A molecular marker associated with susceptibility to ovine brucellosis and use thereof

Abstract

The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker related to sheep brucellosis susceptibility and application thereof.The molecular marker comprises nucleic acid of a nucleotide sequence as shown in SEQ ID NO.1, and polymorphism exists at the 101st position, and the polymorphism is G / A.A molecular marker related to sheep brucellosis susceptibility is screened by the present application, and the susceptibility of sheep brucellosis can be identified by detecting the polymorphism of the molecular marker.The molecular marker provided by the present application can also be used for breeding sheep varieties with low brucellosis susceptibility, which has important significance in the field of sheep breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of animal breeding technology, and particularly relates to a molecular marker related to sheep brucellosis susceptibility and application thereof. BACKGROUND

[0002] Brucellosis is a zoonosis caused by Brucella infection. The clinical symptoms of brucellosis include undulant fever, fatigue and reproductive disorders (testitis and epididymitis in male animals, and abortion and endometritis in female animals). Brucella is a facultative intracellular parasite with immune evasion ability, and the clinical manifestations of brucellosis are latent infection and chronic course. It is difficult to find in the early stage and difficult to control in the late stage. Sheep Brucella is the most virulent and infectious, and sheep and goats are susceptible to Brucella, which is one of the most dangerous sources of human brucellosis. This has caused great harm to the current sheep livestock breeding industry.

[0003] Single nucleotide polymorphism (SNP) is the most common type of genetic variation at the genome level, which is caused by a single base change. Specifically, it includes Transition and Transversion: Transition refers to the replacement between purines (G / A) or pyrimidines (T / C), and Transversion refers to the replacement between purines and pyrimidines. In livestock breeding, SNP is widely used in genetic marker and genome analysis. Through SNP markers, the genotype of animal individuals can be accurately identified and distinguished, thereby helping researchers to understand important genetic characteristics such as animal disease resistance and production performance.

[0004] In host animals such as sheep, the molecular marker related to brucellosis susceptibility is mined and applied to assist in the breeding of disease-resistant sheep. This not only fundamentally cuts off the transmission route of brucellosis, truly implements "human disease prevention of animals" and "forward shift of the pass", but also reduces the harm of environmental pollution and drug residues caused by the abuse of antibiotics. Therefore, it is of great practical significance to mine the molecular marker related to the susceptibility of sheep brucellosis. SUMMARY

[0005] In order to solve the problems existing in the prior art, the present application provides a molecular marker related to sheep brucellosis susceptibility and application thereof.

[0006] The present application discovers the SNP molecular marker related to sheep brucellosis susceptibility in the sheep genome by performing whole genome association analysis on the brucellosis susceptibility of different breeds of sheep. Through population verification, it is proved that the SNP molecular marker is significantly related to the susceptibility of sheep brucellosis, and can be used for detecting the susceptibility of sheep to brucellosis.

[0007] In a first aspect, the present application provides a molecular marker, which comprises a nucleic acid of a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism of G / A exists at position 101.

[0008] a nucleotide sequence as shown in SEQ ID NO. 1:

[0009] CCAGGACTGACATGCACCCACTGTTCCCCAAAAGCTTACTGTCTAGAAGGGAAGAGAGACACGATAGCTTTGACTGTAATTAACATATGGATGGGAAGCARGGAAATACATGCACGGGGCTCATGAGATCAGTGGGCAGGAGTCCATGATTAGGGGTTGGTGGGGGGTGGGGGTTGAGGAGTGGAGATAAAGGAGACAGAG.

[0010] wherein R represents G or A (in accordance with the international standard IUPAC-IUBMB).

[0011] Specifically, the polymorphism site of the aforementioned molecular marker is located at position 210186957 of chromosome 3 of the reference genome version number Oar_v4.0, and the polymorphism is G / A.

[0012] In a second aspect, the present application provides a primer pair for amplifying the aforementioned molecular marker. The design method of the primer pair of the present application can be the conventional method of the present application, and the skilled person can design primer pairs (including primer pairs or KASP primer combinations) of different lengths for amplifying the aforementioned molecular marker according to the existing primer design rules and primer design software (such as primer).

[0013] Further, the present application provides a probe for amplifying the aforementioned molecular marker. The existing technology has mature technical guidance and means for designing probes for molecular markers, and the probes designed according to the existing technical guidance are within the protection scope of the present application.

[0014] Still further, the present application provides a gene chip comprising the probe. The existing technology also has mature gene chip design means, which can separately comprise the aforementioned probe, or combine the aforementioned probe with other probes to prepare a gene chip for genotyping or molecular marker assisted breeding.

[0015] In a third aspect, the present application provides a primer pair, which comprises nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0016] SEQ ID NO. 2: 5'-AGAGTGGGGTGAGAGTATCAG-3'.

[0017] SEQ ID NO. 3: 5'-AGCCCTGAGACCAAACTCCTAC-3'.

[0018] The primer combination described above can realize efficient amplification and genotyping for the above-mentioned molecular marker.

[0019] In a fourth aspect, the present application provides a kit comprising the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned gene chip.

[0020] In a fifth aspect, the present application provides the SNP site as a target for use in any one of the following:

[0021] (1) predicting or detecting the Brucella disease susceptibility of sheep, or preparing a reagent for predicting or detecting the Brucella disease susceptibility of sheep;

[0022] (2) identifying or cultivating a sheep breed with low Brucella disease susceptibility, or preparing a reagent for identifying or cultivating a sheep breed with low Brucella disease susceptibility;

[0023] (3) molecular marker assisted breeding of sheep Brucella disease susceptibility;

[0024] (4) improvement of sheep breeds related to Brucella disease susceptibility;

[0025] (5) improvement of sheep germplasm resources;

[0026] The SNP site is located at position 210186957 of chromosome 3 of the reference genome version number Oar_v4.0, and the polymorphism is G / A.

[0027] The target described in the present application includes existing conventional nucleotide detection methods and reagents, such as gene sequencing, primer amplification design, probe targeting detection, etc.

[0028] In a sixth aspect, the present application provides the use of the aforementioned detection reagent of the molecular marker, or the aforementioned primer pair, or the aforementioned gene chip, or the aforementioned kit in any one of the following:

[0029] (1) predicting or detecting the Brucella disease susceptibility of sheep, or preparing a reagent for predicting or detecting the Brucella disease susceptibility of sheep;

[0030] (2) identifying or cultivating a sheep breed with low Brucella disease susceptibility, or preparing a reagent for identifying or cultivating a sheep breed with low Brucella disease susceptibility;

[0031] (3) Molecular marker-assisted breeding of sheep susceptibility to brucellosis;

[0032] (4) Sheep breed improvement related to susceptibility to brucellosis;

[0033] (5) Improvement of sheep germplasm resources.

[0034] The sheep breed improvement related to susceptibility to brucellosis described in this invention includes: using the aforementioned molecular markers to select sheep for breeding, for example, in the breeding process, selecting offspring with the genotype GG.

[0035] In a seventh aspect, the present invention provides a method for identifying susceptibility to brucellosis in sheep, comprising:

[0036] The polymorphism of molecular markers was tested on the sheep samples to be tested, as described above, and the susceptibility of the sheep to brucellosis was determined based on the genotype test results.

[0037] Furthermore, the method includes:

[0038] Genomic DNA was extracted from the sheep samples to be tested, and PCR amplification was performed using the aforementioned primer pairs, or the genotype of the sheep to be tested was obtained using the aforementioned gene chip. The susceptibility of the sheep to brucellosis was determined based on the genotype detection results.

[0039] Furthermore, the reaction conditions for the PCR amplification include:

[0040] Pre-denaturation at 93~97℃ for 2~4 minutes; denaturation at 93~97℃ for 15~60 seconds, annealing at 54~60℃ for 20~60 seconds, extension at 70~74℃ for 45~120 seconds, for a total of 40~55 cycles; extension for 2~5 minutes after the last cycle.

[0041] Furthermore, the determination of the susceptibility of the sheep to be tested to brucellosis based on the genotype detection results includes: genotype GG corresponds to low susceptibility to brucellosis, and genotypes AG and AA correspond to high susceptibility to brucellosis.

[0042] Taking the aforementioned primer pair as an example, position 165 of the amplification result corresponds to the polymorphic site, thereby enabling the identification of brucellosis susceptibility in the sheep being tested. In fact, in addition to this, the detection of this molecular marker polymorphism can also be achieved directly through any of the following methods: gene sequencing, molecular probes, liquid phase capture, or mass spectrometry (all of which are conventional methods in this field).

[0043] The brucellosis described in this invention is brucellosis caused by Brucella infection of sheep.

[0044] The present invention has the following beneficial effects:

[0045] The application discloses a molecular marker related to sheep brucellosis susceptibility, which can more accurately detect the susceptibility of sheep to brucellosis, realizes early prediction of the susceptibility of sheep to brucellosis, and is not limited by the age and gender of sheep. The molecular marker provided by the application can be used for detection of the susceptibility of sheep to brucellosis and molecular marker assisted breeding, has important significance for prevention and screening of brucellosis susceptible sheep, effectively improves breeding efficiency, and has important significance for development and utilization of excellent economic characteristics of sheep excellent breeds and protection and rational utilization of breed resources. BRIEF DESCRIPTION OF DRAWINGS

[0046] In order to more clearly illustrate the technical solutions in the application or prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0047] Figure 1 is the expansion verification result of the SNP molecular marker disclosed in embodiment 2 of the application in a sheep population, wherein, represents p<0.01, represents p<0.001. DETAILED DESCRIPTION

[0048] In order to make the objects, technical solutions and advantages of the application more clear, the technical solutions in the application will be clearly and completely described in the following with reference to the drawings in the application. Obviously, the described embodiments are some embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.

[0049] The experimental methods involved in the following embodiments are all conventional methods in the art if not specially mentioned, for example, can refer to the experimental manual in the art or the conditions suggested in the manufacturer's instruction.

[0050] The experimental materials and reagents involved in the following embodiments can be obtained from commercial channels if not specially mentioned.

[0051] Example 1: Screening of SNP molecular marker related to susceptibility of sheep to brucellosis

[0052] In the embodiment, a screening method takes sheep population as a sample, which is an infected host of brucellosis, uses whole genome association analysis (GWAS) to develop a SNP molecular marker related to susceptibility of sheep to brucellosis, and the specific steps are as follows:

[0053] (1) Blood collection and serological detection.

[0054] Blood samples were collected from 50 sheep raised under the same conditions, and the concentrations of Brucella antibodies in the sheep serum were detected by competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA), respectively. The detection results were used as the susceptibility index of sheep brucellosis and as the phenotype data for GWAS analysis.

[0055] (2) Total DNA extraction, genome resequencing and quality control.

[0056] The blood DNA samples of the above-mentioned 50 sheep were subjected to whole genome resequencing with a sequencing depth of 20x. Sequence alignment and quality control were performed on the sequencing data, and the number of effective SNPs after quality control was 22833320.

[0057] (3) Screening of SNP sites related to the susceptibility of sheep brucellosis by using whole genome association analysis technology.

[0058] The cELISA value was selected as the phenotype, and the GEMMA (Version 0.95) software was used to perform whole genome association analysis based on the MLM (y=γCov+Xβ+Zα+Wμ+e) model. The iELISA value was selected as the phenotype, and the GEMMA (Version 0.95) software was used to perform whole genome association analysis based on the MLM (y=γCov+Xβ+Zα+Wμ+e) model. The FPA value was selected as the phenotype, and the GEMMA (Version 0.95) software was used to perform whole genome association analysis based on the MLM (y=γCov+Xβ+Zα+Wμ+e) model.

[0059] (4) Screening of SNP sites significantly associated with the susceptibility of sheep brucellosis.

[0060] The top 500 SNPs in the three GWAS results were compared, and finally, the present application obtained an SNP molecular marker significantly associated with the susceptibility of sheep brucellosis, which was located at the physical position of 210186957 of chromosome 3 based on the sheep reference genome Oar_v4.0.

[0061] The above-mentioned SNP molecular marker corresponds to the nucleotide sequence shown in SEQ ID NO. 1, wherein the polymorphic site is located at 101bp, and the polymorphism is G or A.

[0062] Example 2 Application of the SNP molecular marker related to the susceptibility of sheep brucellosis

[0063] In the present embodiment, a method is used to validate the SNP molecular marker developed in Embodiment 1 in relation to the susceptibility of sheep to brucellosis, and the method is as follows:

[0064] (1) Design of primers.

[0065] According to the information of the sheep genomic DNA sequence, a pair of primers is designed as follows for amplifying the nucleotide fragment in which the SNP to be tested is located:

[0066] Forward primer F: 5'-AGAGTGGGGTGAGAGTATCAG-3'.

[0067] Reverse primer R: 5'-AGCCCTGAGACCAAACTCCTAC-3'.

[0068] (2) Collection of blood samples of sheep to be tested and identification of serum antibody concentration.

[0069] 135 sheep, including Texel sheep, East Friesian sheep, Suffolk sheep and white Suffolk sheep, from a breeding farm naturally infected with Brucella were collected for jugular blood. The serum Brucella antibody concentration was detected by competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA), respectively.

[0070] (3) Extraction of genomic DNA from the blood samples of sheep to be tested.

[0071] Solution method was used to extract the genomic DNA from the blood samples of sheep to be tested.

[0072] (4) Extraction of SNP marker of the tested genome by genotyping technology.

[0073] Based on the primer design in the present embodiment (1), the SNP molecular marker developed in Embodiment 1 in relation to the susceptibility of sheep to brucellosis was detected by genotyping.

[0074] (5) Comparison of whether there is a significant difference in susceptibility between different genotypes.

[0075] The genotypes of the polymorphic sites of the SNP molecular marker of the above-mentioned 135 sheep were detected, and the significance test of mean difference of the brucellosis susceptibility traits (cELISA value, iELISA value and FPA value) of different genotypes of the sites was performed by one-way ANOVA of SPSS.

[0076] The results are as follows: Figure 1As shown, three genotypes of "GG", "GA" and "AA" are distinguished in the detected sheep population, and the iELISA average of the "GG" genotype sheep individual is significantly lower than that of the "GA" and "AA" genotypes, indicating that the "GG" genotype sheep individual is lower in brucellosis susceptibility than the "GA" and "AA" genotypes, and the SNP molecular marker provided by the application has higher accuracy in identifying the brucellosis susceptibility trait.

[0077] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. Application of SNP site as a target in any one of the following: (1) preparation of reagent for predicting or detecting Brucellosis susceptibility of sheep; (2) breeding of sheep breed with low Brucellosis susceptibility, or preparation of reagent for identifying or breeding sheep breed with low Brucellosis susceptibility; (3) molecular marker assisted breeding of Brucellosis susceptibility of sheep; (4) improvement of sheep breed related to Brucellosis susceptibility; (5) improvement of germplasm resource of sheep; the SNP site is located at 210186957 of chromosome 3 of reference genome version number Oar_v4.0, and the polymorphism is G / A.

2. Application of molecular marker, or primer pair, or kit in any one of the following: (1) preparation of reagent for predicting or detecting Brucellosis susceptibility of sheep; (2) breeding of sheep breed with low Brucellosis susceptibility, or preparation of reagent for identifying or breeding sheep breed with low Brucellosis susceptibility; (3) molecular marker assisted breeding of Brucellosis susceptibility of sheep; (4) improvement of sheep breed related to Brucellosis susceptibility; (5) improvement of germplasm resource of sheep; the molecular marker is nucleic acid of nucleotide sequence as shown in SEQ ID NO. 1, and the polymorphism is G / A at 101; the nucleotide sequences of the primer pair are as shown in SEQ ID NO. 2 and SEQ ID NO. 3; the primer pair is used for amplifying the molecular marker; the kit comprises the primer pair.

Images