Preparation method and application of lysate of bamboo leaf fermentation of Saccharomyces cerevisiae

Abstract

The present invention belongs to the technical field related to microorganisms, and specifically relates to a preparation method and application of a lysate of bamboo leaves fermented by brewer's yeast. The present invention discloses a preparation method of a lysate of bamboo leaves fermented by brewer's yeast, comprising the following steps: preparing seed liquid; inoculating the seed liquid into a fermentation culture medium as a fermentation system for fermentation to obtain a fermentation liquid; the fermentation culture medium is composed of bamboo leaf powder, glucose and deionized water; filtering and centrifuging the fermentation liquid, homogenizing and centrifuging, sterilizing and centrifuging, and the obtained supernatant is a lysate of bamboo leaves fermented by brewer's yeast. The present invention also provides the use of the above-mentioned bamboo leaves fermented by brewer's yeast, which is any of the following: preparing antioxidant substances, preparing whitening substances, preparing antibacterial substances, and other active substances.

Description

Technical Field

[0001] The invention belongs to the technical field related to microorganisms, and particularly relates to a preparation method and application of bamboo leaf lysate fermented by brewer's yeast. Background Art

[0002] Bamboo leaf extract has a unique position in the personal care industry due to its rich bioactive ingredients and excellent skin care effects, and has become a favorite in many high-end and natural product lines. Bamboo leaves are rich in flavonoids and polyphenols, which have strong antioxidant capacity, can effectively resist free radicals, reduce skin damage caused by oxidative stress, and delay the aging process. For sensitive or damaged skin, bamboo leaf extract can play a good soothing role, reduce erythema and tingling, accelerate skin self-repair, and rebuild skin barrier function. It meets the high standards of contemporary consumers for natural, organic, and harmless. It comes from bamboo forests that are sustainably planted and managed, reduces dependence on chemical ingredients, and is more skin-friendly and safe. The unique advantage of bamboo leaf extract lies in its diversified efficacy combination, which can solve a variety of skin problems while emphasizing overall conditioning and maintenance, which fits the modern people's pursuit of efficient and convenient skin care concepts while focusing on natural purity.

[0003] The research and application of yeast fermentation lysate has been a hot topic in the field of biotechnology worldwide in recent years. Since the beginning of this century, many international studies have focused on verifying the specific efficacy of yeast fermentation lysate, especially its mechanism of action in improving immunity, promoting nutrient absorption, maintaining intestinal health, anti-aging and assisting in the treatment of chronic diseases.

[0004] Yeast fermentation lysate filtrate is highly valued by the global scientific research community for its wide range of health benefits. Estee Lauder has worked with CLR Laboratories in Germany to jointly develop bifid yeast fermentation lysate, which refers to the lysate of bifidobacterium cells, including all cell components (cell membrane, organelles, lysate components of the nucleus) and metabolites that are not excreted from the body (small molecule organic acids, amino acids, vitamins, etc.). Bifid yeast fermentation lysate can be widely used in high-end skin care products, which are known for their excellent repair and anti-aging effects, largely due to the presence of bifid yeast fermentation lysate. In these skin care products, bifid yeast fermentation lysate is often listed as an important ingredient for repairing micro-damage to the skin, enhancing the skin's defenses, delaying photoaging, promoting DNA repair, and improving overall skin brightness and elasticity.

[0005] Yeast has been used in domestic cosmetic raw materials to prepare various fermentation filtrates, including yeast / soy protein fermentation products, yeast / rice fermentation products, yeast fermentation products, yeast fermentation lysates, etc. There are many brands of anti-aging and repair cosmetics on the market, with different effects and varying degrees of popularity among consumers. From the analysis of the sources of anti-aging and repair, there are products from plant sources to protect the skin from aging and repair, products that inhibit aging and protect the skin from oxidation, and products that fight cell aging. In application, skin care products usually combine several anti-aging and repair substances at the same time to achieve anti-aging and repair effects. However, many cosmetics do not have synergistic effects, so they often fail to reach the best state.

[0006] In recent years, more and more probiotic fermentation lysates (such as bifid yeast lysates) have been added to cosmetics. How to produce safe and functional lysate raw materials has become a technical issue that needs to be continuously optimized. So far, there has been no report on the use of yeast fermentation bamboo leaves to prepare lysates to repair UV-damaged skin, nor has there been any report on its effect on the expression levels of skin-related genes.

[0007] The invention of CN117338686A, "Whitening and anti-allergic cream and its preparation method", informs that the raw materials of the whitening and anti-allergic cream include the following components: plant fermentation liquid component, self-made nano-platinum powder, Chinese medicine anti-allergic extraction component and plant extraction component; the plant fermentation liquid component is prepared by fermenting dendrobium, polygonatum and bamboo leaves with brewer's yeast seed liquid; that is, the dendrobium powder, polygonatum powder, bamboo leaf powder and glucose are mixed and added to deionized water after conventional sterilization treatment as the fermentation component; the whitening and anti-allergic cream has the functions of anti-oxidation, whitening and anti-aging. Its fermentation system is complex. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a preparation method and application of a lysate of bamboo leaf fermentation of brewer's yeast.

[0009] In order to solve the above technical problems, the present invention provides a method for preparing a lysate of bamboo leaf fermentation of Saccharomyces cerevisiae, comprising the following steps: 1) Prepare seed solution: inoculate the fermentation bacteria into YPD liquid medium to obtain seed solution; 2) Fermentation: The seed solution was inoculated into the fermentation medium at a volume inoculation rate of 9-11% as a fermentation system, and then fermented under the following conditions: temperature 28-37°C (preferably 29-31°C), stirring speed 150-250 rpm, air flow rate 0.25-0.75 Nm 3 / h, ferment until the pH value of the fermentation system no longer decreases (generally, the pH value no longer decreases within 2 to 3 hours is used as the judgment condition, and the total fermentation time is about 45±1h), and then the fermentation is terminated to obtain the fermentation liquid; The fermentation culture solution is composed of the following components by weight: 1±0.1% of bamboo leaf powder (Phyllostachys pubescens bamboo leaf powder), 2±0.1% of glucose, and the balance is deionized water; 3) The fermentation liquid obtained in step 2) is filtered and centrifuged, homogenized and centrifuged, sterilized and centrifuged, and the obtained supernatant is the lysate of bamboo leaf fermentation of Saccharomyces cerevisiae (hereinafter referred to as lysate).

[0010] As an improvement to the method for preparing the lysate of bamboo leaf fermentation of Saccharomyces cerevisiae of the present invention: the fermentation bacteria in step 1) is Saccharomyces cerevisiae CICC 31105.

[0011] Purchased from China Industrial Microbiological Culture Collection Center (CICC), strain number: CICC 31105, scientific name: Saccharomyces cerevisiae.

[0012] As a further improvement of the method for preparing the lysate of bamboo leaf fermentation of brewer's yeast of the present invention, the method for preparing the seed solution in step 1) comprises the following steps: S1. Activation of strains: Activate Saccharomyces cerevisiae CICC 31105 by streaking on malt extract agar medium to obtain activated Saccharomyces cerevisiae; S2. Seed liquid expansion: inoculate the activated Saccharomyces cerevisiae into YPD liquid culture medium and culture in a shaking incubator (200-250 rpm) at 28±0.5℃ for 20±2h.

[0013] As a further improvement of the method for preparing the brewer's yeast bamboo leaf fermentation lysate of the present invention, the preparation method of the moso bamboo leaf powder (Jingshan bamboo leaf powder) in the fermentation culture medium of the step 2) is: take moso bamboo leaves (Jingshan bamboo leaves), wash them and dry them at 50±5°C for 3~5 days, and then crush them to pass through a 40~100 mesh sieve to obtain moso bamboo leaf powder.

[0014] As a further improvement of the method for preparing the lysate of the fermentation of Saccharomyces cerevisiae bamboo leaves of the present invention, the fermentation in step 2) includes an early fermentation stage and a mid-to-late fermentation stage: The fermentation start (fermentation hour 0) ~ fermentation hour 10 belongs to the early stage of fermentation, set the temperature to 30±0.5℃, the speed to 150~200rpm, and the air flow to 0.25~0.75Nm 3 / h; The air flow rate at the beginning of fermentation is 0.25Nm 3 / h; ferment the bacteria under natural DO value (dissolved oxygen) conditions; when the DO value drops to 0.1%, increase the air flow rate so that the DO value is controlled at 0.1~1%, and the maximum air flow rate cannot exceed 0.75Nm 3 / h; then continue to adjust the air flow rate to 0.25 ~0.75Nm 3 / h, thereby controlling the DO value to 0.1~1%; Note: The early stage of fermentation is the rapid growth period of brewer's yeast. Brewer's yeast uses glucose as the main carbon source. The initial DO value of fermentation is 100%. As the yeast grows, the DO value drops rapidly (the DO value drops rapidly to 0.1% within 1 hour). Therefore, it is necessary to increase the air flow rate to control the DO value at 0.1~1%; the maximum air flow rate does not exceed 0.75Nm 3 / h. After (8±1) hours, the DO value will gradually rise to more than 1%. At this time, the air flow rate needs to be reduced so that the DO value is still controlled at 0.1~1%. After 10 hours of fermentation, it enters the middle and late stages of fermentation. Set the temperature to 30±0.5℃, the speed to 200~250rpm, and the air flow to 0.25~0.75Nm 3 / h, and control the DO value to 0.1~1%; when the pH value of the fermentation system no longer decreases, the fermentation is judged to be over (the total fermentation time is about 45±1h).

[0015] Description: The fermentation process in the middle and late stages of fermentation is relatively stable. Saccharomyces cerevisiae uses the ethanol and bamboo leaf polysaccharides produced by fermentation as carbon sources for metabolism. During this process, the pH value slowly decreases and the DO value decreases very slowly. Therefore, the rotation speed is increased compared to the early stage of fermentation to control the DO value at 0.1~1%. Generally, the fermentation is concluded when the pH value no longer decreases within 2~3 hours. The fermentation time is about 45±1h.

[0016] As a further improvement of the method for preparing the lysate of bamboo leaf fermentation of Saccharomyces cerevisiae of the present invention, in step 3): The filtration and centrifugation is as follows: the fermentation liquid is filtered through gauze and then centrifuged (at a speed of 3500-4500r for 15-20 minutes), and the solid part obtained by centrifugation is the fermentation mixture (including bamboo leaf residue and brewer's yeast); The homogenization and centrifugation include homogenization and secondary centrifugation; The homogenization comprises: firstly diluting the fermentation mixture with water to form a suspension, wherein the mass content of the fermentation mixture in the suspension is 15-35% (preferably 25-30%); and then performing a homogenization and crushing process to obtain a lysate; The secondary centrifugation is as follows: centrifuging the lysate at 8000-1000 rpm for 5-10 min, and collecting the upper layer of liquid (in the form of suspension) obtained by centrifugation; The sterilization and centrifugation include sterilization and three centrifugations; The sterilization step is as follows: sterilizing the upper layer liquid obtained by the secondary centrifugation at 105-121° C. for 15-21 minutes, and then naturally cooling for 24-30 hours to obtain a sterilized liquid; The three centrifugations are as follows: the sterilized liquid is centrifuged at 8000-1000 rpm for 5-10 min, and the supernatant is taken, and the supernatant is the fermentation lysate of Saccharomyces cerevisiae bamboo leaves.

[0017] As a further improvement of the preparation method of the brewer's yeast bamboo leaf fermentation lysate of the present invention, the homogenization and crushing treatment is: homogenizing the suspension at 200-300 bar, repeating 2 times; increasing the pressure to 700-800 bar and homogenizing, repeating 2 times; continuing to increase the pressure to 1200-1300 bar and homogenizing, repeating 2 times; after completing the above three types of homogenization, the homogenization and crushing treatment is completed to obtain a lysate.

[0018] The present invention also provides the use of the brewer's yeast bamboo leaf fermentation lysate prepared by the above method, which is any of the following: preparing antioxidant substances, preparing whitening substances, preparing antibacterial substances, and preparing other active substances.

[0019] Improvements on the use of the Saccharomyces cerevisiae bamboo leaf fermentation lysate of the present invention: The antioxidant substance includes at least one of polysaccharides, flavonoids, and polyphenols; the whitening substance includes at least one of proteins, polysaccharides, and polyphenols; the antibacterial substance includes at least one of lactic acid, flavonoids, and small molecule polypeptides; and the other active substances include at least one of amino acids and trace elements.

[0020] The present invention also provides the use of the brewer's yeast bamboo leaf fermentation lysate prepared by the above method in multi-effect skin care: the multi-effect skin care includes anti-oxidation, whitening, UV repair and anti-aging, and strengthening the skin barrier. That is, the invention provides the use of the brewer's yeast bamboo leaf fermentation lysate in the preparation of a skin repair and anti-aging external preparation.

[0021] The brewer's yeast bamboo leaf fermentation lysate obtained by the present invention contains rich natural nutrients such as polysaccharides, proteins, flavonoids, polyphenols, amino acids, etc., and has multiple functions such as whitening, anti-inflammatory, and antioxidant. Among them, the brewer's yeast cells contain rich nutrients such as proteins, metabolic polysaccharides, peptides, amino acids, vitamins, etc., and have multiple effects such as anti-aging, anti-wrinkle and firming, and barrier repair. It is a mild and natural new cosmetic raw material that can keep the skin young and energetic.

[0022] The fermentation liquid of the invention has low cost, can greatly improve the utilization and development of bamboo leaves, and during the fermentation process, the brewing yeast ferments in multiple stages, which helps to improve the nutritional diversity of the fermentation product, turning waste into treasure, and has extremely high social value.

[0023] The present invention utilizes a specific brewer's yeast bamboo leaf fermentation process to obtain bamboo leaf residues and yeast bodies, and obtains a brewer's yeast bamboo leaf fermentation lysate through a specific means and multiple processes such as cell crushing, centrifugation, and sterilization, which can be used as an active raw material for cosmetics. The raw material has significant antioxidant, whitening, anti-wrinkle and firming, UV damage repair, anti-aging and other effects, which can keep the skin youthful and energetic.

[0024] The brewer's yeast bamboo leaf fermentation lysate of the present invention is rich in polysaccharides, flavonoids, polyphenols, proteins, amino acids, etc., and has significant repair and anti-aging, anti-oxidation, whitening and other functions, so it can be used for whitening, anti-oxidation, ultraviolet damage repair, firming and anti-aging.

[0025] The brewer's yeast bamboo leaf fermentation lysate of the present invention can effectively promote the proliferation of human skin keratinocytes and the expression of related proteins between keratinocytes, including aquaporin AQP3, filaggrin FLG, and loricrin LOR, which is crucial for maintaining the integrity of the skin barrier.

[0026] The brewer's yeast bamboo leaf fermentation lysate of the present invention can effectively inhibit the apoptosis of human skin keratinocytes, enhance cell activity after UV irradiation, and regulate the expression of the SIRT family of longevity-related genes.

[0027] The brewer's yeast bamboo leaf fermentation lysate of the present invention can effectively slow down the aging of human dermal fibroblasts, increase the expression of collagen-related genes, and provide a basis for skin firming and rejuvenation.

[0028] In summary, the present invention realizes the preparation of cosmetic raw materials with bamboo leaf fermentation residues and brewer's yeast cells for the first time, reduces the waste treatment pressure brought by yeast fermentation cells, and turns waste into treasure; homogenization and sterilization in the preparation process can effectively control the growth of cells; the lysate of the present invention can effectively repair UV-damaged keratinocytes, slow down cell apoptosis, promote the expression of aquaporin APQ3, filaggrin FLG, and involucrin IVL, and has significant free radical scavenging, anti-aging, UV ultraviolet repair and other effects. The lysate of the present invention has high activity, can produce obvious effects at a relatively low content, has pure natural raw materials, is safe and non-irritating, and can be widely used in various skin topical preparations. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0030] Figure 1The ABTS free radical scavenging ability of the bamboo leaf fermentation lysate of Saccharomyces cerevisiae; Figure 2 The tyrosinase activity of the lysate of bamboo leaf fermentation of Saccharomyces cerevisiae; Figure 3 This is the β-galactosidase staining of human dermal fibroblasts by the lysate of bamboo leaf fermentation with Saccharomyces cerevisiae; Figure 4 The expression results of FLG gene in blank control group and bamboo leaf fermentation lysate with Saccharomyces cerevisiae added; Figure 5 The IVL gene expression results of the blank control group and the group supplemented with the fermentation lysate of Saccharomyces cerevisiae bamboo leaves; Figure 6 These are the AQP3 gene expression results for the blank control group and the group supplemented with Saccharomyces cerevisiae bamboo leaf fermentation lysate. DETAILED DESCRIPTION

[0031] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto: Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials and reagents used are all commercially available unless otherwise specified; the percentages mentioned in the examples are all mass percentages unless otherwise specified.

[0032] Saccharomyces cerevisiae was obtained from China Industrial Microbiological Culture Collection Center, with the collection number CICC 31105.

[0033] The culture medium used in the present invention is as follows: The formula of malt extract agar medium is: 0.4% peptone, 1% glucose, 0.3% yeast extract powder, 1% malt powder, 1.3% agar powder, and the balance is deionized water.

[0034] The formula of YPD liquid medium is: 1% yeast extract, 2% peptone, 2% glucose, and the balance is deionized water.

[0035] The above % are all mass %.

[0036] Embodiment 1: A method for preparing a lysate of bamboo leaf fermentation of Saccharomyces cerevisiae, comprising the following steps: (1) Strain activation and seed solution preparation: 1.1) Activate Saccharomyces cerevisiae (CICC 31105) by streaking on malt extract agar medium. The activation condition is to culture in an incubator at 28±0.5℃ for 24~72h. 1.2) Inoculate one inoculation loop of activated Saccharomyces cerevisiae into 100 ml of YPD liquid culture medium, shake the flask at 200-250 rpm and 28±0.5℃ for 18-20 hours as seed solution.

[0037] (2) Preparation of fermentation medium and fermentation: 2.1) The fermentation culture medium is composed of the following components by mass: 1% of Phyllostachys pubescens leaf powder, 2% of glucose, and the balance is deionized water.

[0038] The preparation method of moso bamboo leaf powder (Jingshan moso bamboo leaf powder) is as follows: take moso bamboo leaves (Jingshan moso bamboo leaves), wash them, dry them at 50°C for 4 days, and then grind them to pass through a 80-100 mesh sieve to obtain moso bamboo leaf powder; 2.2) Fermentation: According to the inoculation amount of 10±0.1%, the seed liquid was inoculated into the fermentation medium obtained in the above step 2.1) for fermentation culture. The fermentation conditions were as follows: Early fermentation period (0th to 10th hour of fermentation): temperature 30±0.5℃, rotation speed 150~200rpm, air flow 0.25~0.75Nm 3 / h; Air flow at the start of fermentation: 0.25 Nm 3 / h; ferment the bacteria under natural DO value (dissolved oxygen) conditions (i.e., the initial DO value of fermentation is 100%); when the DO value drops to 0.1%, increase the air flow rate so that the DO value is controlled at 0.1~1%, and the maximum air flow rate cannot exceed 0.75Nm 3 / h; then continue to adjust the air flow rate to 0.25 ~0.75Nm 3 / h, thereby controlling the DO value to 0.1~1%; Note: The early stage of fermentation is the rapid growth period of brewer's yeast. Brewer's yeast uses glucose as the main carbon source. The DO value drops rapidly to 0.1% within 1 hour. Therefore, it is necessary to slowly increase the air flow rate to control the DO value at 0.1~1%; the maximum air flow rate shall not exceed 0.75Nm 3 / h. After (8±1) hours, the DO value will gradually rise to more than 1%. At this time, the air flow rate needs to be reduced so that the DO value is still controlled at 0.1~1%.

[0039] Mid-to-late fermentation period (after 10 hours to the end of fermentation): temperature 30±0.5℃, rotation speed 200~250rpm; air flow 0.25~0.75Nm 3 / h; control the DO value to be controlled at 0.1~1%; when the pH value of the fermentation system no longer decreases within 2~3 hours, the fermentation is judged to be over and the fermentation liquid is obtained.

[0040] The total fermentation time is about 45±1h.

[0041] Note: The fermentation process in the middle and late stages of fermentation is relatively stable. Saccharomyces cerevisiae uses the ethanol and bamboo leaf polysaccharides produced by fermentation as carbon sources for metabolism. During this process, the pH value slowly decreases and the DO value decreases very slowly. Therefore, the rotation speed is increased compared to the early stage of fermentation to control the DO value at 0.1~1%. When the pH value of the fermentation system no longer decreases within 2~3 hours, the fermentation is judged to be over. At this time, the total fermentation time is about 45±1h.

[0042] During the above fermentation process, samples were taken every 2 hours and the absorbance at 600 nm was measured. Generally, the OD value of the last 3 samples was 600 No significant growth.

[0043] (3) The fermentation liquid obtained in step (2) is filtered and centrifuged, homogenized and centrifuged, sterilized and centrifuged, and the supernatant obtained is the Saccharomyces cerevisiae bamboo leaf fermentation lysate (hereinafter referred to as lysate).

[0044] The details are as follows: 3.1) Filtration and centrifugation: The fermentation liquid obtained after the fermentation is filtered through gauze once and then centrifuged (centrifuged at a speed of 4000r for 15-20 minutes). The solid part obtained by centrifugation is the fermentation mixture (including bamboo leaf residue and brewer's yeast).

[0045] 3.2) Homogenization: The fermentation mixture is diluted with water to form a suspension, wherein the mass content of the fermentation mixture in the suspension is 25-30%; The suspension was homogenized at 200-300 bar, and the process was repeated twice; the pressure was increased to 700-800 bar and the process was repeated twice; the pressure was further increased to 1200-1300 bar and the process was repeated twice; after the above three types of homogenization were completed, the homogenization and crushing treatment was completed to obtain the lysis solution.

[0046] The homogenization time for each time is 10 to 15 minutes.

[0047] 3.3) Secondary centrifugation: The lysate obtained in step 3.2) was centrifuged at 8000-1000 rpm for 5-10 min, and the upper layer of liquid obtained by centrifugation (in the form of suspension) was collected.

[0048] Note: The lower sediment obtained by centrifugation should be discarded.

[0049] 3.4) Sterilization: The upper layer liquid obtained in step 3.3) is sterilized in a high pressure sterilizer at 115-121°C for 15-21 minutes, and then naturally cooled for 24-30 hours to obtain a sterilized liquid; 3.5) Centrifugation three times: The sterilized solution obtained in step 3.4) is centrifuged at 8000-1000 rpm for 5-10 min, and the supernatant is taken, which is the lysate (Saccharomyces cerevisiae bamboo leaf fermentation lysate).

[0050] Experiment 1: Determination of the concentration of active substances in the fermentation lysate of Saccharomyces cerevisiae bamboo leaves obtained in Example 1 1. Determination of polysaccharide content in lysate Prepare anthrone-sulfuric acid reagent: weigh 100 mg of anthrone reagent, dilute to 100 mL with 75% sulfuric acid solution, and store at low temperature and away from light for later use (use up within 6 hours, the prepared solution will be yellow, and there will be precipitation if it deteriorates); Prepare 1mg / mL glucose standard solution: weigh 10mg glucose standard and dilute to 10mL with deionized water; then dilute to 20μg / mL, 40μg / mL, 60μg / mL, 80μg / mL, 100μg / mL, 120μg / mL, 140μg / mL, 160μg / mL, and obtain the diluted glucose solution for use; each diluted glucose solution is operated as follows: take 200μL of diluted glucose solution in a 1.5mL centrifuge tube, use 200μL of deionized water as a blank control, add 800μL of anthrone-sulfuric acid reagent in an ice bath, immediately seal and shake, and heat at 100℃ for 15min; each diluted glucose solution is repeated 4 times. After the reaction is completed, transfer to an ice water bath to cool for 5min, then transfer to room temperature, let stand for 30min, and measure its absorbance at 620nm. Draw a standard curve with absorbance as the horizontal axis and glucose concentration as the vertical axis.

[0051] Take an appropriate amount of the lysate obtained in Example 1 and dilute it with deionized water to an appropriate concentration (generally add 99 times the volume of water for dilution) as a sample, replace the diluted glucose solution and perform the measurement according to the above method, substitute the obtained absorbance into the above standard curve, and then perform corresponding conversion to obtain the polysaccharide content of the lysate.

[0052] The results obtained were as follows: the polysaccharide content in the cell lysate obtained in Example 1 was 13.78 mg / mL.

[0053] 2. Determination of flavonoid content in lysate Prepare 5% NaNO3 solution: weigh 5g NaNO3 powder, dissolve it in deionized water and make up to 100mL for later use; Prepare 10% Al(NO3)3 solution: weigh 10g Al(NO3)3 powder, dissolve it in deionized water and make up to 100mL for later use; Prepare 1.0 mol / L NaOH solution: weigh 0.1 mol NaOH, dissolve it in deionized water and dilute to 100 mL for later use; Prepare 0.1 mg / mL rutin standard: weigh rutin standard, dilute to 100 mL with 30% ethanol to obtain 0.1 mg / mL rutin standard; then dilute 0.1 mg / mL rutin standard with super deionized water to 20 μg / mL, 40 μg / mL, 60 μg / mL, 80 μg / mL, 100 μg / mL, 120 μg / mL to obtain diluted rutin solution for use; Each diluted rutin solution was subjected to the following operations: 100 μL of the diluted rutin solution was placed in a 5 mL centrifuge tube, and super deionized water was used as a blank control. 900 μL of 30% ethanol was added and mixed for 5 min; 100 μL of 5% NaNO3 solution was added and shaken for 5 min; 100 μL of 10% Al(NO3)3 solution was added and shaken for 6 min; 1 mL of 1.0 mol / L NaOH solution was added and shaken for 6 min; 30% ethanol was added to make the volume 2.5 mL and reacted for 10 min, and then the absorbance at 510 nm was measured. A standard curve was drawn with absorbance as the horizontal axis and rutin concentration as the vertical axis.

[0054] The lysate obtained in Example 1 was taken as a sample, and the diluted rutin solution was replaced for determination according to the above method. The absorbance obtained was substituted into the above standard curve, and then converted accordingly to obtain the flavonoid content of the lysate.

[0055] The results obtained were as follows: the flavonoid content in the cell lysate obtained in Example 1 was 371.40 μg / mL.

[0056] 3. Determination of polyphenol content in lysate Prepare 10% Folin phenol solution: weigh 10 g of Folin phenol and dilute to 100 mL with deionized water for later use; Prepare 7.5% NaCO3 solution: weigh 37.5g NaCO3 powder, dissolve it in deionized water and dilute to 500mL for later use; Prepare gallic acid standard solution: weigh 0.11g of monohydrated gallic acid powder, dissolve it in deionized water to 100mL; dilute it with deionized water to 10μg / mL, 20μg / mL, 30μg / mL, 40μg / mL, 50μg / mL, and prepare the diluted gallic acid solution for use; Each diluted gallic acid solution was subjected to the following operation: 1 mL of the diluted gallic acid solution was taken into a 10 mL centrifuge tube, and super deionized water was used as a blank control. 5 mL of 10% Folin phenol solution was added, mixed and placed for 3 min; then 4 mL of 7.5% NaCO3 solution was added to react for 60 min, and the absorbance at 765 nm was measured. A standard curve was drawn with absorbance as the horizontal axis and gallic acid concentration as the vertical axis.

[0057] Take an appropriate amount of the lysate obtained in Example 1 and dilute it with deionized water to an appropriate concentration (generally add 9 volumes of deionized water for dilution) as a sample, replace the diluted gallic acid solution and perform the measurement according to the above method, substitute the obtained absorbance into the above standard curve, and then perform corresponding conversion to obtain the polyphenol content of the lysate.

[0058] The results obtained were as follows: the polyphenol content in the cell lysate obtained in Example 1 was 485.48 μg / mL.

[0059] 4. Determination of protein content in lysate Preparation of BCA working solution: Prepare an appropriate amount of BCA working solution by adding 1 volume of BCA reagent B to 50 volumes of BCA reagent A (50:1) and mix thoroughly. For example, add 100μl of BCA reagent B to 5ml of BCA reagent A, mix well, and prepare 5.1ml of BCA working solution. BCA working solution is stable at room temperature for 24 hours.

[0060] Preparation of protein standard: Take 1.2mL of protein standard preparation solution and add it to a tube of protein standard (30mg bovine serum albumin BSA), and prepare a 25mg / mL protein standard solution after fully dissolving. Take an appropriate amount of 25mg / mL protein standard, dilute it with deionized water to a final concentration of 0.5mg / mL, and then dilute it with deionized water to 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5mg / mL to obtain diluted protein dilution; each diluted protein dilution is performed as follows: take 20μL of diluted protein dilution to a 96-well plate, use super deionized water as a blank control, add 200μL BCA working solution, place at 37℃ for 30min, measure the absorbance at 562nm with an enzyme marker, and draw a standard curve.

[0061] The BCA reagent A, BCA reagent B and protein standard preparation solution are provided by a BCA protein concentration determination kit (enhanced Biyutian kit).

[0062] Take an appropriate amount of the lysate obtained in Example 1 and dilute it with deionized water to an appropriate concentration (generally add 39 times the volume of water for dilution) as a sample, replace the diluted protein diluent and perform the measurement according to the above method, substitute the obtained absorbance into the above standard curve, and then perform corresponding conversion to obtain the protein content of the lysate.

[0063] The results obtained were as follows: the protein content in the cell lysate obtained in Example 1 was 7.43 mg / mL.

[0064] Experiment 2: Antioxidant activity test of the fermented lysate of Saccharomyces cerevisiae and bamboo leaves 1. DPPH (1,1-diphenyl-2-trinitrophenylhydrazine) method Prepare the solution: weigh an appropriate amount of DPPH powder and dissolve it in anhydrous ethanol, and sonicate for 20 minutes to assist dissolution; measure the diluted DPPH solution to an OD517 absorbance of 1.2-1.3 using a UV spectrophotometer, and refrigerate away from light; The lysate obtained in Example 1 was diluted with deionized water and diluted to different concentrations as samples by the two-fold dilution method. Each solution was added according to Table 1 below and reacted at room temperature in the dark for 30 minutes. The absorbance was measured at 517 nm on a microplate reader to calculate the DPPH free radical scavenging rate.

[0065] Table 1 DPPH free radical scavenging experiment sample addition table (μL)

[0066] The calculation formula of DPPH free radical scavenging rate is as follows: .

[0067] Wherein: Y represents the DPPH free radical scavenging rate, Aa represents the solvent background absorbance, Ab represents the solvent reaction well absorbance, Ac represents the sample background reaction well absorbance, and Ad represents the sample reaction well absorbance.

[0068] A positive control, Vc, was also set up in this experiment.

[0069] The results are shown in Table 2.

[0070] Table 2 DPPH free radical scavenging ability of Saccharomyces cerevisiae bamboo leaf fermentation lysate

[0071] The results showed that compared with the positive control (0.0025% vitamin C), the fermented lysate of Saccharomyces cerevisiae bamboo leaves had a certain DPPH free radical scavenging ability, and the 10% lysate DPPH free radical scavenging effect was basically equivalent to the positive control. Since the lysate contained a high concentration of polysaccharides, ethanol solution needed to be added to the DPPH determination system, and higher concentrations of lysate would cause alcohol precipitation. When the concentration was lower than 10%, the DPPH free radical scavenging ability of the lysate was concentration-dependent. It can be concluded that the fermented lysate of Saccharomyces cerevisiae bamboo leaves can effectively scavenge DPPH free radicals and alleviate skin oxidation and aging.

[0072] 2. ABTS (2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt) method Prepare the solution: weigh an appropriate amount of ABTS powder and dissolve it in deionized water to 7 mmol / L; weigh an appropriate amount of sodium persulfate powder and dissolve it in deionized water to 2.45 mmol / L; mix the two in a volume ratio of 1:1, place at 4°C for 12 hours, and then dilute with deionized water. The 734nm value measured by UV spectrophotometer is 0.7 for subsequent experiments.

[0073] The lysate obtained in Example 1 was diluted with deionized water and diluted to different concentrations by the two-fold dilution method. Each solution was added according to Table 3 below and reacted at room temperature in the dark for 6 minutes. The absorbance was measured at 734 nm on a microplate reader to calculate the ABTS free radical scavenging rate.

[0074] Table 3 ABTS free radical scavenging experiment sample addition table (μL)

[0075] The calculation formula of DPPH free radical scavenging rate is as follows: .

[0076] Wherein: Y represents the ABTS free radical scavenging rate, Aa represents the solvent background absorbance, Ab represents the solvent reaction well absorbance, Ac represents the sample background reaction well absorbance, and Ad represents the sample reaction well absorbance.

[0077] A positive control, Vc, was also set up in this experiment.

[0078] Table 4 ABTS free radical scavenging ability of Saccharomyces cerevisiae bamboo leaf fermentation lysate

[0079] The results are as follows Figure 1 , as shown in Table 4. The results show that compared with the positive control (0.00125% vitamin C), the fermented lysate of Saccharomyces cerevisiae bamboo leaves has a significant ABTS free radical scavenging ability. The lysate with a content of 3.13% or more has a better ABTS free radical scavenging effect than the positive control Vc, and is concentration-dependent. In particular, the 12.5% ​​lysate has a 100% ABTS free radical scavenging rate. It can be concluded that the fermented lysate of Saccharomyces cerevisiae bamboo leaves can efficiently scavenge ABTS free radicals and alleviate skin oxidation and aging.

[0080] Experiment 3: Whitening performance test of the fermented lysate of Saccharomyces cerevisiae and bamboo leaves Prepare the solution: Weigh appropriate amounts of sodium dihydrogen phosphate and disodium hydrogen phosphate powders and dissolve them separately to prepare 0.1 mol / L pH 6.8 PBS buffer; Weigh an appropriate amount of L-DOPA, dissolve it with an appropriate amount of 0.5 mol / L hydrochloric acid solution (i.e., the amount of 0.5 mol / L hydrochloric acid solution is only enough to ensure that L-DOPA can be dissolved), and then dilute to a concentration of 0.2 mg / mL with PBS buffer; Weigh an appropriate amount of tyrosinase and dissolve it in PBS buffer to 500 U / mL; The lysate was prepared with PBS buffer as a sample and diluted to different concentrations by two-fold dilution method. Each solution was added according to Table 5 below and reacted at 37°C for 10 min. The absorbance was measured at 475 nm on a microplate reader to calculate the tyrosinase activity inhibition rate.

[0081] Table 5 Sample loading table for tyrosinase activity inhibition experiment (μL)

[0082] The tyrosinase activity inhibition rate was calculated as follows: .

[0083] Wherein: Y represents the inhibition rate of tyrosinase activity, Aa represents the solvent background absorbance, Ab represents the solvent reaction well absorbance, Ac represents the sample background reaction well absorbance, and Ad represents the sample reaction well absorbance.

[0084] A positive control, kojic acid, was also set up in this experiment.

[0085] Table 6 Tyrosinase activity inhibition rate of Saccharomyces cerevisiae bamboo leaf fermentation lysate

[0086] The results are as follows Figure 2 , as shown in Table 6. The results show that compared with the positive control (0.002% kojic acid), the fermented lysate of Saccharomyces cerevisiae bamboo leaves has a high ability to inhibit tyrosinase activity. With the increase of the lysate content, its inhibitory ability on tyrosinase activity increases, and the lysate with a concentration higher than 6.25% has a better inhibitory ability on tyrosinase activity than 0.002% kojic acid. Tyrosinase is an enzyme that plays a key role in the production of melanin and is a rate-limiting enzyme. Inhibiting its activity can reduce the production of melanin. It can be seen that the lysate of Saccharomyces cerevisiae can effectively reduce the production of melanin, achieve skin whitening effects, and improve problems related to uneven skin tone and excessive pigmentation.

[0087] Experiment 4: Cytotoxicity of Saccharomyces cerevisiae lysate Keratinocytes are the most important cells in the epidermis. They participate in the formation of the skin's physical barrier, preventing physical, chemical and microbial invasions and protecting the skin. One of the main characteristics of skin aging is the thinning of the epidermis and the slowing of wound healing, which is mainly due to the decreased regeneration ability of keratinocytes in the epidermis and the decreased proliferation ability of the keratinocyte system.

[0088] Dermal aging is manifested by decreased dermal clearance of foreign chemicals, thinning of dermal thickness, decreased synthesis of collagen and elastin, increased decomposition, and enhanced activity of degradative enzymes. These phenomena are all related to the reduction in the number of fibroblasts and the decline or abnormality of secretory synthesis function. Human skin fibroblasts are the most important cells in the reticular layer of the dermis and are one of the main repair cells after skin aging and cell damage. It not only promotes the migration, proliferation and differentiation of epidermal cells, but also secretes a large amount of collagen, elastin and a variety of cell repair factors, and has a strong self-renewal ability, thereby repairing aging skin.

[0089] The lysate obtained in Example 1 was diluted with deionized water to a polysaccharide content of 1% (i.e., 10 mg / mL) as a 100% test concentration; and then, when conducting a cell experiment, the corresponding culture medium was added to obtain a test concentration as described in Table 7 as a test sample. Taking 10% (v / v) in Table 7 as an example, 90 μL of the corresponding culture medium was added to 10 μL of the lysate of 100% test concentration, and a 10% (v / v) test concentration was obtained as a test sample. HaCaT cells used 1640 culture medium, and HSF cells used FM culture medium.

[0090] 8000-10000 HaCaT cells or HSF cells were inoculated in a 96-well plate and adhered to the wall for 24 hours. The culture medium was aspirated and the test sample of the lysate was added. Deionized water without sample was used as blank control and cultured for 24 hours. After the culture was completed, the volume ratio of complete culture medium to CCK-8 reagent was 1:10, 100 μL staining medium was added to each well to avoid bubbles, and incubated at 37°C in an incubator for 0.5-4 hours. The absorbance was measured using a microplate reader at a wavelength of 450 nm. The toxicity to human keratinocytes or human fibroblasts was evaluated by reference to the blank control.

[0091] The cell viability calculation formula is as follows: .

[0092] Among them, A2 represents the absorbance value of cells with added drugs, A1 represents the absorbance value of cells without added drugs, and A0 represents the absorbance value of sterile water.

[0093] Table 7 Toxicity of Saccharomyces cerevisiae bamboo leaf fermentation lysate to human skin cells

[0094] As shown in Table 7, the lysate prepared from the Hangzhou Jingshan bamboo leaf powder fermented with brewer's yeast of the present invention has no toxicity to human epidermal keratinocytes and dermal fibroblasts, and can promote epidermal barrier formation and human skin cell proliferation, thereby maintaining skin health and enhancing skin homeostasis.

[0095] Experiment 5: Repair effect of Saccharomyces cerevisiae lysate on UV-damaged skin cells Skin aging is divided into endogenous aging and exogenous aging. Sunlight, especially ultraviolet (UV) irradiation, is the main factor in the formation of exogenous aging, so exogenous aging is also called photoaging; UVA (320nm-400nm) and a small amount of UVB (280-320nm) are mainly related to skin photoaging. Many data show that 95% of the ultraviolet rays irradiated to the skin are absorbed by keratinocytes. When the skin is exposed to UVA radiation, ROS will be generated and cause different damages including oxidative stress. Ultraviolet UVB will directly act on epidermal cells, inducing oxidative stress and inflammatory processes, thereby affecting the skin barrier function and forming photodamage. Therefore, this experiment used UVA / UVB to irradiate human immortalized epidermal (HaCaT) cells and dermal fibroblasts (Fibroblast) cells to establish a skin photodamage model, and used this model to evaluate the protective effect of active substances against skin ultraviolet damage.

[0096] Referring to Experiment 4, HaCaT cells were inoculated into 96-well plates and cultured in a cell culture incubator at 37°C and 5% CO2 for 24 h. The culture medium was removed and PBS buffer was added. The model group 1 (UVA2J / cm 2 , UVB15mJ / cm 2 )、Model group 2(UVB30mJ / cm 2 ) irradiation treatment, the non-irradiation group was used as the control group. Different concentrations of lysate samples were added immediately after injury and incubated for 24 h (incubation temperature was 37°C), and the cell activity was detected by CCK-8 method.

[0097] As shown in Tables 8 and 9, the lysate of bamboo leaf fermentation of Saccharomyces cerevisiae has a significant repairing effect on the damage of human epidermal keratinocytes caused by UV / UVB.

[0098] Table 8 Repair effect of Saccharomyces cerevisiae bamboo leaf fermentation lysate on UV damage of human keratinocytes

[0099] Table 9 Repair effect of Saccharomyces cerevisiae bamboo leaf fermentation lysate on UVB damage in human keratinocytes

[0100] Note: The preparation method of the lysate test concentration refers to Experiment 4, and the corresponding culture medium is 1640 culture medium.

[0101] Experiment 6: Anti-aging ability test of lysate of Saccharomyces cerevisiae Most normal cells are believed to have only limited ability to divide, and enter a state of senescence when they can no longer divide. At this point, the cells are still alive, but the expression profiles of their genes and proteins have changed significantly. Senescent cells can no longer induce cell division under some conventional stimuli, and the cell cycle distribution of senescent cells is also quite special, different from some damage-induced cell dormancy and contact inhibition of cell growth. Senescent cells usually become larger in size and express β-galactosidase, which has high enzymatic activity at pH 6.0. Cellular senescence is also considered a way for organisms to suppress tumors, and is also a potential cause of aging in organisms.

[0102] The test content is: HSF cells were inoculated into 6-well plates, and the cells were attached to the plate in a cell culture incubator at a constant temperature of 37°C and 5% CO2 for 24 hours. 2 , UVB 15mJ / cm 2 The irradiated and non-irradiated cells were incubated for 24 h at 37°C and the β-galactoside staining kit was used to compare and analyze the cell staining.

[0103] The results are as follows Figure 3 As shown in Table 10, the fermented lysate of Saccharomyces cerevisiae bamboo leaves has a significant repairing effect on the damage of human dermal fibroblasts caused by UV radiation; it also has a significant anti-aging effect on naturally aged fibroblasts.

[0104] Table 10 Effect of Saccharomyces cerevisiae bamboo leaf fermentation lysate on UV damage repair of human dermal fibroblasts

[0105] Note: The preparation method of the test concentration of lysate refers to Experiment 4. The corresponding culture medium is FM medium.

[0106] Experiment 7: Test of the ability of Saccharomyces cerevisiae lysate to inhibit cell apoptosis Annexin V selectively binds to phosphatidylserine; phosphatidylserine is mainly distributed on the inner side of the cell membrane, that is, the side adjacent to the cytoplasm. In the early stages of cell apoptosis, different types of cells will externalize phosphatidylserine to the cell surface, that is, the outer side of the cell membrane. When phosphatidylserine is exposed to the cell surface, it promotes coagulation and inflammatory responses. Annexin V binds to phosphatidylserine externalized to the cell surface and can block the procoagulant and proinflammatory activity of phosphatidylserine. The Annexin V-FITC Cell Apoptosis Detection Kit can be used to detect the apoptosis of human fibroblasts / human keratinocytes stimulated by UVA / UVB.

[0107] A 6-well plate was inoculated with 200,000 HaCaT cells / well or 130,000 HSF cells / well. The cells were cultured in a constant temperature incubator at 37°C and 5% CO2 for 24 h. The culture medium was removed and blank control wells (culture medium only) and experimental wells (culture medium, culture medium containing different amounts of lysate) were set. The experimental wells were irradiated with UVA (2 J / cm 2 ) or UVB (15mJ / cm 2 ) and incubated at 37°C for 24 h. The Annexin V-FITC apoptosis detection kit was used to perform the experiment, and the cell ratios at different stages were determined and analyzed by flow cytometry.

[0108] As shown in Tables 11 and 12, the fermented lysate of Saccharomyces cerevisiae bamboo leaves has different degrees of inhibitory effect on apoptosis of human skin cells damaged by UVA / UVB, and increases the proportion of live cells. Among them, the lysate of human dermal fibroblasts has a better effect at low concentrations (0.1~1% v / v); the repair effect of the lysate on human epidermal keratinocytes is concentration-dependent, and its ability to inhibit cell apoptosis is significantly enhanced as the concentration increases.

[0109] Table 11 The ability of the fermented lysate of Saccharomyces cerevisiae bamboo leaves to inhibit the UVA damage and apoptosis of human fibroblasts (UVA irradiation treatment UVA2J / cm 2 )

[0110] Note: The preparation method of the test concentration of lysate refers to Experiment 4. The corresponding culture medium is FM medium.

[0111] Table 12 The ability of the fermented lysate of Saccharomyces cerevisiae bamboo leaves to inhibit apoptosis of human keratinocytes damaged by UVB (UVB irradiation treatment: UVB 15 mJ / cm 2 )

[0112] Note: The preparation method of the lysate test concentration refers to Experiment 4. The corresponding culture medium is 1640 medium.

[0113] Experiment 8: Saccharomyces cerevisiae lysate was used to test the gene expression activity of epidermal cells 200,000 HaCaT cells were inoculated in a 6-well plate and adhered to the wall for 24 hours. The culture medium was removed, and blank control wells (culture medium only) and experimental wells (culture medium containing 0.1% lysate and 10% lysate were added, respectively) were set up. The cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 24 hours. The FastPure® Cell / Tissue Total RNA Isolation Kit V2 was used to perform the corresponding experimental steps to extract RNA from the cells, and the HiScript® Q RT SuperMix for qPCR (+gDNAwiper) kit was used to perform reverse transcription according to the steps. The Taq Pro Universal SYBR qPCR Master Mix kit and the target gene primers were used for real-time fluorescence quantitative PCR, and the results were calculated and analyzed for mapping. The FLG primer sequence is FLG-F: TGAAGCCTATGACACCACTGA, FLG-R: TCCCCTACGCTTTCTTGTCCT; the IVL primer sequence is IVL-F: GTGGGGGAGAGAGGGAATTA, IVL-R: CTCACCTGAGGTTGGGATTG; the AQP3 primer sequence is AQP3-F: AGACAGCCCCTTCAGGATTT, AQP3-R: TCCCTTGCCCTGAATATCTG.

[0114] (1) Bamboo leaf fermentation lysate of Saccharomyces cerevisiae increases the expression of FLG gene Depend on Figure 4 It can be seen that compared with the Control group, the addition of 0.1% of Saccharomyces cerevisiae bamboo leaf fermentation lysate can significantly increase the expression level of FLG gene in HaCaT cells in the epidermis of the skin, up-regulating by 4.59 times; the addition of 10% of the lysate can up-regulate the expression of FLG gene in cells by 2.81 times. Filaggrin (FLG) is a key molecule that connects keratin fibers in the stratum corneum of the skin, which helps prevent epidermal water loss and the invasion of external allergic substances. Its main function is to participate in the differentiation of epidermal cells and form a barrier for the skin; the degradation product of FLG has a moisturizing effect and is called a "natural moisturizing factor" to maintain the hydration of the skin. Therefore, Saccharomyces cerevisiae bamboo leaf fermentation lysate promotes the barrier function of the stratum corneum and improves the moisturizing ability of the skin by up-regulating the FLG gene.

[0115] (2) Improving IVL gene expression by fermenting lysate of Saccharomyces cerevisiae with bamboo leaves Depend on Figure 5It can be seen that compared with the Control group, the addition of 0.1% of Saccharomyces cerevisiae bamboo leaf fermentation lysate can significantly increase the expression level of IVL gene in HaCaT cells in the epidermis of the skin, up by 1.95 times, and the addition of 10% of the lysate can upregulate the expression of IVL gene in cells by 1.61 times. The involucrin gene (IVL) is mainly expressed in the stratum corneum cells of the skin, and the involucrin encoded by it is an important structural protein, which is essential for the barrier function of the skin. Involucrin interacts with other proteins such as keratin to form the stratum corneum of the skin, thereby preventing water loss and the invasion of external substances. Therefore, Saccharomyces cerevisiae bamboo leaf fermentation lysate can promote protein interaction and prevent water loss by upregulating the IVL gene in the skin.

[0116] (3) Saccharomyces cerevisiae bamboo leaf fermentation lysate increases the expression of AQP3 gene Depend on Figure 6 It can be seen that compared with the Control group, the addition of 0.1% of Saccharomyces cerevisiae bamboo leaf fermentation lysate can significantly increase the expression level of AQP3 gene in HaCaT cells in the epidermis of the skin, up by 1.31 times, and the addition of 10% of the lysate can upregulate the expression of AQP3 gene in cells by 1.22 times. Aquaporin 3 (AQP3) is a member of the aquaporin family and a class of intrinsic membrane proteins that mainly regulates the transmembrane transport of water molecules and can permeate small molecules such as glycerol and urea. Saccharomyces cerevisiae bamboo leaf fermentation lysate promotes the expression of AQP3 gene in the skin, helps transport glycerol, provides ATP for cell proliferation, enhances cell vitality, and delays skin aging.

[0117] Example 2: Compared with Example 1, the fermentation medium in step 2.1) is changed to the following: 0.9% Phyllostachys pubescens leaf powder, 1.9% glucose, and the rest is the same as Example 1.

[0118] Example 3: Compared with Example 1, the total fermentation time in step 2.2) is changed to 20 hours (that is, the time in the middle and late fermentation is changed to 10 hours), and the rest is the same as Example 1.

[0119] Example 4: Compared with Example 1, the centrifugation in step 3.1) is changed to 8000r for 5min, and the rest is the same as Example 1.

[0120] Example 5: Compared with Example 1, the homogenization condition in step 3.2) is changed to 1000-1500 bar homogenization, which is repeated 3 times. The rest is the same as Example 1.

[0121] Comparative Example 1: Compared with Example 1, the "three centrifugations" in step 3.5) were replaced by diatomaceous earth filtration treatment, and the rest was the same as Example 1.

[0122] Comparative Example 2: Compared with Example 1, the "three centrifugations" in step 3.5) are replaced by adding activated carbon and diatomaceous earth for co-treatment, and the rest is the same as Example 1.

[0123] The products obtained in all the above comparative examples were tested according to the above experimental method, and the comparison results with Example 1 of the present invention are shown in Table 13 below: Table 13

[0124] As shown in the data of Table 13 above, the content of active substances detected in the bamboo leaf fermentation lysate of Saccharomyces cerevisiae prepared under the conditions described in Example 1 of the present invention is the highest.

[0125] In addition: According to the above experimental method of the present invention, the antioxidant performance, whitening performance, repair effect on ultraviolet damage to skin cells, anti-aging ability, and ability to inhibit cell apoptosis of the brewer's yeast bamboo leaf fermentation lysate obtained in Examples 3 to 5 and Comparative Examples 1 to 2 are not as good as the corresponding experimental results obtained from the brewer's yeast bamboo leaf fermentation lysate obtained in Example 1 of the present invention.

[0126] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A method for preparing a lysate of Saccharomyces cerevisiae fermented from bamboo leaves, characterized in that The following steps are involved: 1) Preparation of seed solution: The fermentation bacteria are inoculated into YPD liquid medium to obtain seed liquid; 2) Fermentation: The seed solution was inoculated into the fermentation medium at a volume inoculation rate of 9-11% as the fermentation system, and then fermented under the following conditions: temperature 28-37°C, stirring speed 150-250 rpm, air flow 0.25-0.75 Nm 3 / h, fermenting until the pH value of the fermentation system no longer decreases, and then ending the fermentation to obtain a fermentation liquid; The fermentation culture solution is composed of the following components by weight: 1±0.1% of bamboo leaf powder, 2±0.1% of glucose, and the balance is deionized water; 3) The fermentation liquid obtained in step 2) is filtered and centrifuged, homogenized and centrifuged, sterilized and centrifuged, and the obtained supernatant is the lysate of the bamboo leaf fermentation of Saccharomyces cerevisiae.

2. The method for preparing a lysate of bamboo leaf fermentation of brewer's yeast according to claim 1, characterized in that: The fermentation bacteria in step 1) is Saccharomyces cerevisiae CICC 31105.

3. The method for preparing the lysate of bamboo leaf fermentation of brewer's yeast according to claim 2, characterized in that The method for preparing the seed solution in step 1) comprises the following steps: S1. Activation of strains: Activate Saccharomyces cerevisiae CICC 31105 by streaking on malt extract agar medium to obtain activated Saccharomyces cerevisiae; S2. Seed liquid expansion: inoculate the activated Saccharomyces cerevisiae into YPD liquid culture medium and culture in a shaking incubator at 28±0.5℃ for 20±2h.

4. The method for preparing the lysate of bamboo leaf fermentation of brewer's yeast according to claim 3, characterized in that The preparation method of the bamboo leaf powder in the fermentation culture medium of step 2) is as follows: take bamboo leaves, wash them, dry them at 50±5° C. for 3-5 days, and then grind them to pass through a 40-100 mesh sieve to obtain bamboo leaf powder.

5. The method for preparing the lysate of bamboo leaf fermentation of brewer's yeast according to claim 4, characterized in that The fermentation in step 2) includes the early fermentation stage and the middle and late fermentation stage: The fermentation start to 10 hours belongs to the early stage of fermentation. The set temperature is 30±0.5℃, the speed is 150~200rpm, and the air flow is 0.25~0.75Nm 3 / h; The air flow rate at the beginning of fermentation is 0.25Nm 3 / h; ferment the bacteria under natural DO value conditions; when the DO value drops to 0.1%, increase the air flow rate so that the DO value is controlled at 0.1~1%, and the maximum air flow rate cannot exceed 0.75Nm 3 / h; then continue to adjust the air flow rate to 0.25 ~0.75Nm 3 / h, thereby controlling the DO value to 0.1~1%; After 10 hours of fermentation, it enters the middle and late stages of fermentation. Set the temperature to 30±0.5℃, the speed to 200~250rpm, and the air flow to 0.25~0.75Nm 3 / h, and control the DO value to 0.1~1%; when the pH value of the fermentation system no longer decreases, the fermentation is judged to be over.

6. The method for preparing the lysate of bamboo leaf fermentation of brewer's yeast according to claim 5, characterized in that In the step 3): The filtration and centrifugation is as follows: the fermentation liquid is filtered through gauze and then centrifuged, and the solid part obtained by centrifugation is the fermentation mixture; The homogenization and centrifugation include homogenization and secondary centrifugation; The homogenization comprises: firstly diluting the fermentation mixture with water to form a suspension, wherein the mass content of the fermentation mixture in the suspension is 15-35%; and then performing a homogenization and crushing process to obtain a lysate; The secondary centrifugation comprises: centrifuging the lysate at 8000-1000 rpm for 5-10 min, and collecting the upper liquid obtained by centrifugation; The sterilization and centrifugation include sterilization and three centrifugations; The sterilization step is as follows: sterilizing the upper layer liquid obtained by the secondary centrifugation at 105-121° C. for 15-21 minutes, and then naturally cooling for 24-30 hours to obtain a sterilized liquid; The three centrifugations are as follows: the sterilized liquid is centrifuged at 8000-1000 rpm for 5-10 min, and the supernatant is taken, and the supernatant is the fermentation lysate of Saccharomyces cerevisiae bamboo leaves.

7. The method for preparing the lysate of bamboo leaf fermentation of brewer's yeast according to claim 6, characterized in that The homogenization and crushing treatment is as follows: homogenizing the suspension at 200-300 bar, repeating twice; increasing the pressure to 700-800 bar and homogenizing, repeating twice; continuing to increase the pressure to 1200-1300 bar and homogenizing, repeating twice; after completing the above three types of homogenization, the homogenization and crushing treatment is completed to obtain a lysate.

8. Use of the Saccharomyces cerevisiae bamboo leaf fermentation lysate prepared by any one of claims 1 to 7, characterized in that Is any of the following: Preparation of antioxidant substances, preparation of whitening substances, preparation of antibacterial substances.

9. The use of the bamboo leaf fermentation lysate of Saccharomyces cerevisiae according to claim 8, characterized in that: The antioxidant substance includes at least one of polysaccharides, flavonoids, and polyphenols; The whitening substance includes at least one of protein, polysaccharide and polyphenol; The antibacterial substance includes at least one of lactic acid, flavonoids and small molecule polypeptides.

10. Use of the bamboo leaf fermentation lysate of Saccharomyces cerevisiae prepared by any one of claims 1 to 7 in multi-effect skin care, characterized in that The multi-effect skin care includes anti-oxidation, whitening, UV repair and anti-aging, and strengthening of the skin barrier.

Images