Paecilomyces lilacinus for preventing and treating various pathogenic bacteria as well as separation and purification method and application thereof

Abstract

The invention discloses paecilomyces lilacinus for preventing and treating various pathogenic bacteria as well as a separation and purification method and application of the paecilomyces lilacinus. The paecilomyces lilacinus strain is named as paecilomyces lilacinus GZUAS951025, the paecilomyces lilacinus strain is preserved in the Guangdong Microbial Culture Collection Center on September 23, 2024, and the preservation number of the paecilomyces lilacinus strain is GDMCC (China General Microbiological Culture Collection Center) NO. 65172. The paecilomyces lilacinus strain separated, purified and screened by the invention has a remarkable inhibition effect on phaseolus vulgaris, microascospora nivalis, fusarium solani, euphorbia clausena, fusarium equisetum and fusarium verticillium, and can be widely applied to prevention and treatment of various pathogenic bacteria diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of Paecilomyces lilacinus for preventing and treating various pathogens, and a separation and purification method and application thereof. Background Art

[0002] As my country's agriculture develops from traditional agriculture to modern agriculture, the planting area and planting varieties are gradually increasing, and the problem of plant disease prevention and control is prominent. Plant diseases are mainly divided into: bacteria, fungi, viruses and nematodes. Among them, plant pathogenic fungi refer to fungi that can parasitize living plants and cause plant diseases. At present, it is known that there are about 1.0×10 5 There are more than 8,000 fungi that can cause plant diseases, which are highly hidden, destructive, long-lasting, and difficult to control. For example, Fusarium, which causes root rot, can cause fusarium head blight in vegetables and rice and wilt in cotton and bananas, affecting the quality and yield of many cash crops.

[0003] Agricultural control is to optimize the crop growth environment through tillage, timely cultivation, crop rotation, soil disinfection and soil replacement, block the dormancy, spread and reproduction of pathogens, and reduce and prevent the probability of disease occurrence, but the control effect is limited; chemical control is to use various pesticide products for control, but it is easy to cause pesticide residues, increased resistance of pathogens, environmental pollution and damage to soil microecology. As people pay more attention to health, food safety and the environment, biological control is favored by people because of its low cost, safety and environmental friendliness. Biocontrol bacteria control by secreting secondary metabolites, occupying ecological niches and competing for nutrients, and can also be prepared into biocontrol agents, bacterial fertilizers and other products for agricultural production to achieve the purpose of increasing production and efficiency.

[0004] Paecilomyces lilacinus is an endoparasitic fungus that is widely found in nature. It is well known that it has excellent nematicidal activity and has a good control effect on aphids, spider mites and greenhouse whiteflies. In addition, it has an inhibitory effect on a variety of pathogens and can produce substances similar to auxins to promote plant growth.

[0005] At present, more than 50 species of Paecilomyces lilacinus have been reported, all of which are insect and nematode pathogens. They are well-known for their good nematicidal ability and have the advantages of high efficiency, no pollution, and easy preparation. With the deepening of research, it is no longer limited to the ability to kill insect pests, and the inhibitory effect on a variety of pathogens is also worthy of our attention. At present, there is no report on the inhibitory effect of Paecilomyces lilacinus on Phaseolus vulgaris, Microspores of snow rot, Fusarium solani, Fusarium arvense, Fusarium equisetum, and Fusarium verticillium. This study used plate confrontation and potted experiments to show the antibacterial activity of Paecilomyces lilacinus against the above pathogens. Summary of the invention

[0006] One of the purposes of the present invention is to provide a strain of Paecilomyces lilacinus that can inhibit multiple pathogens, and the strain has a significant inhibitory effect on Phaseolus vulgaris, Microspores nivalis, Fusarium solani, Fermentaria lutea, Fusarium equisetifolia, and Fusarium spp.; a second purpose of the present invention is to provide a method for separating and purifying a strain of Paecilomyces lilacinus that can inhibit multiple pathogens; a third purpose of the present invention is to provide an application of Paecilomyces lilacinus in the preparation of pathogen inhibitors, specifically in the preparation of antagonists to Phaseolus vulgaris, Microspores nivalis, Fusarium solani, Fermentaria lutea, Fusarium equisetifolia, and Fusarium spp.

[0007] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0008] The present invention discloses a strain of Purpureocillium lilacinum for preventing and controlling multiple pathogens. The strain is named Purpureocillium lilacinum GZUAS951025, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024 with a deposit number of GDMCC NO 65172.

[0009] The invention discloses an application of the Purpureocillium lilacinum GZUAS951025 in preparing a pathogen inhibitor.

[0010] The inhibitor of the present invention is specifically: the use of the Paecilomyces lilacinus strain in the preparation of any one or more antagonists of Phaseolus vulgaris, Microsporum nivalis, Fusarium solani, Fusarium argentea, Fusarium equisetifolia and Fusarium pseudoverticillium.

[0011] The separation and purification method of Purpureocillium lilacinum GZUAS951025 of the present invention comprises the following steps:

[0012] S1, collect fresh soil from betel nut trees, use the five-point sampling method, weigh the soil into a triangular bottle, add sterile water, mix evenly in a shaker, take out after half an hour, and obtain the bacterial solution for standby use;

[0013] S2. Take the evenly mixed soil stock solution, add sterile water to dilute it, repeat the above steps to obtain the bacterial dilution solution, take a certain concentration of the bacterial dilution solution and spread it on the PDA plate. Repeat three treatments. After culturing for 3 days, pick out the single colony whose color changes from white to light purple and inoculate it into the PDA medium for purification culture.

[0014] Preferably, step S1 of the present invention specifically comprises: collecting fresh areca palm soil, sampling by the five-point method, weighing 10 g of soil into a triangular flask, adding 100 mL of sterile water, mixing evenly in a shaker at 28° C. and 160 rpm, taking out after half an hour, obtaining a bacterial solution for standby use.

[0015] Preferably, step S2 of the present invention is specifically as follows: take 1 mL of the uniformly mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Bacterial dilution, take 10 -2 -10 -5 100 μL of bacterial dilution with a concentration of 100 μL was spread on the PDA plate, and the treatment was repeated three times. After culturing for 3 days, a single colony whose color changed from white to light purple was picked out and inoculated into the PDA medium for purification culture.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] 1. The Purpureocillium lilacinum GZUAS951025 obtained by the separation, purification and screening method of the present invention is a new strain that can inhibit multiple pathogens, and has inhibitory effects on Phaseolus vulgaris, Microspores of nivalis, Fusarium solani, Fusarium argentea, Fusarium equisetum, and Fusarium spp.

[0018] 2. The present invention confirms through the broad-spectrum antibacterial test of Paecilomyces lilacinus that the inhibition rate of the Paecilomyces lilacinus strain on the bean shell is 60.6±1.02%, the inhibition rate of Fusarium solani is 60.25±1.87%, the inhibition rate of Fusarium solani is 49.98±3.77%, the inhibition rate of Microdochium nivalis is 48.61±2.74%, the inhibition rate of Fusarium equisetum is 35.29±1.1%, and the inhibition rate of Fusarium erythrorhizium is 31.52±1.39%, indicating that the Paecilomyces lilacinus strain has a significant inhibitory effect on the above-mentioned pathogens.

[0019] 3. The present invention confirms through a potted plant experiment on the prevention and control of Fusarium oxysporum disease by the fermentation liquid of the Paecilomyces lilacinus strain that the fermentation liquid of the Paecilomyces lilacinus strain can effectively inhibit the occurrence of the disease; after root irrigation treatment with the fermentation liquid of the Paecilomyces lilacinus strain, the disease index is significantly reduced compared with the clear water control group, and the prevention and control effect is 55%.

[0020] Storage information description:

[0021] The isolated strain was classified and named as: Paecilomyces lilacinus GZUAS951025

[0022] Depository: Guangdong Microbiological Culture Collection Center

[0023] Storage address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou

[0024] Deposit date: September 23, 2024

[0025] Deposit number: GDMCC NO.65172 BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 :PDA surface morphology of Paecilomyces lilacinus GZUAS951025

[0027] Figure 2 :Morphology of Paecilomyces lilacinus GZUAS951025 under microscope

[0028] Figure 3 :Phylogenetic tree of Paecilomyces lilacinus GZUAS951025

[0029] Figure 4 : Plate confrontation of Paecilomyces lilacinus against various pathogens (A: Phaseolus vulgaris, B: Microsporum nivalis, C: Fusarium solani, D: Fusarium solani, E: Fusarium equisetum, F: Fusarium pseudoverticillium)

[0030] Figure 5 :Pot experiment of using Paecilomyces lilacinus to control Fusarium spp. disease (plants not inoculated with Paecilomyces lilacinus (left), plants inoculated with Paecilomyces lilacinus (right)) DETAILED DESCRIPTION

[0031] The present invention will be further described in detail below in conjunction with specific embodiments and accompanying drawings. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention relates.

[0032] Example 1

[0033] Purpureocillium lilacinum GZUAS951025, named: Purpureocillium lilacinum GZUAS951025, was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024, with the collection number: GDMCCNO.65172.

[0034] Example 2 Isolation and purification of Paecilomyces lilacinus

[0035] Step 1: Collect fresh soil from Areca palm trees in Hainan Province, sample using the five-point method, weigh 10 g of soil in a triangular flask, add 100 mL of sterile water, mix well in a shaker at 28° C. and 160 rpm, and take out after half an hour for later use;

[0036] Step 2: Take 1 mL of the mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Take 10 -2 -10 -5 100 μL of bacterial dilution with different concentrations was spread on PDA plates, with three replicates for each treatment; after culturing at 28°C for 3 days, single colonies whose color changed from white to light purple were picked out and inoculated into new PDA medium for purification until a single uncontaminated colony grew.

[0037] Example 3 Isolation and purification of Paecilomyces lilacinus

[0038] Step 1: Collect fresh soil from Areca palm trees in Hainan Province, sample using the five-point method, weigh 10 g of soil in a triangular flask, add 100 mL of sterile water, mix well in a shaker at 26° C. and 150 rpm, and take out after half an hour for later use;

[0039] Step 2: Take 1 mL of the mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Take 10 -2 -10 -5 100 μL of bacterial dilution with different concentrations was spread on PDA plates, with three replicates for each treatment; after culturing at 26°C for 4 days, a single colony whose color changed from white to light purple was picked out and inoculated into a new PDA medium for purification until a single uncontaminated colony grew.

[0040] Example 4 Isolation and purification of Paecilomyces lilacinus

[0041] Step 1: Collect fresh soil from Areca palm trees in Hainan Province, use the five-point sampling method, weigh 10 g of soil into a triangular flask, add 100 mL of sterile water, mix well in a shaker at 30°C and 170 rpm, and take out after half an hour for later use;

[0042] Step 2: Take 1 mL of the mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Take 10 -2 -10 -5 100 μL of bacterial dilution with different concentrations was spread on PDA plates, with three replicates for each treatment; after culturing at 30°C for 2 days, single colonies whose color changed from white to light purple were picked out and inoculated into new PDA medium for purification until a single uncontaminated colony grew.

[0043] Example 5 Identification of Paecilomyces lilacinus

[0044] 1. Morphological identification of strains

[0045] The surface morphology of Paecilomyces lilacinus on PDA plates: 1-2 days after inoculation, the colonies are white and round. On the third day, they begin to turn from the middle of the colonies to lavender, with smooth edges. The colonies are flat, dense, and powdery. Under the microscope: a single hyphae is derived from the main hyphae, and then smaller hyphae are derived from the conidia and spores are produced. The conidia are single-celled and ovoid, forming discrete conidia chains. See Figure 1 to Figure 2 .

[0046] 2. Molecular Biological Identification of Strains

[0047] Using ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGA TATGC) sequences as primers, the isolated Paecilomyces lilacinus was identified by ITS molecular analysis, and a phylogenetic tree was constructed based on the sequencing results to determine its species relationship. Figure 3 .

[0048] The ITS region sequence is as follows:

[0049] GCGGAGGGATCATTACCGAGTTATACAACTCCCAAACCCACTGTGAA

[0050] CCTTACCTCAGTTGCCTCGGCGGGAACGCCCCGGCCGCCTGCCCCCGCGCC

[0051] GGCGCCGGACCCAGGCGCCCGCCGCAGGGACCCCAAACTCTCTTGCATTA

[0052] CGCCCAGCGGGCGGAATTTCTTCTCTGAGTTGCACAAGCAAAAACAAATG

[0053] AATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACG

[0054] CAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGA

[0055] ATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTC

[0056] GAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGA

[0057] CGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCCCGCCGCAGCCTCC

[0058] CCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGGCGGTCACGCCG

[0059] TAAAACGCCCAACTTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCG

[0060] CTGAACTTAAGCATATC

[0061] ITS Identification:

[0062] Through homology comparison on the NCBI website (http: / / www.ncbi.nlm.nih.gov / BLAST), GZUAS951025 has the highest sequence homology with Purpureocillium lilacinum in Gene Bank, with a confidence level of up to 99%.

[0063] Example 6 Plate confrontation test of Paecilomyces lilacinus against various pathogens

[0064] PDA solid culture medium was prepared, and pathogens such as Phaseolus vulgaris, Fusarium solani, Fusarium verticillioides, Microsporum nigrostriatum, Fusarium equisetum, and Fusarium rot were activated. The above pathogens were inoculated in the middle of the plate, and Paecilomyces lilacinus was inoculated on both sides of the pathogens. The culture was carried out at 28°C for five days, and the inhibition diameter was measured. The inhibition rate was calculated according to the formula: inhibition rate = (normal growth diameter of pathogens - inhibited growth diameter of pathogens) / normal growth diameter of pathogens. The results are shown in Table 1. Figure 4 .

[0065] As can be seen from Table 1, the inhibition rate of the Paecilomyces lilacinus strain on the bean shell is 60.6±1.02%, the inhibition rate of Fusarium solani is 60.25±1.87%, the inhibition rate of Fusarium solani is 49.98±3.77%, the inhibition rate of Microdochium nivalis is 48.61±2.74%, the inhibition rate of Fusarium equisetum is 35.29±1.1%, and the inhibition rate of Pseudomonas aeruginosa is 31.52±1.39%, indicating that the Paecilomyces lilacinus strain has a significant inhibitory effect on the above pathogens.

[0066] Table 1 Inhibition rate of Paecilomyces lilacinus against various pathogens

[0067]

[0068] Example 7 Potted plant test of using Paecilomyces lilacinus to control Fusarium verticillioides disease on cotton

[0069] The plants were inoculated for the first time: the experimental group used the root irrigation method to inoculate the plants with a suspension of Paecilomyces lilacinus spores (1×10 6 CFU / mL) was added to the seedling pot, 20 mL per pot. The control group was only added with the same amount of water. The second inoculation was carried out 7 days after the first inoculation. The experimental group and the control group were simultaneously inoculated with a spore suspension of Fusarium spp. (1×10 7 CFU / mL), 30mL was added to each seedling pot. Repeat 3 times. The disease was measured on the 10th day after inoculation. The disease of the plants was observed.

[0070] Potted plant disease classification standards:

[0071]

[0072] (In the formula, Ni is the number of diseased plants at each level, i is the disease level index, and N is the total number of plants investigated)

[0073]

[0074]

[0075] The pot experiment of the Paecilomyces lilacinus fermentation liquid on the prevention and control of Fusarium verticillioides disease confirmed that the Paecilomyces lilacinus fermentation liquid can effectively inhibit the occurrence of the disease; the total number of investigations was 30 strains, and the control group had 2, 9, 8, 9 and 2 strains in the 0-4 disease level respectively; the experimental group had 10, 15, 3, 2 and 0 strains in the 0-4 disease level respectively after root irrigation treatment with the Paecilomyces lilacinus fermentation liquid. According to the disease classification standard, the disease index of the control group was 50%, and the disease index of the experimental group was 22.5%. The disease index was significantly lower than that of the clear water control group. According to the formula of control effect = (control group disease index - treatment group disease index) / control group disease index × 100%, the control effect was 55%.

[0076] Although the present invention has been described in detail above by means of general description, specific implementation methods and experiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A strain of Paecilomyces lilacinus for controlling multiple pathogens, characterized in that: The strain was named Purpureocillium lilacinum GZUAS951025 and was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 23, 2024 with the deposit number GDMCC NO 65172.

2. Use of the Purpureocillium lilacinum GZUAS951025 as claimed in claim 1 in the preparation of pathogen inhibitors.

3. The use according to claim 2, characterized in that: The inhibitor is a strain of Paecilomyces lilacinus used in the preparation of Phaseolus vulgaris, Microspores of Nivalis, Fusarium solani, Fusarium solani, Application of any one or more of Fusarium equisetifolia and Fusarium oxysporum as antagonists.

4. A method for separating and purifying Purpureocillium lilacinum GZUAS951025 as claimed in claim 1, characterized in that: The steps include: S1, collect fresh soil from betel nut trees, use the five-point sampling method, weigh the soil into a triangular bottle, add sterile water, mix evenly in a shaker, take out after half an hour, and obtain the bacterial solution for standby use; S2. Take the evenly mixed soil stock solution, add sterile water to dilute it, repeat the above steps to obtain the bacterial dilution solution, take a certain concentration of the bacterial dilution solution and spread it on the PDA plate. Repeat three treatments. After culturing for 3 days, pick out the single colony whose color changes from white to light purple and inoculate it into the PDA medium for purification culture.

5. The method for separating and purifying Purpureocillium lilacinum GZUAS951025 according to claim 4, characterized in that: The step S1 specifically comprises: collecting fresh soil from betel nut trees, sampling by a five-point method, weighing 10 g of soil into a triangular flask, adding 100 mL of sterile water, mixing evenly in a shaker at 28° C. and 160 rpm, taking out after half an hour, obtaining a bacterial solution for standby use.

6. The method for separating and purifying Purpureocillium lilacinum GZUAS951025 according to claim 5, characterized in that: The step S2 is specifically as follows: take 1 mL of the uniformly mixed soil stock solution, add 9 mL of sterile water to dilute, and repeat the above steps to obtain 10 -1 -10 -5 Bacterial dilution, take 10 -2 -10 -5 100 μL of bacterial dilution with a concentration of 100 μL was spread on the PDA plate, and the treatment was repeated three times. After culturing for 3 days, a single colony whose color changed from white to light purple was picked out and inoculated into the PDA medium for purification culture.

Images