma strain L4905 according to claim 6, characterized in that: In step E, the greenhouse adjusts the light intensity through the shade net; the light intensity is adjusted under the commercial forest through nurturing, felling or building small arch sheds; in step E, the crops can be harvested 58-60 days after planting after covering the soil.

8. The cultivation method of Ganoderma lucidum strain L4905 according to claim 7, characterized in that: In step E, the greenhouse maintains soil moisture at 20-30%, air humidity at 70-90%, and CO2 concentration less than 0.05%; the tree density under the commercial forest is adjusted to 6.5-7.5 to allow it to grow naturally.

9. The mycelium, fermentation liquid, fruiting body or spore powder of the Ganoderma lucidum strain L4905 according to claim 1 is used in the preparation of anti-tumor drugs or sedative drugs.

10. Use of the mycelium, fermentation liquid, fruiting body or spore powder of the Ganoderma lucidum strain L4905 according to claim 1 in the preparation of whitening and anti-inflammatory products.

Images