Brucella attenuated live vaccine strain m5 delta lysr21 and its attenuation method and application

Abstract

The present application relates to the field of biotechnology, and particularly relates to a Brucella attenuated live vaccine strain M5Delta lysR21 and an attenuating method and application thereof, wherein the M5Delta lysR21 is obtained by deleting a lysR21 gene from a M5 strain of ovine Brucella, and the Brucella attenuated live vaccine strain MSDelta lysR21 is preserved in the China General Microbiological Culture Collection Center, located at No. 1, Beichen West Road, Yard 3, Chaoyang District, Beijing, on November 21, 2024, with a preservation number of CGMCC NO. 32791. It is found in the present application that the lysR21 gene is related to the virulence of Brucella, and the deletion of the lysR21 gene can weaken the virulence of Brucella, can significantly reduce the survival ability of Brucella in cells and in mice, and shows stronger immunoprotective property than a vaccine strain, and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis, and has potential application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a Brucella attenuated live vaccine strain M5Delta lysR21 and its attenuation method and application. BACKGROUND

[0002] Brucellosis, simply referred to as "brucellosis", is a human and animal shared infectious disease caused by Brucella infection. Brucella is a gram-negative intracellular parasitic bacteria, and B. melitensis, B. abortus and B. suis are more common. Human infection with Brucella has various clinical manifestations, such as fever, sweating, fatigue, joint and muscle pain, and can turn into chronic if not treated or treated in time, leading to prolonged illness. Livestock infected with Brucella can have testicular or epididymal inflammation in male animals, and abortion, premature birth or stillbirth in female animals.

[0003] Brucellosis is widely prevalent and distributed in the world. It is reported that there are nearly 170 countries and regions in the world where people and animals are infected with Brucella. In recent years, due to factors such as increase in animal feed, frequent animal trade and circulation, Brucellosis has shown a rising trend worldwide and is a public health problem faced by the world, especially developing countries.

[0004] The prevention and control of brucellosis mainly depends on quarantine, culling and destruction, and vaccination. Vaccination is the most effective way to prevent brucellosis in livestock. The development of brucellosis vaccine can be traced back to the early 20th century. With the in-depth understanding of the pathogenesis of brucellosis, the development of vaccines has also undergone the evolution of inactivated vaccines, attenuated live vaccines, mutant vaccines and new vaccines. Among them, attenuated live vaccines have long-lasting and high efficiency, and most of the vaccines used in China are attenuated live vaccines. However, the existing attenuated vaccines have certain defects, such as high toxicity and serious reversion. In addition, there is no very effective vaccine and treatment method for human brucellosis, and there is also a risk of transmission to humans in the process of vaccinating animals.

[0005] Therefore, with the in-depth study of the pathogenesis of Brucella and the development and application of related molecular biology techniques, it is the key to control the prevalence of brucellosis to develop a vaccine that can overcome the defects of existing vaccines and is safe and effective for animals and humans. SUMMARY

[0006] The purpose of the present application is to provide a Brucella attenuated live vaccine strain M5Delta lysR21 and its attenuation method and application, which is attenuated by knocking out the lysR21 gene, and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0007] The purpose of the present application is achieved by the following technical scheme:

[0008] The application provides a Brucella attenuated live vaccine strain M5Delta lysR21, which is obtained by deleting a lysR21 gene from a Brucella melitensis M5 strain, and is preserved in the China General Microbiological Culture Collection Center, 1st Courtyard, Beichen West Road, Chaoyang District, Beijing, on November 21, 2024, with a preservation number of CGMCC NO.32791 and a classification name of Brucella melitensis.

[0009] The application further provides a Brucella attenuating method, which comprises the step of knocking out or deleting a lysR21 gene in Brucella, which is the Brucella melitensis M5 strain.

[0010] Further, the method specifically comprises the following steps:

[0011] (1) PCR amplifies the upstream and downstream homologous arm fragments of the lysR21 gene, and after amplification, fusion PCR is used to fuse the two fragments to obtain a fusion fragment;

[0012] (2) The fusion fragment is connected with a linearized suicide plasmid pKB by a homologous recombination method to obtain a recombinant plasmid, and after screening and extraction, a suicide plasmid pKB- Delta lysR21 is obtained;

[0013] (3) The suicide plasmid pKB-Delta lysR21 is electroporated into the competent cells of the Brucella melitensis M5 strain, and after double screening, the M5Delta lysR21 deletion strain is obtained.

[0014] Further, in step (1), the primer sequences used when the PCR amplifies the upstream and downstream homologous arm fragments of the lysR21 gene are shown in SEQ ID NO. 1-4, wherein the primer sequence shown in SEQ ID NO. 1 (LysR21-UF) and the primer sequence shown in SEQ ID NO. 2 (LysR21-UR) are used to amplify the upstream homologous arm fragment, the primer sequence shown in SEQ ID NO. 3 (LysR21-DF) and the primer sequence shown in SEQ ID NO. 4 (LysR21-DR) are used to amplify the downstream homologous arm fragment, and the primer set used in the fusion PCR is the primer sequence shown in SEQ ID NO. 1 (LysR21-UF) and the primer sequence shown in SEQ ID NO. 4 (LysR21-DR).

[0015] Further, in step (2), the screening method is to transform the recombinant plasmid into E. coli DH5a competent cells, screen kanamycin-resistant strains in turn on LB solid medium containing kanamycin and liquid medium, then perform PCR bacterial liquid identification, and extract the pKB-ΔlysR21 suicide plasmid.

[0016] Further, in step (3), the double screening method is to electrotransform the suicide plasmid extracted in step (2) into Brucella competent cells, coat the product on TSA solid medium containing kanamycin, pick single colony bacteria in TSB liquid medium, then perform negative screening on TSA solid medium containing 5% sucrose, pick single colony bacteria in TSB liquid medium, and perform PCR bacterial liquid identification on the M5ΔlysR21 deletion strain using the inside identification primer and the outside identification primer.

[0017] Further, the inside identification primer is InLysR21-F as shown in SEQ ID NO. 5 and InLysR21-R as shown in SEQ ID NO. 6; and the outside identification primer is OutLysR21-F as shown in SEQ ID NO. 7 and OutLysR21-R as shown in SEQ ID NO. 8.

[0018] The application further provides application of the attenuated live vaccine strain M5ΔlysR21 of Brucella or the attenuated Brucella prepared by the Brucella attenuation method in preparation of a preparation for preventing brucellosis.

[0019] Further, the preparation is an attenuated live vaccine of Brucella.

[0020] Beneficial effects:

[0021] (1) The application finds that lysR21 gene deletion can affect the basic phenotype of Brucella, such as the ability to resist oxidative stress and the ability to resist nitrogen stress, which are significantly reduced.

[0022] (2) The application finds that the lysR21 gene is related to the virulence of Brucella, lysR21 gene deletion can weaken the virulence of Brucella, and the survival ability of Brucella in cells and in mice can be significantly reduced after deletion, which has potential application value.

[0023] (3) The constructed M5ΔlysR21 gene deletion strain has weaker virulence compared with the original Brucella M5 strain, and has stronger immunoprotective property compared with the M5-90Δ26 vaccine strain, and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to make the technical solutions in the embodiments of the present application or the prior art clearer, the accompanying drawings needed in the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description only need to be some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort.

[0025] Figure 1 Figure for the result of PCR amplification of target gene fragment in Example 1 of the present application;

[0026] Figure 2 Figure for the result of identification of suicide plasmid pKB-ΔlysR21 using universal primer M13F(-47) / R(-48) in Example 1 of the present application;

[0027] Figure 3 Figure for the structure of M5ΔlysR21 deletion strain identified by inner and outer primers PCR in Example 1 of the present application;

[0028] Figure 4 Figure for the result of PCR identification of M5ΔlysR21 deletion strain in Example 1 of the present application; wherein, A is the result of PCR identification of parent strain M5 and M5ΔlysR21 deletion strain using inner identification primer InLysR21-F and InLysR21-R; B is the result of PCR identification of parent strain M5 and M5ΔlysR21 deletion strain using outer identification primer OutLysR21-F and OutLysR21-R;

[0029] Figure 5 Figure for the result of Western Blot identification of M5ΔlysR21 deletion strain in Example 1 of the present application, wherein, A is the result of identification of LysR21 expression, and B is the result of identification of GroEL expression;

[0030] Figure 6 Figure for the determination of Brucella growth curve in Test Example 1 of the present application, which shows the growth curve result of parent strain M5 and M5ΔlysR21 deletion strain in TSB medium;

[0031] Figure 7 Figure for the result of tolerance test in Test Example 1 of the present application; wherein, A is the sensitivity of parent strain M5 and M5ΔlysR21 deletion strain to H2O2; B is the tolerance of parent strain M5 and M5ΔlysR21 deletion strain to SNP; statistical analysis: “ns” means that there is no significant difference in data; “*” means that p value≤0.05, “**” means that p value≤0.01, and there is significant difference in data;

[0032] Figure 8Figure of the test results of the adhesion and invasion of the M5 parent strain and the M5ΔlysR21 deletion strain in RAW264.7 cells in the test example 2 of the present application; statistical analysis: "ns" indicates that there is no significant difference in the data;

[0033] Figure 9 Figure of the survival test results of the M5 parent strain and the M5ΔlysR21 deletion strain in RAW264.7 cells in the test example 2 of the present application; statistical analysis: "ns" indicates that there is no significant difference in the data; "**" indicates that the p value is less than or equal to 0.01, and there is a significant difference in the data;

[0034] Figure 10 Figure of the results of evaluating the pathogenicity of the parent strain M5 and the M5ΔlysR21 deletion strain in the mouse infection test in the test example 2 of the present application; wherein, the left figure is the results of the spleen weight and the spleen bacterial load of the mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 2 weeks; the right figure is the results of the spleen weight and the spleen bacterial load of the mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 4 weeks; statistical analysis: "ns" indicates that there is no significant difference in the data; "*" indicates that the p value is less than or equal to 0.05, "**" indicates that the p value is less than or equal to 0.01, and "***" indicates that the p value is less than or equal to 0.001, and there is a significant difference in the data;

[0035] Figure 11 Figure of the liver lesion condition of the M5 parent strain and the M5ΔlysR21 deletion strain in the mouse infection test in the test example 2 of the present application; wherein, figure A is the histopathological change results of the liver of the mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 2 weeks; figure B is the histopathological change results of the liver of the mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain for 4 weeks; the arrow in the figure indicates the liver granuloma formed by brucella infection;

[0036] Figure 12 Figure of the humoral immune condition of the mice infected with the M5 parent strain and the M5ΔlysR21 deletion strain in the test example 2 of the present application;

[0037] Figure 13 Figure of the immune protection test results of the M5ΔlysR21 as a vaccine in the test example 2 of the present application; wherein, figure A is the results of the spleen bacterial load and the spleen weight of the mice immunized with the deletion strain M5ΔlysR21 and the vaccine strain M5-90Δ26 after 30 days, and then attacked by M5 for 2 weeks; figure B is the results of the spleen bacterial load and the spleen weight of the mice immunized with the deletion strain M5ΔlysR21 and the vaccine strain M5-90Δ26 after 45 days, and then attacked by M5 for 2 weeks; statistical analysis: "ns" indicates that there is no significant difference in the data; "*" indicates that the p value is less than or equal to 0.05, and "***" indicates that the p value is less than or equal to 0.001, and there is a significant difference in the data;

[0038] Figure 14Figure A is the result of histopathological changes of liver of mice immunized with the deletion strain M5AlysR21 and the vaccine strain M5-90A26 30 days after immunization and 2 weeks after challenge with M5; Figure B is the result of histopathological changes of liver of mice immunized with the deletion strain M5AlysR21 and the vaccine strain M5-90A26 45 days after immunization and 2 weeks after challenge with M5; the arrow in the figure indicates the liver granuloma formed by Brucella infection. DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. The detailed description is not to be regarded as limiting the application, but rather as a description of certain aspects, features and embodiments of the application.

[0040] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the broader ranges is also specifically included. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and are also encompassed within the application, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of the limits are also included.

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe in detail the methods and / or materials that are related to the present application. In the case of conflict between the content of the specification and that of any document incorporated herein by reference, the content of the specification controls.

[0042] Various modifications and changes can be made to the specific embodiments of the application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0043] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0044] Chemical reagents, biochemicals and materials used in the present application are commercially available unless otherwise specified.

[0045] Example 1

[0046] The lysR21 gene deletion strain M5ΔlysR21 strain is constructed in the embodiment 1 of the present application, and the specific method is as follows:

[0047] (1) Primer design:

[0048] The genome full sequence (GenBank from NCBI, sequence number: NC_017244.1, NC_017245.1) of Brucella M28 is used as a template to design the required primers, and the primer sequences are as follows:

[0049] The primer pair for amplifying the LysR21-U fragment of the lysR21 gene upstream homologous arm is as follows:

[0050] LysR21-UF (SEQ ID NO. 1):

[0051] GGTACCCGGGGATCCATTCCGGCACGATCTATACC;

[0052] LysR21-UR (SEQ ID NO. 2):

[0053] CGGCGTCTGCGGCCGGTTTTTCCCCTCTCATTGTT;

[0054] The primer pair for amplifying the LysR21-D fragment of the lysR21 gene downstream homologous arm is as follows:

[0055] LysR21-DF (SEQ ID NO. 3):

[0056] TGAGAGGGGAAAAACCGGCCGCAGACGCCGGAATT;

[0057] LysR21-DR (SEQ ID NO. 4):

[0058] TGCCTGCAGGTCGACATGCTCAACCAGGCAACCGG;

[0059] Inner identification primer:

[0060] InLysR21-F (SEQ ID NO. 5): AGCAGCCGGATCTCATTCAG;

[0061] InLysR21-R (SEQ ID NO. 6): GGGCCTTCGAGAACAGGAAA;

[0062] Outer identification primer:

[0063] OutLysR21-F (SEQ ID NO. 7): TTTTCATCGCAATCGGCCAC;

[0064] OutLysR21-R (SEQ ID NO. 8): AGACGGCTCATATGACAGCG.

[0065] (2) Amplification and fusion of the target gene:

[0066] The LysR21-U and LysR21-D fragments were amplified from the genome of the ovine Brucella M5 strain using the LysR21-UF / UR and LysR21-DF / DR primer pairs, respectively. The PCR amplification system was 50 μL, including 1 μL of DNA template (100 ng / μL), 2 μL of each of the upstream primer (10 pmol / μL) and the downstream primer (10 pmol / μL), 25 μL of 2x PrimeSTAR Max Premix (Takara), and deionized water to make up to 50 μL. The PCR reaction conditions were 98°C for 2 min, 98°C for 10 sec, 55°C for 15 sec, 72°C for 30 sec, for 35 cycles, and finally 72°C for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis, and the results are shown in Figure 1 From the results, it can be seen that the amplified LysR21-U and LysR21-D fragments were about 750 bp in size, which was consistent with the expected results. Figure 1

[0067] The LysR21-U and LysR21-D fragments were then recovered using the TIANgel Recycle Kit. The recovered LysR21-U and LysR21-D were used as templates, LysR21-UF / DR was used as primers, and Overlap-PCR was used to fuse the upstream and downstream fragments. In a 50 μL PCR amplification system, 1 μL of each of the recovered LysR21-U (10-20 ng / μL) and LysR21-D (10-20 ng / μL) was added, 2 μL of each of the upstream primer LysR21-UF (10 pmol / μL) and the downstream primer LysR21-DR (10 pmol / μL) was added, 25 μL of 2x PrimeSTAR Max Premix (Takara) was added, and deionized water was added to make up to 50 μL. The PCR reaction conditions were 98°C for 2 min, 98°C for 10 sec, 55°C for 15 sec, 72°C for 1 min, for 35 cycles, and finally 72°C for 10 min. The PCR products were subjected to 1% agarose gel electrophoresis, and the results are shown in Figure 1 From the results, it can be seen that the fused LysR21-UD fragment was about 1500 bp in size, which was consistent with the expected size.

[0068] ​(3) Construction of suicide plasmid:

[0069] The fusion gene fragment LysR21-UD and linearized plasmid pKB were ligated using a homologous recombination kit (Novagen), and the ligated fusion product was transformed into E. coli DH5α competent cells, which were screened in LB solid medium containing 50 μg / mL kanamycin and liquid medium, and the PCR broth was identified using universal primers M13F(-47) / R(-48). The PCR reaction system was 20 μL, including 1 μL of broth, 1 μL of upstream and downstream primers, 10 μL of 2×Taq Master Mix (Novagen), and 7 μL of deionized water. The PCR reaction conditions were 95°C for 2 min, 95°C for 15 sec, 60°C for 15 sec, 72°C for 1 min, 35 cycles, and finally 72°C for 10 min.

[0070] Figure 2 PCR identification results showed that the size of the target fragment was about 1500 bp, which was consistent with the expected result. After the correct broth was cultured in LB liquid medium with kanamycin resistance, the suicide plasmid was extracted using a small extraction kit (Tiangen), named pKB-ΔlysR21, and the correct plasmid was stored for use.

[0071] (4) Construction of gene deletion strain:

[0072] Brucella melitensis M5 strain was purchased from the National Veterinary Microbial Culture Collection Center. Brucella M5 was cultured in TSB to the early logarithmic growth phase (OD 600= 0.6-0.8). The bacterial solution was placed in an ice bath for 15-30 min, and then centrifuged at 8000 x g for 5 min at 4°C to collect the bacterial precipitate. The bacterial precipitate was washed twice with pre-cooled sterile deionized water, and the second time the washing was transferred to a new centrifuge tube and the supernatant was discarded. The bacterial precipitate was resuspended with pre-cooled sterile 10% glycerol water and divided into 90 μL per tube. 10 μL of the recombinant plasmid (2 μg of pKB-ΔlysR21 plasmid) was added to the prepared M5 competent cells, mixed gently, and then placed in an ice bath for 10 min. 100 μL of the mixed solution was added to a pre-cooled one-time electric shock cup, and the plasmid was electrically transformed into the competent cells under the conditions of 2.4 kV and 400 Ω. 800 μL of 37°C preheated TSB was slowly added to the electric shock cup, and mixed by blowing. 900 μL of the mixed solution was added to a sterile 2 mL EP tube and labeled, and then incubated at 37°C and 220 rpm for 6-8 h. The bacterial solution was centrifuged at 8000 rpm for 5 min, and 800 μL of the supernatant was discarded. After resuspension, the entire solution was spread on TSA solid medium containing kanamycin, and then incubated at 37°C and 5% CO2 for 3-5 days. Single colonies were picked and incubated in TSB liquid medium at 37°C for 2-3 days. After gradient dilution, 100 μL of the bacterial solution was spread on TSA solid medium containing 5% sucrose for a second round of screening. InLysR21-F / R and OutLysR21-F / R were used as the internal and external identification primers, respectively, for PCR bacterial identification. The PCR reaction system and reaction conditions were the same as described in step (3). Figure 3

[0073] As can be seen from Figure 3 , the PCR identification of the bacterial solution using the internal identification primer InLysR21-F / R showed a band of 435 bp for the parent strain M5, and no band for the deletion strain. The PCR identification of the bacterial solution using the external primer OutLysR21-F / R showed a band of 1273 bp for the parent strain M5, and a band of 367 bp for the deletion strain M5ΔlysR21 due to the deletion of 906 bp.

[0074] Figure 4 The PCR identification results showed that the band size of the parent strain M5 was about 435 bp using the internal primer, and the deletion strain M5ΔlysR21 had no obvious band amplification. The band size of the parent strain M5 was about 1273 bp using the external primer, and the band size of the deletion strain M5ΔlysR21 was about 435 bp. The identification results were consistent with the expected results.

[0075] (5) Western Blot identification of the deletion strain:

[0076] ​The TSB was used to culture Brucella melitensis M5 and M5ΔlysR21 for 21-48 h. 1.4 mL of each was taken in a 1.5 mL EP tube, centrifuged at 10,000 rpm for 5 min, and the supernatant was discarded. The bacterial pellet was resuspended in 1 mL of PBS, centrifuged at 10,000 rpm for 5 min, and the supernatant was discarded. The bacterial pellet was resuspended in 80 μL of sterile deionized water, transferred to a new 1.5 mL EP tube, 20 μL of 5× SDS protein loading buffer was added, and the mixture was incubated at 100°C for 10 min. The mixture was centrifuged at 8,000 rpm for 5 min, and the supernatant was taken for use.

[0077] 10 μL of the protein sample was added to the SDS-PAGE well, and the concentrated gel was run at 80 V for 30 min. The separation gel was run at 120 V for 60 min. The transfer membrane solution was pre-cooled at 4°C. The NC membrane was soaked in the transfer membrane solution. The transfer membrane clamp was placed with the black side facing down, and the gauze, filter paper, gel, NC membrane, filter paper, and gauze were placed in sequence. The NC membrane was tightly attached to the gel to remove air bubbles. The black interface of the transfer membrane clamp was adjusted to the negative pole of the transfer membrane slot, and the white side was adjusted to the positive pole. After the transfer membrane slot was filled with the transfer membrane solution, a constant current of 200 mA was used for transfer for 90 min, and the outer periphery of the transfer membrane slot was filled with ice.

[0078] After the transfer was completed, the membrane was taken out, and it was observed that the protein Marker was completely transferred from the gel to the membrane. The residual transfer membrane solution on the membrane was quickly washed away with PBST. The NC membrane was soaked in 5% skimmed milk, slowly shaken, and incubated at room temperature for 1 h. After blocking, the excess milk was washed away with 1×PBST buffer, and the membrane was washed for 5 min each time for a total of 3 times. The primary antibody was Anti-LysR21, and then the membrane was soaked in the primary antibody and incubated overnight at 4°C on a shaker. After incubation of the primary antibody, 1×PBST buffer was added and placed on a shaker for 5 min for a total of 3 times. The secondary antibody was incubated at room temperature for 1 h. After incubation of the secondary antibody, 1×PBST was washed for 5 min for a total of 3 times. After washing the membrane, the luminescent solution was applied to the membrane, and the image was exposed by a chemiluminescence imager, and the picture was saved.

[0079] The antibody was stripped with antibody stripping solution, and 1×PBST was washed for 5 min for a total of 3 times. 5% skimmed milk was blocked at room temperature for 1 h, and 1×PBST was washed for 5 min for a total of 3 times. The primary antibody was Anti-GroEL, and then the membrane was soaked in the primary antibody and incubated overnight at 4°C on a shaker. After incubation of the primary antibody, 1×PBST buffer was added and placed on a shaker for 5 min for a total of 3 times. The secondary antibody was incubated at room temperature for 1 h. After incubation of the secondary antibody, 1×PBST was washed for 5 min for a total of 3 times. The luminescent solution was applied to the membrane, and the image was exposed by a chemiluminescence imager, and the picture was saved.

[0080] Figure 5Western Blot identification results show that the parent strain M5 has the expression of the target protein LysR21 at about 35 kDa, and the deletion strain M5ΔlysR21 has no expression of the target protein. The above results all show that the M5ΔlysR21 strain is successfully constructed.

[0081] The finally prepared lysR21 gene deletion strain M5ΔlysR21 is preserved in the China General Microbiological Culture Collection Center, located at No. 1, Beichen West Road, Yard 3, Chaoyang District, Beijing, on November 21, 2024, and the preservation number is CGMCC NO. 32791.

[0082] Test Example 1

[0083] In this test example 1, the basic phenotypes of the Brucella M5ΔlysR21 strain and the Brucella M5 parent strain prepared in the example 1 of the present application are verified, and the specific method is as follows:

[0084] (1) Growth curve determination:

[0085] The Brucella M5 parent strain and the lysR21 gene deletion strain M5ΔlysR21 are cultured in vitro to the logarithmic growth phase, and the OD 600 value is adjusted to 1.0. The bacterial solution is inoculated in the TSB liquid medium at a ratio of 1:10, and cultured at 37°C, 220 rpm. Every 6h, 100μL of bacterial solution is taken to measure the OD 600 value, and the bacterial growth curve is drawn according to the value. The results are shown in Figure 6 .

[0086] As shown in Figure 6 , in the TSB medium, the growth rate of M5ΔlysR21 and the parent strain is consistent, indicating that the deletion of lysR21 gene does not affect the growth ability of Brucella in TSB.

[0087] (2) Tolerance experiment

[0088] The Brucella M5 parent strain and the M5ΔlysR21 deletion strain cultured overnight are adjusted to OD 600 = 1.0, and the bacterial solution is diluted with PBS 10 times gradient to 5×10 5 CFU / mL. The obtained bacterial solution is used for the following experiment:

[0089] A. Hydrogen peroxide tolerance test: H2O2 was diluted with sterile PBS to a working concentration of 2 mM, 4 mM and 8 mM solution, 50 μL H2O2 solution was mixed with 50 μL diluted bacteria solution in a 1.5 mL EP tube (at this time, the final concentration of H2O2 solution was 1 mM, 2 mM and 4 mM, respectively), and incubated at 37°C, 220 rpm for 1 h, while setting up PBS control group. After incubation, 900 μL sterile PBS was added to terminate the reaction, and then diluted 10 times, 100 μL suspension was spread on TSA solid medium. After 3-5 days of incubation at 37°C, the bacterial CFU was counted, and the bacterial survival rate was calculated. Each strain was set up three repeats for each group of test, and the results are shown in Table A. Figure 7

[0090] B. Prepare TSA medium containing sodium nitroprusside (SNP) with a final concentration of 0.5 mM SNP. The above transferred bacterial solution was adjusted to OD 600 = 1.0, and the bacterial solution was diluted 10 times by gradient dilution with sterile PBS. The bacterial solution was diluted to 5 x 10 9 CFU / mL, 5 x 10 8 CFU / mL, 5 x 10 7 CFU / mL, 5 x 10 6 CFU / mL, 5 x 10 5 CFU / mL, and 5 x 10 4 CFU / mL, 2 μL of the diluted culture medium was spotted into 0.5 mM SNP TSA medium, and incubated in a 37°C incubator for 5-6 days. TSA without SNP was used as a control group. The colony morphology, size and number were observed, and the results are shown in Table B. Figure 7

[0091] As shown in Tables A and B, the tolerance of M5ΔlysR21 strain to H2O2 solution with a final concentration of 1 mM was not significantly different from that of the parent strain M5, the tolerance of M5ΔlysR21 strain to H2O2 solution with a final concentration of 2 mM and 4 mM was significantly lower than that of the parent strain M5, indicating that the deletion of lysR21 weakened the ability of Brucella to resist oxidative stress; in addition, the tolerance of M5ΔlysR21 strain to 0.5 mM SNP TSA medium was significantly lower than that of the parent strain M5, while there was no difference in growth between the deletion strain and the parent strain in TSA plate without SNP, indicating that the deletion of lysR21 gene weakened the ability of Brucella to resist nitrogen stress. Figure 7 Test Example 2

[0092]

[0093] ​​​This Experimental Example 2 evaluated the virulence and immune protection of the Brucella M5ΔlysR21 strain prepared in Example 1 of the present invention. The specific steps are as follows:

[0094] (1) Brucella M5ΔlysR21 strain adhesion, invasion, and intracellular survival assay

[0095] A. Brucella M5ΔlysR21 strain adhesion and invasion cell assay:

[0096] The overnight cultured Brucella M5 parent strain and M5ΔlysR21 deletion strain were adjusted to OD 600 =1.0.

[0097] One day in advance, mouse macrophage RAW264.7 cells were cultured at a density of 2.5-3 × 10 5 Cells were seeded into 24-well cell culture plates at a concentration of 1 mL per well at 400 cells / well and cultured for 20-24 hours until cells reached monolayer growth. Macrophages were synchronously infected at a multiplicity of infection (MOI) of 100:1 (bacteria:cells) by centrifugation at 400 × g for 5 minutes. After incubation at 37°C, 5% CO₂ for 1 hour, infection time was counted as time 0. After infection, cells were washed three times with PBS. 200 μL of 0.25% Triton-X 100 in PBS was added to each well to lyse the cells. 100 μL of the cell lysate was serially diluted 10-fold and plated. The plates were then incubated at 37°C, 5% CO₂ for 3-4 days. CFU (Cell Fungal Infection Units) were counted and the initial CFU per well was calculated, representing the number of adherent bacteria. Following infection, cells were washed three times with PBS and treated with gentamicin (100 μg / mL) for 1 hour to kill extracellular bacteria. Wash three times with PBS, add 200 μL of 0.25% Triton-X 100 PBS solution to each well to lyse the cells, take 100 μL of cell lysate and dilute it 10-fold, take 100 μL and hang the plate, incubate at 37℃, 5% CO2 environment for 3-4 days, count the bacterial CFU, and calculate the original CFU of each well, which is the amount of invading bacteria. The results are as follows: Figure 8 shown.

[0098] Depend on Figure 8 It can be seen that in the RAW264.7 cell infection group, the ability of the M5ΔlysR21 strain to adhere to RAW264.7 cells and invade RAW264.7 cells was similar to that of the parental strain M5, indicating that the deletion of the lysR21 gene did not affect the ability of Brucella to adhere to and invade RAW264.7 cells.

[0099] B. Intracellular survival assay:

[0100] According to the infection step in the Brucella M5AlysR21 strain adhesion and invasion cell test, the cells were infected, and after the cell infection was completed, the extracellular bacteria were killed by culturing in DMEM containing 100 μg / mL gentamicin for 1 h, the cells were washed with PBS for 3 times, and after the extracellular bacteria were washed away, the culture medium was replaced with a DMEM solution containing 50 μg / mL gentamicin and 2% FBS to maintain the cells, and the cell plates were taken out at 1 h, 24 h, 48 h and 72 h after infection, respectively, the cells were washed with PBS for 3 times, 200 μL of 0.25% Triton-X 100 PBS solution was added to each well to lyse the cells for 15 min, 100 μL of the cell lysate was diluted by 10 times in gradient, and then the plate was hung, which was cultured at 37°C and 5% CO2 for 3-4 days, the CFU was counted, and the original CFU of each well was calculated to draw the intracellular survival curve of Brucella, and the results are shown in Figure 9 .

[0101] As can be seen from Figure 9 , compared with the parent strain M5, the M5AlysR21 deletion strain showed the same intracellular bacterial load in the early infection of RAW264.7 cells, and the intracellular survival ability of the M5AlysR21 deletion strain was significantly weakened with the extension of the infection time, which indicated that the deletion of the lysR21 gene weakened the intracellular survival ability of Brucella.

[0102] (2) Mouse pathogenicity test:

[0103] The overnight cultured Brucella M5 parent strain and M5AlysR21 deletion strain were adjusted to OD 600 = 1.0 (at this time, the bacterial concentration was about 5 × 10 9 CFU / mL), and the bacterial solution was diluted to 1 × 10 7 CFU / mL with PBS.

[0104] Thirty 6-8 week old female BALB / c mice were divided into M5, M5AlysR21 and PBS inoculation groups, 15 in each group, and each mouse was inoculated with 0.1 mL of bacterial suspension (containing 1 × 10 6 CFU of bacteria) intraperitoneally, and the non-infected group was inoculated with PBS as a negative control. At 2 and 4 weeks after infection, 5 mice in each group were quickly decapitated, the spleen was taken out, the degree of spleen swelling was observed, and the weight of the spleen was weighed; 3 mL of 0.25% Triton-X 100 PBS solution was added to the spleen for grinding, and after 10 times gradient dilution, 100 μL was hung, the bacterial CFU was counted, and the original bacterial load in each spleen was calculated to draw a column chart to evaluate the residual virulence of the bacteria, and the results are shown in Figure 10 .

[0105] As can be seen from Figure 10It can be seen that 2 weeks after the mice were inoculated with bacteria, the bacterial load in the spleen and the weight of the spleen of the M5ΔlysR21 infected mice were significantly lower than those of the M5 parent strain; 4 weeks after the mice were inoculated with bacteria, the bacterial load in the spleen of the M5ΔlysR21 infected mice was significantly lower than that of the M5 parent strain, and the weight of the spleen of the M5ΔlysR21 infected mice had no significant difference compared with the M5 parent strain.

[0106] To further evaluate the pathogenicity of M5 and M5ΔlysR21, the livers of the mice were removed and immersed in 4% paraformaldehyde for 24-48 h for fixation, and then sent to Wuhan Seville Company for tissue section preparation and HE staining to observe the pathological changes of the liver, and the results are shown in Figure 11

[0107] As can be seen from Figure 11 Compared with the M5 inoculation group, the mice inoculated with the M5ΔlysR21 deletion strain significantly weakened the formation of liver granuloma induced by Brucella infection; the above experimental results show that the deletion of the lysR21 gene significantly weakened the pathogenicity of the Brucella M5 strain to mice.

[0108] (3) Antibody level determination:

[0109] To evaluate the antibody level of M5 and M5ΔlysR21 in infected mice, the serum of the mice infected for 2 weeks and 4 weeks was taken and subjected to ELISA determination. The whole bacterial protein of M5 was coated on a 96-well plate at 25 μg / well at 4°C overnight. 1×PBST was washed three times for 5 min each time, 5% skim milk was blocked at room temperature for 2 h, 1×PBST was washed three times for 5 min each time, the primary antibody (mouse serum diluted 200 times) was incubated at 100 μL / well at 37°C for 1 h, 1×PBST was washed three times for 5 min each time, the secondary antibody (IgM, IgG, IgG1, IgG2a diluted 1:20,000 times) was incubated at 100 μL / well at 37°C for 1 h, 1×PBST was washed three times for 5 min each time, 100 μL / well of TMB substrate developing solution was added, and incubated in the dark for 20 min, 100 μL / well of stop solution was added, and the antibody titer was determined at OD 450 The results are shown in Figure 12

[0110] As can be seen from Figure 12 ​​It can be seen that at 2 and 4 weeks of immunization, the M5 and M5ΔlysR21 immunization groups induced higher levels of IgM, IgG, IgG1, and IgG2a antibodies in mice compared with the PBS group. Compared with mice immunized for 2 weeks, the level of IgM antibodies showed a downward trend after 4 weeks of immunization, which is consistent with the results that IgM is involved in the early immune response to Brucella. The levels of IgG and IgG2a antibodies remained basically unchanged at 2 and 4 weeks of immunization, while the level of IgG1 antibodies showed an upward trend. However, whether mice were immunized for 2 weeks or 4 weeks, the level of IgG2a in their serum was significantly higher than that of IgG1. It can be seen that the level of IgG2a antibodies dominated their immune response, indicating a preference for Th1-type immune response.

[0111] (4) Immunoprotective test:

[0112] The overnight culture of Brucella M5ΔlysR21 deletion strain and M5-90Δ26 vaccine strain was adjusted to OD 600 =1.0 (At this time, the bacterial concentration is about 5×10 9 CFU / mL). Dilute the bacterial solution with PBS to about 1×10 6 CFU / mL. Thirty female BALB / c mice aged 6-8 weeks were divided into PBS group, M5ΔlysR21 group and M5-90Δ26 group, with 5 mice in each group. Each mouse was treated with 1×10 5 The mice in the PBS group were injected intraperitoneally with 0.1 mL PBS. 30 or 45 days after vaccination, 1×10 5 All mice were challenged with M5 at a dose of 100 CFU / mouse. Two weeks after challenge, all mice were quickly killed by cervical dislocation. The spleens of the mice were removed, the degree of spleen swelling was observed, and the spleen weight was weighed. 3 mL of 0.25% Triton-X100 PBS solution was added to the spleens for grinding. After 10-fold gradient dilution, 100 μL was taken for hanging plates and bacterial CFU counted to estimate the original bacterial load in the spleen. The results are as follows: Figure 13 shown.

[0113] Depend on Figure 13 Two weeks after M5 challenge, the Brucella load in the spleens of mice immunized with M5ΔlysR21 and M5-90Δ26 was significantly lower than that of the PBS-vaccinated group. The Brucella load in the spleens of mice immunized with M5ΔlysR21 was significantly lower than that of the M5-90Δ26-vaccinated group. Spleen weights showed a significant decrease in spleen weights in mice immunized with M5ΔlysR21 and M5-90Δ26 compared to the PBS-vaccinated group. However, there was no significant difference in spleen weights between the M5ΔlysR21 and M5-90Δ26-vaccinated groups.

[0114] To further evaluate the immunoprotection of M5AlysR21 and M5-90A26 vaccine strains, the livers of the mice immunized for 30 days and 45 days and then challenged with M5 for 2 weeks were taken out and fixed in 4% paraformaldehyde for 24-48 h, and then sent to Wuhan Service Company for tissue section preparation and HE staining to observe the pathological changes of the livers, and the results are shown in Figure 14 .

[0115] As can be seen from Figure 14 , in the vaccine immunization group for 30 days, compared with the PBS inoculation group, the mice inoculated with M5AlysR21 and M5-90A26 vaccine strains significantly weakened the formation of liver granuloma induced by Brucella infection; M5AlysR21 almost no granuloma was observed, and individual position M5-90A26 formed scattered small granuloma. In the vaccine immunization group for 45 days, no obvious granuloma was formed in the livers of the mice inoculated with M5AlysR21 and M5-90A26 vaccine strains.

[0116] In summary, the M5AlysR21 strain is constructed by deleting the lysR21 gene, compared with the original Brucella M5 strain, the virulence of the M5AlysR21 strain is weakened, the survival ability in cells and in mice is significantly reduced, and the M5AlysR21 strain has stronger immunoprotection compared with the M5-90A26 vaccine, and can be used as a candidate attenuated live vaccine strain for preventing animal brucellosis.

[0117] The above-described examples only express several embodiments of the present application, which are described in more detail and in detail, but should not be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A live attenuated Brucella vaccine strain M5Δ lysR21 , characterized in that, The Brucella live attenuated vaccine strain M5Δ lysR21 Deletion of Brucella melitensis M5 strain lysR21 The Brucella live attenuated vaccine strain M5Δ lysR21 It is deposited in the General Microbiology Center of China Culture Collection Administration, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is November 21, 2024, and the deposit number is CGMCC NO. 32791.

2. A method for attenuating Brucella, characterized in that: The method comprises the steps of: lysR21 The step of gene deletion, wherein the Brucella is Brucella melitensis M5 strain; The specific steps include: (1) PCR amplification lysR21 After amplification of the upstream and downstream homology arm fragments of the gene, the two fragments were fused by fusion PCR to obtain a fusion fragment; (2) By homologous recombination, the fusion fragment was connected with the linearized suicide plasmid pKB to obtain a recombinant plasmid. After screening and extraction, the suicide plasmid pKB-Δ was obtained. lysR21 ; (3) The suicide plasmid pKB-Δ lysR21 Electrotransformed into Brucella melitensis M5 competent cells, M5Δ was obtained after double screening. lysR21 Deletion strains; In step (1), the PCR amplification lysR21 The primer sequences used for amplifying the upstream and downstream homology arm fragments of the gene are shown in SEQ ID NOs. 1-4, wherein the primer sequences LysR21-UF shown in SEQ ID NO. 1 and LysR21-UR shown in SEQ ID NO. 2 are used to amplify the upstream homology arm fragment, and the primer sequences LysR21-DF shown in SEQ ID NO. 3 and LysR21-DR shown in SEQ ID NO. 4 are used to amplify the downstream homology arm fragment. The primer set used in the fusion PCR is LysR21-UF shown in SEQ ID NO. 1 and LysR21-DR shown in SEQ ID NO.

4.

3. The Brucella attenuation method according to claim 2, wherein In step (2), the screening method is to transfer the recombinant plasmid into Escherichia coli DH5a competent cells, screen the kanamycin-resistant strains in LB solid medium and liquid medium containing kanamycin, and then perform PCR bacterial liquid identification and extract pKB-Δ lysR21 Suicide plasmid.

4. The Brucella attenuation method according to claim 2, wherein In step (3), the double screening method is: the suicide plasmid pKB-Δ extracted in step (2) is lysR21 Electrotransformed into Brucella competent cells, the product was spread on TSA solid medium containing kanamycin, and monoclonal bacteria were picked and cultured in TSB liquid medium. Then, negative screening was performed on TSA solid medium containing 5% sucrose. Monoclonal colonies were picked and cultured in TSB liquid medium. M5Δ was identified by PCR using inner and outer identification primers. lysR21 Deletion strain.

5. The Brucella attenuation method according to claim 4, wherein The inner identification primers are InLysR21-F with sequences as shown in SEQ ID NO. 5 and InLysR21-R with sequences as shown in SEQ ID NO. 6; the outer identification primers are OutLysR21-F with sequences as shown in SEQ ID NO. 7 and OutLysR21-R with sequences as shown in SEQ ID NO.

8.

6. Use of the attenuated Brucella obtained by the Brucella attenuation method according to any one of claims 2 to 5 in preparing a preparation for preventing brucellosis.

7. The use according to claim 6, characterized in that The preparation is a live attenuated Brucella vaccine.

Images