Lactobacillus paracasei and bifidobacterium adolescentis fusion strain as well as preparation method and application thereof

Abstract

The invention discloses a lactobacillus paracasei and bifidobacterium adolescentis fusion strain as well as a preparation method and application thereof, and belongs to the technical field of strain breeding. By adopting the method provided by the invention, the fusion strain of the lactobacillus paracasei and the bifidobacterium adolescentis is successfully prepared, the prepared fusion strain has a new form, the utilization range of a carbon source is widened, and the inhibition effect on three pathogenic bacteria is remarkably improved; in addition, vancomycin and mupirocin lithium salt can be tolerated; the fermentation characteristics are good, the pH value is 4.05, the titer is 114 DEG T, the viable count can still be kept above 1 * 10 < 7 > CFU / mL, the viscosity value is 2,260 mpa.s, the hardness is 37.462 g, and the consistency is 282.04 g.s when the strain is stored for 28 days, and the strain can be used for development and application of dairy products; according to the provided preparation method, the obtained protoplast is high in regeneration capacity, high in activity and high in fusion rate, and a support is provided for a protoplast fusion technology in breeding of excellent strains of lactic acid bacteria.

Description

Technical Field

[0001] The invention relates to the technical field of strain breeding, in particular to a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis and a preparation method and application thereof. Background Art

[0002] At present, my country's lactic acid bacteria industry is developing rapidly, but key core technologies such as strain development and processing are lagging behind, including excellent strains such as lactic acid bacteria fermentation agents and probiotic preparations, which are known as the "chips" of the dairy industry. In addition, some probiotics cannot achieve the desired effect after taking them, so it is necessary to select and improve the strains to improve product quality and reduce strain production costs.

[0003] Microbial breeding is a method of selecting and breeding specific production target strains based on genetic principles and technologies. Through breeding, strain performance and practical application can be significantly optimized, product variety diversity can be increased, and process conditions can be optimized. Common strain breeding can be achieved through a variety of ways, such as natural breeding, mutation breeding, and hybrid breeding.

[0004] Compared with other methods, protoplast fusion technology has many unique advantages: the parents are less restricted by the combination type or fertility type. Due to the absence of cell wall barriers, the fused strains can cross the boundaries of species and achieve distant hybridization with large genetic differences, that is, it can effectively overcome the main physical and physiological barriers, thereby obtaining new types with outstanding excellent traits and improving the genetic characteristics of the strains; the fusion of protoplasts will form contact between the parental genes and realize gene exchange between strains, generate different recombinants of various gene types, and even form strains with specific functions or traits. In addition, the recombination frequency in this process is very high, and the genetic material is transmitted completely; the genes obtained from other methods can be transferred to the strains. The beneficial traits obtained can be combined and fused into one strain, that is, other breeding techniques and protoplast fusion technology are combined; more than two parents can also be fused into one strain, so as to select new strains with more advantages; in addition, inactivated protoplasts can also be fused. After being treated with temperature and ultraviolet irradiation, the parent becomes passivated and fused with the protoplasts of another parent that maintains activity. One parent can be effectively removed during the strain selection process, and the efficiency is greatly improved. Compared with genetic engineering breeding methods, this method can avoid relatively complex genetic operations such as separation and purification, shearing, and splicing. It is simple and easy, so this method is highly feasible.

[0005] As an important probiotic, bifidobacterium has been widely used in many fields such as food, health products and medicine. Lactobacillus paracasei is an important member of the genus Lactobacillus and one of the "three major probiotics for human health". Studies over the years have shown that the functions of bifidobacteria and Lactobacillus paracasei are mainly: maintaining and improving the stability of intestinal microecology, promoting digestion and absorption, producing antibacterial substances, inhibiting the growth of some pathogenic bacteria, reducing inflammatory reactions, enhancing immune function, delaying aging, anti-tumor, lowering cholesterol and promoting host health. However, since bifidobacteria are strictly anaerobic bacteria, it is difficult for the number of live bacteria in the preparation to maintain a high vitality for a long time; during the fermentation process of Lactobacillus paracasei, the post-acidification phenomenon is serious, and the accumulation of lactic acid to a high level will produce an autoinhibitory effect, which troubles the development and storage of bifidobacteria and Lactobacillus paracasei preparations. Summary of the invention

[0006] The invention aims to provide a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis and a preparation method and application thereof, so as to solve the problems of shortage of excellent bacterial strain resources in my country, high cost and low efficiency in strain selection and improvement, and to provide a fusion strain having excellent properties of both Bifidobacterium and Lactobacillus paracasei.

[0007] To achieve the above object, the present invention provides a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, the fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis is Lactobacillus paracasei PL-35, Lactobacillus paracasei is classified and named (Lacticaseibacillus paracasei), and is deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on July 8, 2024, with an address of the deposit unit: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and a deposit number of CGMCC NO.31228; Lactobacillus paracasei PL-35 is prepared from Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11.

[0008] A food comprising the above-mentioned Lactobacillus paracasei and Bifidobacterium adolescentis fusion strain, wherein the viable cell count concentration of the Lactobacillus paracasei and Bifidobacterium adolescentis fusion strain in the food is not less than 1×10 7 CFU / mL.

[0009] Preferably, the food is fermented milk.

[0010] A method for preparing the above-mentioned Lactobacillus paracasei and Bifidobacterium adolescentis fusion strain comprises the following steps:

[0011] S1. Protoplast preparation: Lactobacillus paracasei and Bifidobacterium adolescentis strains cultured to the logarithmic growth phase are collected, washed and resuspended with protoplast preparation solution, and then lysozyme is added for enzymolysis. After the enzymolysis is completed, the enzyme solution is removed, and the protoplast preparation solution is used to wash and resuspend again;

[0012] S2, inactivation of protoplasts: inactivation of the protoplasts obtained in S1 by ultraviolet inactivation or heat inactivation;

[0013] S3, protoplast fusion: take equal amounts of inactivated protoplasts obtained in S2 and mix them to obtain a mixed solution A, add PEG 6000 after mixing to obtain a mixed solution B, and perform water bath fusion;

[0014] The protoplast preparation solution in S1 is a mixture of 0.2mmol / L PBS buffer and 0.8mol / L mannitol;

[0015] The concentration of mixed solution B in S3 is 40% of the concentration of mixed solution A, and the conditions for water bath fusion are 37°C for 7 minutes;

[0016] PEG6000 contains 0.02 mol / L CaCl2·2H2O and 0.02 mol / L MgCl2·H2O.

[0017] Preferably, the conditions for ultraviolet inactivation in S2 are: preheating the ultraviolet lamp for 30 minutes, and irradiating the protoplast preparation solution containing protoplasts under the ultraviolet lamp for no less than 210 seconds.

[0018] Preferably, the heat inactivation condition in S2 is: keeping the protoplast preparation solution containing protoplasts at 40-50° C. for 30 min.

[0019] Preferably, the enzyme concentration of Bifidobacterium adolescentis in S1 is 0.75 mg / mL, the enzyme concentration of Lactobacillus paracasei is 1 mg / mL, and the enzymolysis time is 30 min.

[0020] Therefore, the present invention provides a Lactobacillus paracasei and Bifidobacterium adolescentis fusion strain and its preparation method and application, and its specific technical effects are as follows:

[0021] (1) The method provided by the present invention was used to successfully prepare a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis. The prepared fusion strain has a new morphology, which is straighter and arranged in a chain shape; a new available carbon source, L-proline, which can be used by both parents, is significantly higher in inhibitory effect on three pathogenic bacteria, Salmonella enteritidis, Staphylococcus aureus and Escherichia coli, than the two parents; and it has the advantages of both parents, being tolerant to both vancomycin and mupirocin lithium salt, and having the same sensitivity to 12 antibiotics and adaptability to growth conditions as the parent PC-92;

[0022] (2) The fusion strain PL-35 of Lactobacillus paracasei and Bifidobacterium adolescentis prepared by the present invention has good fermentation characteristics. The pH at the end of fermentation is 4.51, the pH after storage for 28 days is 4.05, the titer is 114°T, and the number of viable bacteria can still be maintained at 1×10 7 CFU / mL, which are all within the optimal drinking range specified by national standards; the viscosity value shows an upward trend with the extension of storage period. After 28 days of storage, the viscosity value is 2260mpa·s, the hardness is 37.462g, and the consistency is 282.04g·s. The storage quality is excellent and can be used for the development and application of dairy products;

[0023] (3) The present invention optimizes the conditions of the preparation method and obtains the optimal parameter combination for preparing the fusion strain of Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11. The obtained protoplasts have strong regeneration ability, high vitality and high fusion rate, which provides experimental data support for the protoplast fusion technology in the selection of excellent lactic acid bacteria strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0025] Figure 1 The effect of lysozyme concentration on the formation rate and regeneration rate of protoplasts in Example 1 of the present invention;

[0026] Figure 2 The effect of the enzymatic hydrolysis time on the formation rate and regeneration rate of protoplasts in Example 1 of the present invention;

[0027] Figure 3 This is a photo of the fusion process of Bifidobacterium adolescentis and Lactobacillus paracasei in Example 1 of the present invention, wherein A is Lactobacillus paracasei and B is Bifidobacterium adolescentis;

[0028] Figure 4 It is a gel electrophoresis diagram of PCR products during verification of the fusion gene level in Example 1 of the present invention; wherein M represents Maker, 1-8 are PCR amplification results using universal primers of Lactobacillus as templates, 9 and 19 are negative controls, 10 and 20 are positive parent controls, and 11-18 are PCR amplification results using primers of Bifidobacterium as templates;

[0029] Figure 5The colony morphology (A) and cell morphology (D) of the PC-92 strain, the colony morphology (B) and cell morphology (E) of the L6R11 strain, and the colony morphology (C) and cell morphology (F) of the fusion strain PL-35 in Example 1 of the present invention are shown;

[0030] Figure 6 The growth conditions of the strains in the MRS of Example 1 of the present invention with the addition of mupirocin lithium salt (A), vancomycin (B), the addition of mupirocin lithium salt and vancomycin (C), and no addition of antibiotics (D);

[0031] Figure 7 are the growth kinetic curves of PC-92, L6R11 and fusion in A-arabinose (A), L-proline (B) and D-ribose (C) in Example 2 of the present invention;

[0032] Figure 8 is the growth kinetic curve of PC-92, L6R11 and 8 strains of fusion in pH 9.5 in Example 2 of the present invention;

[0033] Fig. 9 is the number of viable cells of PC-92 and fusion product PL-35 in Example 5 of the present invention;

[0034] Fig.10 is the change of pH (A) and titratable acidity (B) of PL-35 during storage in Example 6 of the present invention;

[0035] Fig.11 is the change in the number of viable cells of PL-35 during storage in Example 6 of the present invention;

[0036] Fig.12 is the change in water holding capacity of PL-35 during storage in Example 6 of the present invention;

[0037] Fig.13 is the change in viscosity of PL-35 during storage in Example 6 of the present invention;

[0038] Fig.14 The texture changes of PL-35 in Example 6 of the present invention during storage; wherein A is the viscosity index inspection result; B is the cohesion inspection result; C is the consistency inspection result; and D is the hardness inspection result. DETAILED DESCRIPTION

[0039] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0040] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0041] The instruments, equipment, reagents and materials used in the examples were obtained through commercial channels. The methods not described in detail in the examples are conventional technical means in the art. Among them, Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11 were both from the Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University, and Salmonella enterica (Salmonella enterica CICC 10982), Bacillus cereus (Bacillus cereus CICC 10277) and Escherichia coli (Escherichia coli CICC 23657) were all from the Key Laboratory of Dairy Biotechnology and Engineering, Ministry of Education, Inner Mongolia Agricultural University.

[0042] Embodiment 1

[0043] The preparation method comprises the following steps:

[0044] S1. Prepare culture medium and reagents.

[0045] Regeneration solid culture medium: Add 25 g gelatin, 20 mmol / LMgCl2, and 0.5 mol / L sucrose to MRS agar medium (without Tween 80).

[0046] Protoplast preparation solution: 0.2mmol / LPBS buffer (19mL 0.2mmol / LNaH2PO4 solution, 81mL 0.2mmol / LNa2HPO4 solution), 0.8mol / L mannitol.

[0047] Enzyme solution: Use protoplast preparation solution to prepare 10 mg / mL lysozyme stock solution, filter and sterilize using filter membrane, dispense into 2 mL centrifuge tubes, and store at -80℃ for future use.

[0048] Polyethylene glycol (PEG6000) solution: Weigh 30.0 g of polyethylene glycol and gradually dissolve it into the protoplast preparation solution. At the same time, add 0.02 mol / L CaCl2·2H2O and 0.02 mol / LMgCL·H2O to make the volume 100 ml. Autoclave at 121°C for 15 minutes.

[0049] S2, activated strains. Use an inoculation loop to pick Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11 (stored at -80°C) and streak them on MRS solid plates, and place them in a 37°C incubator for 48 hours. Then pick a single pure colony from the plate, inoculate it in 4.5 mL MRS liquid culture medium, culture it at 37°C for 24 hours, and subculture it again and culture it for 24 hours.

[0050] S3. Prepare protoplasts.

[0051] (1) Investigate the effect of enzyme concentration on protoplast preparation and determine the optimal enzyme concentration.

[0052] After the strain is cultured to the logarithmic growth phase, centrifuge to collect the bacteria, then wash the bacteria twice with protoplast preparation solution, then resuspend in protoplast preparation solution, centrifuge again, then add an appropriate amount of lysozyme to make the lysozyme concentration of 5 mg / mL, 7.5 mg / mL, and 10 mg / mL, respectively, and enzymolysis at 37°C in a water bath for 30 min to remove the cell wall. After the treatment is completed, immediately centrifuge to remove the enzyme solution, wash twice with protoplast preparation solution, and finally resuspend the protoplasts in protoplast preparation solution to obtain protoplast fluid.

[0053] The protoplast formation rate was calculated by the following formula (1), and the protoplast regeneration rate was calculated by the following formula (2). Figure 1 As shown, the optimal enzyme concentration of Bifidobacterium adolescentis L6R11 is 0.75 mg / mL, and the optimal enzyme concentration of Lactobacillus paracasei PC-92 is 1 mg / mL.

[0054]

[0055] Among them, A-the number of colonies of bacterial suspension on MRS solid medium; B-the number of colonies of protoplast fluid on MRS solid medium; C-the number of colonies of protoplast fluid on regeneration solid medium.

[0056] (2) Investigate the effect of enzymatic hydrolysis time on protoplast preparation and determine the optimal enzymatic hydrolysis time.

[0057] After the strain is cultured to the logarithmic growth phase, centrifuge to collect the bacteria, then wash the bacteria twice with protoplast preparation solution, then resuspend in protoplast preparation solution, centrifuge again, and then add lysozyme to a lysozyme concentration of 1 mg / mL. Treat the bacterial solution in a 37°C water bath for 30 min, 60 min, and 120 min to remove the cell wall. After the treatment, centrifuge immediately to remove the enzyme solution, wash twice with protoplast preparation solution, and finally resuspend the protoplast solution in the protoplast preparation solution. The protoplast formation rate and regeneration rate were calculated using formula (1) and formula (2), respectively. The results are as follows: Figure 2 As shown in the figure, the optimal enzymatic treatment time is 30 min.

[0058] S4. Optimization of protoplast inactivation conditions.

[0059] (1) Optimization of UV inactivation conditions. Preheat the UV lamp for 30 min to stabilize the UV lamp irradiation intensity. Take 1 mL of the protoplast preparation solution containing protoplasts and irradiate it under the UV lamp for 90 s, 210 s, 360 s, and 600 s. Perform gradient dilutions on the protoplast preparation solution containing protoplasts treated differently, then spread it on the regeneration solid culture medium plate and culture it in a 37°C incubator for 48 h.

[0060] The inactivation rate was calculated using formula (3).

[0061] Wherein, A is the colony count of the protoplast preparation liquid of inactivated protoplasts on the regeneration solid medium; B is the colony count of the protoplast preparation liquid of non-inactivated protoplasts on the regeneration solid medium.

[0062] The results are shown in Table 1. The extension of UV irradiation time will cause the inactivation rate of protoplasts to gradually increase. When the UV irradiation time reaches 210s, the inactivation rate reaches 99.99%, indicating that the protoplasts have been completely inactivated. Therefore, 210s is selected as the optimal UV inactivation time.

[0063] Table 1

[0064] UV irradiation time(s) 90 210 360 600 Inactivation rate (100%) 64 99.99 100 100

[0065] (2) Optimization of heat inactivation conditions. The protoplast preparation solution containing protoplasts was kept at 50°C, 70°C and 90°C for 10 min, and the protoplast preparation solution containing protoplasts with different treatments was diluted in a gradient manner, then spread on a regeneration solid culture medium plate and cultured in a 37°C incubator for 48 h.

[0066] The inactivation rate was calculated using formula (3). The results are shown in Table 2. As the temperature increased, the inactivation rate gradually showed an increasing trend, reaching 99.96% at 50°C, indicating that the protoplasts were almost completely inactivated at 50°C. Therefore, it is effective to select 50°C as the thermal inactivation temperature.

[0067] Table 2

[0068] Inactivation temperature (℃) 50 70 90 Inactivation rate (100%) 99.96 100 100

[0069] Determination of the optimal time for heat inactivation. Take 1 mL of protoplast preparation solution containing protoplasts respectively, and keep it warm at 50°C for 30min, 40min, 50min and 60min respectively. The protoplast preparation solution containing protoplasts with different treatments is gradient diluted, then coated on a regeneration solid culture medium plate, and cultured in a 37°C incubator for 48h. The inactivation rate is calculated using formula (3). The results are shown in Table 3. The heat inactivation time also has a certain effect on the protoplasts. At 30min, the protoplasts are almost completely inactivated, and the inactivation rate is 99.98%. Therefore, 30min is selected as the heat inactivation time when performing heat inactivation treatment. In order to ensure the accuracy of subsequent experiments and ensure that the protoplasts are killed, it is necessary to strictly control the inactivation time and temperature.

[0070] Table 3

[0071] Heat inactivation time (min) 30 40 50 60 Inactivation rate (100%) 99.98 100 100 100

[0072] S5. Optimization of protoplast fusion conditions.

[0073] (1) Determine the optimal PEG concentration. Take 1 mL of inactivated protoplast fluid of Lactobacillus paracasei PC-92 and 1 mL of protoplast fluid of Bifidobacterium adolescentis L6R11, respectively, mix them, centrifuge to remove the supernatant, add 2 mL of 300 g / L, 400 g / L, and 500 g / L PEG6000 (containing 0.02 mol / L CaCl2·2H2O, 0.02 mol / L MgCl2·H2O), respectively, mix well, and incubate at 37°C for 7 min. Finally, spread on a regeneration solid culture medium containing mupirocin lithium salt (50 μg / mL), and count after culturing at 37°C for 3 days.

[0074] Then the fusion rate was calculated according to formula (4), and the results are shown in Table 4. The optimum PEG concentration is 40%, where 300 g / L×100%=300 / 1000×100%=30%.

[0075]

[0076] Table 4

[0077] PEG concentration (%) 30 40 50 <![CDATA[Fusion rate (10 -8 )]]> 6.5 7.9 5.8

[0078] (2) Determine the optimal fusion time.

[0079] 1 mL of inactivated protoplast fluid of Lactobacillus paracasei PC-92 strain and 1 mL of protoplast fluid of Bifidobacterium adolescentis L6R11 were mixed, centrifuged to remove the supernatant, and 2 mL of 400 g / L PEG 6000 (containing 0.02 mol / L CaCl2·2H2O, 0.02 mol / L MgCl2·H2O) were added and mixed, and then incubated in a 37°C water bath for 5 min, 7 min, 10 min, and 15 min. Finally, the mixture was spread on a regeneration solid medium containing mupirocin lithium salt (50 μg / mL), and the total number of colonies was counted after culturing at 37°C for 3 days. The fusion rate was calculated using formula (4), and the results are shown in Table 5. The optimal fusion time was 7 min.

[0080] Table 5

[0081] Fusion time (min) 5 7 10 15 <![CDATA[Fusion rate (10 -8 )]]> 5.6 7.9 7.2 6.7

[0082] (3) Determine the optimal fusion temperature.

[0083] 1 mL of inactivated protoplast fluid of Lactobacillus paracasei PC-92 and protoplast fluid of Bifidobacterium adolescentis L6R11 were mixed, centrifuged to remove the supernatant, and 2 mL of 400 g / L PEG 6000 (containing 0.02 mol / L CaCl2·2H2O, 0.02 mol / LMgCl2·H2O) were added and mixed, and placed at 4°C, 28°C, 37°C, and 42°C for 7 min. Finally, it was spread on a regeneration solid medium containing mupirocin lithium salt (50 μg / mL), and the total number of colonies was counted after culturing at 37°C for 3 days.

[0084] Then the fusion rate was calculated according to formula (4). The results are shown in Table 6. The optimal fusion temperature was 37°C.

[0085] Table 6

[0086] Fusion temperature (℃) 4 28 37 42 <![CDATA[Fusion rate (10 -8 )]]> 7.2 6.9 7.9 7.5

[0087] It can be seen from Tables 4 to 6 that the optimal fusion conditions for protoplasts are: 40% PEG as a fusogen and 37°C water bath for 7 minutes.

[0088] In addition, when studying the fusion time, it was found that a higher fusion rate was obtained when the fusion time was 7 minutes. If the time is too short, PEG cannot effectively promote fusion, and if the time is too long, the fusion rate decreases, which may be due to the toxic effect of PEG on protoplasts. Therefore, choosing 7 minutes as the fusion time and deeply understanding the effect of time factors on the fusion rate will help reveal the key factors in the fusion process.

[0089] The results of the temperature experiment showed that the protoplast fusion rate did not show an increasing trend with the increase of fusion temperature. This shows that within a certain range, temperature has little effect on the fusion effect. In summary, the optimal fusion conditions for protoplasts are: 40% PEG as a fusion promoter, 37°C water bath for 7 minutes. This experimental result provides experimental data support for research in related fields and lays a good foundation.

[0090] Methylene blue staining can be used to observe the fusion process of protoplasts. Figure 3 As shown in the optical microscope (×1000), two protoplasts can be seen to exist at the same time and to be in contact with each other, wherein A is Lactobacillus paracasei and B is Bifidobacterium adolescentis.

[0091] S6. Genetic verification of the fusion.

[0092] The parent Lactobacillus paracasei uses universal primers for lactobacillus, the forward primer sequence is shown in SEQ ID NO.1, and the reverse primer sequence is shown in SEQ ID NO.2. The parent Bifidobacterium adolescentis uses universal primer sequences for Bifidobacterium, the forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4. The successfully fused fusion genome should contain both DNA sequences in Lactobacillus paracasei and Bifidobacterium adolescentis.

[0093] SEQ ID NO.1:GGTAWYYAACYAGAAAGTCAC

[0094] SEQ ID NO.2:CTGAGAHMRGCTTTCAGAGAT

[0095] SEQ ID NO.3:GAAAGAAGAAGGCCACCAAGTAA

[0096] SEQ ID NO.4:GGTAAGAGTCGGACGCTGTGCAATAA

[0097] The extracted fusion genomic DNA was used as a template, and PCR amplification was performed with primers shown in SEQ ID NO.1 to SEQ ID NO.4, with water as a negative control and the parent as a positive control. The amplification system of the PCR reaction was: 1.5 μL of each forward and reverse primer (10 μM), 4 μL of dNTP, 10× buffer (amplification buffer, containing Mg 2+ions) 5μL, r-Taq enzyme (Taq DNA polymerase) 0.5μL, DNA template (100ng / μL) 2μL, ddH2O 35.5μL. PCR amplification conditions: pre-denaturation at 94℃ for 5min; denaturation at 94℃ for 1min, annealing at 58℃ for 1min, extension at 72℃ for 2min, denaturation, annealing and extension cycles for 30 times; terminal extension at 72℃ for 10min; PCR products were stored after termination of the reaction at 4℃.

[0098] The results are as follows Figure 4 As shown, bands were obtained in the products of PCR amplification using Lactobacillus primers and Bifidobacterium primers, and the negative control had no amplification product band, while the positive control amplification product band was clear, indicating that the fusion product had both parental genes and was successfully prepared.

[0099] S7. Analyze the physiological characteristics of the fusion products.

[0100] (1) Morphological analysis of fusion products.

[0101] The fusion product PL-35 was selected for subsequent experiments. The photo of the fusion product colony grown on solid MRS medium for 48 hours is shown in the figure below. Figure 5 As shown, part A is PC-92, part B is L6R11, and part C is PL-35 fusion. The colony morphology of PC-92 and PL-35 is milky white with neat edges and produces stringy mucus, while the colony morphology of L6R11 is extremely small and white.

[0102] The colonies on the solid MRS medium were selected for Gram staining and observed under an optical microscope at ×1000. Figure 5 As shown in the DF section, D is PC-92, E is L6R11, and F is PL-35 fusion. All three strains were positive for Gram staining. PC-92 cells were in the shape of curved rods and arranged in a single pattern. L6R11 cells were in the shape of irregular rods, with some in the shape of a typical Y. PL-35 cells were in the shape of straight rods and arranged in chains.

[0103] (2) Investigate the growth of strains under different antibiotic conditions.

[0104] During the fusion process, countless colonies will be produced. After adding antibiotics, strains that do not have the characteristics of both parents can be effectively removed. The fusion product was streaked on solid MRS medium with antibiotics added. The amount of mupirocin lithium salt added was 50μg / mL and the amount of vancomycin added was 10μg / mL. The culture was observed for 48 hours.

[0105] The results are as follows Figure 6As shown, parts AD are the growth of strains in ordinary MRS medium with mupirocin lithium salt, vancomycin, mupirocin lithium salt and vancomycin added at the same time, and no antibiotics added. Figure 6 It can be seen that PC-92 can grow with the addition of vancomycin, but is intolerant to mupirocin lithium, and did not grow after adding both antibiotics at the same time; L6R11 did not grow when vancomycin was added, but grew when mupirocin lithium was added, indicating that it is intolerant to vancomycin and did not grow after adding both antibiotics at the same time; the fusion product PL-35 can grow with the addition of both vancomycin and mupirocin lithium, and also grows normally when added at the same time, which shows that the fused strain is tolerant to both antibiotics at the same time, which may be due to changes in the genetic information of the fused strain.

[0106] Embodiment 2

[0107] PM high-throughput phenotyping to identify the strain metabolism of fusion PL-35, the specific steps are as follows:

[0108] In order to identify the growth characteristics of the strains under different environments, the OmniLog PM phenotypic identification system was used for the experiment. The carbon source metabolism of the strains was identified using PM 0196-well microplates, each well containing a specific carbon source; the osmotic pressure metabolism of the strains was identified using PM 0996-well microplates, each well containing a specific osmotic pressure; and the pH metabolism of the strains was identified using PM 1096-well microplates, each well containing a specific pH. Except for bacterial culture, the test process and the preparation of the inoculation solution were carried out in accordance with the attached operating manual.

[0109] The main experimental process is as follows: isolate the target strain by streaking a single colony on an MRS solid plate, use a disposable inoculation loop to pick up a single colony cell from the MRS solid plate and place it in a sterile cap tube, and stir the cell suspension to make it uniform; measure its turbidity to ensure that it reaches 81% T; then add the cell suspension to the prepared PM 01, PM 09 and PM 10 inoculation solutions, mix well and inoculate into the corresponding microplates (100 μL / well). All PM microplates were cultured at 37°C in OmniLog for 72 hours. The experiment was repeated three times.

[0110] (1) Fusion carbon source utilization.

[0111] The PM analysis kinetic curves of the fusion PL-35 and the parent showed that the utilization of carbon sources by PL-35 overlapped with that of the parent PC-92, but was quite different from that of the parent L6R11. The carbon sources A-arabinose (A-Arabino), D-ribose (D-Xylose) and L-proline (L-Proline) were selected and measured under an automatic growth curve instrument for 48 hours to further verify the accuracy of the data. The verification results are shown in Figure 7As shown, it was proved that the growth curve of PL-35 on L-proline was significantly different from that of the two parents.

[0112] The results of a study by Ma Ruifen et al. on the carbon source utilization of the commercial Lactobacillus casei Zhang strain L. casei Zhang showed that it did not utilize D-ribose and L-proline (laboratory evolution study with continuous passage to 3000 generations [D]. Inner Mongolia Agricultural University, 2015). The fusion product PL-35 provided by the present invention has less restriction on growth and metabolic capacity, and a wider variety of raw materials can be selected during fermentation.

[0113] (2) Fusion pH.

[0114] The PM analysis kinetic curves of the fusion PL-35 and the parent showed that both the fusion and the parent could grow at pH 8.5-9.5. The growth kinetic curves of PL-35 and the parent PC-92 were highly overlapped, and there was a large difference with the parent L6R11. pH 9.5 was selected for 48h measurement under an automatic growth curve instrument to further verify the accuracy of the data. The verification results are as follows Figure 8 As shown, it shows that the fusion product and the parent can indeed grow under alkaline conditions without any difference.

[0115] (3) Osmotic pressure of fusogen.

[0116] The results showed that both the fusion product and the parent could grow only in the presence of sodium dihydrogen phosphate and a neutral pH, and there was no difference between the strains.

[0117] Embodiment 3

[0118] The antibacterial ability of the fusion product PL-35 was investigated. The specific steps are as follows:

[0119] The Oxford cup method was used to determine the inhibitory effects of the supernatants of the fusion products PL-35, PC-92 and L6R11 on three pathogenic bacteria: Salmonella enterica CICC 10982, Staphylococcus aureus ATCC12600 and Escherichia coli CICC 23657.

[0120] The specific operation steps are as follows: PC-92, L6R11 and fusion PL-35 were cultured in MRS liquid medium at 37℃ for 12h, and then centrifuged (5000×g, 4℃, 10min) to collect the supernatant. The supernatant was filtered through a 0.22μm filter membrane. The bacterial suspension concentrations of Salmonella enterica CICC 10982, Staphylococcus aureus ATCC 12600 and Escherichia coli CICC 23657 were adjusted to 10 6 CFU / mL. Add the indicator bacteria suspension to the NA medium at a 1% inoculation volume and mix well, then pour it into a sterilized plate for culture. Place the sterilized Oxford cup in the NA medium and press gently. After it solidifies, add 100μL of CFS to each well, incubate at 37℃ for 18h, measure the diameter of the inhibition zone, and prepare 3 parallel samples for each indicator bacteria to ensure accurate and reliable experimental results.

[0121] The results are shown in Table 7. PC-92, L6R11 and fusion PL-35 have antibacterial ability against different pathogens. The fusion PL-35 maintains the good antibacterial ability of the parent PC-92, and its antibacterial effect on the three pathogens is significantly higher than that of the two parents.

[0122] Table 7

[0123] strain Staphylococcus aureus Salmonella Enteritidis Escherichia coli PC-92 <![CDATA[24.43±0.25 b mm]]> <![CDATA[22.72±0.08 d mm]]> <![CDATA[20.57±0.33 e mm]]> L6R11 <![CDATA[5.12±0.257 f mm]]> <![CDATA[4.24±0.08 i mm]]> <![CDATA[5.25±0.142 j mm]]> PL-35 26.85±0.34amm <![CDATA[26.08±0.29 a mm]]> <![CDATA[21.57±0.42 b mm]]>

[0124] Note: Different lowercase letters represent significant differences among different strains (P<0.05)

[0125] Zhang Qijin et al. conducted an antibacterial evaluation on the commercial Lactobacillus paracasei strain L. casei Zhang, and the results showed that the inhibition zone of L. casei Zhang strain against Salmonella enterica was 13.28±2.09 mm, and against Escherchia coli was 12.22±2.01 mm (Study on Anti-infection and Immune Synergy [D]. Inner Mongolia Agricultural University, 2006). The antibacterial effect of the PL-35 fusion provided by the present invention on Salmonella enterica and Escherchia coli is significantly higher than that of the commercial Lactobacillus paracasei strain L. casei Zhang.

[0126] Embodiment 4

[0127] Referring to the method of international standard ISO 10932-2010, the sensitivity of strains to antibiotics was evaluated by measuring the minimum inhibitory concentration (MIC) of PC-92, L6R11 and fusion PL-35 in culture medium with 12 different antibiotics. The specific steps are as follows:

[0128] (1) Preparation of antibiotics:

[0129] The antibiotics used are divided into two categories, one is water-soluble antibiotics and the other is water-insoluble antibiotics. Water-soluble antibiotics are dissolved in LSM (90% IST + 10% MRS), while water-insoluble antibiotics need to be dissolved in corresponding organic solvents (Rif is dissolved in methanol, Chl and Ery are dissolved in 95% ethanol, Tri needs to be dissolved in glacial acetic acid, and Cip is dissolved in LSM). Then use LSM liquid culture medium as a diluent to dilute the dissolved antibiotic mother solution to prepare the antibiotic dilution solution with the corresponding concentration gradient.

[0130] (2) Activation and cultivation of strains:

[0131] The PC-92, L6R11 and fusion product PL-35 were streaked twice on MRS solid medium, and single colonies were selected and picked, and mixed with 0.85% saline. Then, the concentration of the bacterial suspension was adjusted to OD 625nm In the range of 0.16 to 0.2, the bacterial suspension was then diluted with LSM liquid culture medium, and the corresponding volume of bacterial suspension was added according to the corresponding antibiotics.

[0132] (3) Determination of minimum inhibitory concentration:

[0133] According to the international standard ISO 10932-2010, the minimum inhibitory concentration (MIC) of PC-92, L6R11 and fusion PL-35 to 12 antibiotics (kanamycin sulfate, streptomycin sulfate, neomycin sulfate, clindamycin hydrochloride, tetracycline hydrochloride, ampicillin, linezolid, erythromycin, rifampicin, ciprofloxacin, chloramphenicol and trimethoprim) was determined by broth microdilution method. During the experiment, a sterilized 96-well plate was used, and 100 μL of antibiotic dilutions of different concentrations (see Table 9) were added to the 2nd to 11th wells according to the concentration from low to high. At the same time, in order to determine the accuracy of the experimental data, a blank control was made in the first well of each row without adding bacterial solution, and the 12th well was set as a growth control without adding antibiotics to make a MIC plate. Next, the diluted bacterial suspension was added to each well of the MIC plate, sealed and placed at 37°C for 48 hours. Each antibiotic concentration was tested in triplicate to ensure the accuracy of the experimental results. Antibiotic resistance was determined according to the EFSA and international standard ISO 10932-2010 standards for Lactobacillus paracasei and Bifidobacterium.

[0134] Each strain was compared with the resistance standard of Lactobacillus paracasei published by EFSA, that is, the MIC value. If the strain was higher than the resistance standard published by EFSA, it was judged as resistant, and if it was lower than or equal to the threshold, it was judged as sensitive. The sensitivity results of PC-92, L6R11 and fusion PL-35 to 12 different antibiotics are shown in Table 8. The resistance of fusion PL-35 was consistent with that of PC-92, and it was sensitive to trimethoprim and tolerant to other antibiotics.

[0135] Table 8

[0136] strain Str Kana Neo Cli Tet Amp Lin Ery Rif Cip Chl Tri PC-92 R R R R R R R R R R R S L6R11 R R R S R S R R R R R S PL-35 R R R R R R R R R R R S

[0137] Note: Antibiotic sensitivity: sensitive (S), resistant (R), streptomycin (Str), kanamycin (Kana), neomycin (Neo), clindamycin (Cli), tetracycline (Tet), ampicillin (Amp), linezolid (Lin), erythromycin (Ery), rifampicin (Rif), ciprofloxacin (Cip), chloramphenicol (Chl), trimethoprim (Tri).

[0138] Table 9

[0139]

[0140] Embodiment 5

[0141] Investigate the growth of the strains under the same conditions. The specific steps are as follows:

[0142] In order to explore the changes in the growth of the fusion and the parent, the strains were inoculated with the same inoculum (2%, v / v) in MRS liquid medium, and PC-92 and PL-35 were cultured in a 37°C incubator. In order to monitor the changes in the growth process, the number of viable cells and pH value were measured every 2 hours during the growth process. Based on these data, the growth of different strains under the same conditions was fully understood.

[0143] Determination of viable count: The plate count method was used to determine the viable count of the strain. First, the bacterial solution at different time points was gradient diluted with PBS buffer solution, 1 mL of the appropriate gradient diluted bacterial solution was drawn into a sterile culture dish, MRS solid culture medium was poured into the culture dish and cultured in a 37°C incubator, and single colonies were counted after 48 hours of culture.

[0144] The viable bacterial count and pH change values ​​of the strains at different time points were used to draw curves to evaluate the fusion strain PL-35 and the parent PC-92. The results are as follows Fig. 9 As shown in the figure, PC-92 and PL-35 have the same growth trend, which is a logarithmic growth phase within 2-12 hours, and then the number of viable cells changes slowly and enters a stable growth phase. The number of viable cells of the fusion PL-35 at each time point is not significantly different from that of the parent (P>0.05). There is also no significant difference in pH value during the growth of the two strains (P>0.05).

[0145] Embodiment 6

[0146] To evaluate the fermentation characteristics of the strain, the specific steps are as follows:

[0147] After the skim milk was hydrated at 55-60℃ for 30min, it was homogenized at 65℃ and 20Mpa, sterilized at 95℃ for 5min, and rapidly cooled. 7 CFU / mL inoculated bacteria, stirred and packaged, and then placed in a 37℃ constant temperature incubator for culture. When the fermented milk reaches the end of fermentation, it is stored at 4℃. During the storage process, the pH, titrated acidity and viable count of the sample need to be monitored. The above indicators are measured on the day of storage (i.e. 0d), 7d, 14d, 21d, and 28d; at the same time, the viscosity, texture and water holding capacity are measured at 1d and 28d to evaluate the quality of the product.

[0148] (1) Evaluate the acid production capacity of the fusates.

[0149] The acid production capacity of lactic acid bacteria was investigated by monitoring the pH and titratable acidity during the fermentation process. Fig.10As shown, the pH of fermented milk showed a downward trend. The pH of PL-35 was 4.51 at the end of fermentation and 4.05 at the end of storage. The most suitable drinking range of fermented milk during storage is pH 4.0-4.35, so the pH value of fermented milk during storage is within the optimal drinking range, and the overall pH shows a significant downward trend, which may be due to the decrease in lactic acid bacteria activity and insufficient acid production capacity in the later period. The titrated acidity of the samples during storage increased significantly during storage, and PL-35 was 114°T at the end of storage, and the titrated acidity was lower than 120°T. Within this range, the product is easily accepted by the public.

[0150] (2) Determination of the number of viable bacteria in fermented milk.

[0151] The results are as follows Fig.11 As shown in Figure 2, the number of viable bacteria continued to decrease during the storage period, but after the storage ended, the number of viable probiotics could still be maintained at 1×10 7 The live bacteria count level above CFU / mL can effectively ensure that probiotics enter the human body in a sufficient live bacteria state to exert their probiotic effects.

[0152] (3) Determination of water holding capacity of fermented milk.

[0153] Water holding capacity refers to the water content in fermented milk, which directly affects the taste, texture and storage period of fermented milk. Fermented milk with higher water holding capacity will be more stable, while fermented milk with lower water holding capacity will precipitate whey and make the taste rough.

[0154] The results are as follows Fig.12 As shown in the figure, the water holding capacity of PL-35 was the highest at 63.39% at the end of storage for 1 day, and it decreased to 60.27% at the end of storage for 28 days. The water holding capacity of the strains was within the range.

[0155] (4) Determination of viscosity of fermented milk.

[0156] Viscosity is one of the important indicators for evaluating the flavor and quality of fermented milk. The viscosity value reflects whether the tissue state of the fermented milk is good, thereby judging the taste and texture of the product. Fig.13 As shown in the figure, the initial viscosity of the sample is low, but as the storage period increases, the viscosity shows an upward trend, indicating that over time, under the action of lactic acid bacteria, the internal structure of the fermented milk may change, resulting in an increase in viscosity. The viscosity of PL-35 increased from 1003mpa·s to 2260mpa·s.

[0157] (5) Determination of texture characteristics of fermented milk.

[0158] For fermented milk, texture can reflect the overall quality of the product. Its evaluation indicators mainly include hardness, consistency, cohesion and viscosity index. Among them, hardness has a significant impact on the quality of yogurt. The higher the hardness value of fermented milk, the better the fermentation degree of the product, and the better the taste and quality of the product. Fig.14 As shown in the data, during storage, the texture hardness and consistency increased. The hardness of PL-35 increased by 37.462 g; the consistency of PL-35 increased by 282.04 g·s. This may be due to the contraction of the gel structure, which increased the strength of the gel and increased its indexes, while reducing the cohesiveness and viscosity index. The strain has good storage properties, indicating that it can be used in the development and application of dairy products.

[0159] Therefore, the method provided by the present invention is used to successfully prepare a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis. The prepared fusion strain has a new morphology, broadens the scope of carbon source utilization, and has a significantly higher inhibitory effect on three pathogenic bacteria, namely, Salmonella enteritidis, Staphylococcus aureus and Escherichia coli, than the two parents; it has the advantages of both parents, and is tolerant to both vancomycin and mupirocin lithium salt; it has good fermentation characteristics, and the pH is 4.05 and the titer is 114°T after storage for 28 days, and the number of viable bacteria can still be maintained at 1×10 7 The content of the protoplasts in the raw materials is 2400 N·m3 / mL, the viscosity is 2260 mpa·s, the hardness is 37.462 g, and the consistency is 282.04 g·s, all of which are within the optimal drinking range specified by the national standard. The storage quality is excellent and the product can be used for the development and application of dairy products. The preparation method provided by the invention has strong protoplast regeneration ability, high vitality and high fusion rate, which provides experimental data support for the selection of excellent lactic acid bacteria strains using protoplast fusion technology.

[0160] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis, characterized in that The fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis Lactobacillus paracasei PL-35, which is classified and named (Lacticaseibacillusparacasei), and was deposited in the General Microbiology Center of China Culture Collection Administration on July 8, 2024. The address of the depository unit is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCCNO.31228; Lactobacillus paracasei PL-35 is prepared from Lactobacillus paracasei PC-92 and Bifidobacterium adolescentis L6R11.

2. A food comprising the fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis according to claim 1, characterized in that: The viable bacterial count concentration of the fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis in the food is not less than 1×10 7 CFU / mL.

3. The food according to claim 2, characterized in that: The food is fermented milk.

4. A method for preparing a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis as claimed in claim 1, characterized in that: Here are the steps: S1. Protoplast preparation: Lactobacillus paracasei and Bifidobacterium adolescentis strains cultured to the logarithmic growth phase are collected, washed and resuspended with protoplast preparation solution, and then lysozyme is added for enzymolysis. After the enzymolysis is completed, the enzyme solution is removed, and the protoplast preparation solution is used to wash and resuspend again; S2, inactivation of protoplasts: inactivation of the protoplasts obtained in S1 by ultraviolet inactivation or heat inactivation; S3, protoplast fusion: take equal amounts of inactivated protoplasts obtained in S2 and mix them to obtain a mixed solution A, add PEG 6000 after mixing to obtain a mixed solution B, and perform water bath fusion; The protoplast preparation solution in S1 is a mixture of 0.2mmol / L PBS buffer and 0.8mol / L mannitol; The concentration of mixed solution B in S3 is 40% of the concentration of mixed solution A, and the conditions for water bath fusion are 37°C for 7 minutes; PEG6000 contains 0.02 mol / L CaCl2·2H2O and 0.02 mol / L MgCl2·H2O.

5. The method for preparing a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis according to claim 4, wherein: The conditions for UV inactivation in S2 are: preheat the UV lamp for 30 min, and irradiate the protoplast preparation solution containing protoplasts under the UV lamp for no less than 210 s.

6. The method for preparing a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis according to claim 4, characterized in that: The heat inactivation conditions in S2 are: the protoplast preparation solution containing protoplasts is kept at 40-50°C for 30 minutes.

7. The method for preparing a fusion strain of Lactobacillus paracasei and Bifidobacterium adolescentis according to claim 4, characterized in that: The enzyme concentration in Bifidobacterium adolescentis in S1 was 0.75 mg / mL, and the enzyme concentration in Lactobacillus paracasei was 1 mg / mL, and the enzymolysis time was 30 min.

Images