A genetically engineered bacterium with high-yield heparosan and its application

By genetically engineering the BDH of Corynebacterium glutamate, the synthetic path of heparosan is optimized, and the problems of high production cost and safety of heparosan in the existing technology are solved, and high-yield, safe and low-cost production of heparosan is achieved.

CN119752761BActive Publication Date: 2025-06-17BEIJING UNIV OF CHEM TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510264920.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-07
Publication Date
2025-06-17
Estimated Expiration
2045-03-07

AI Technical Summary

Technical Problem

In the prior art, E.coli K5 is a pathogenic bacteria. The heparosan produced should not be used directly for medicinal research. It requires multiple rounds of mutation to reduce the toxicity, which increases the cost and difficulty of research.

Method used

By genetically engineering Corynebacterium glutamate BDH, knocking out the zwf and ldh genes, weakening the FBA gene expression, and overexpressing a variety of key enzyme genes, such as glms, ndk, nox, glnA and ppk, to optimize the synthetic pathway of heparosan.

Benefits of technology

The production of high-yield heparosan has been achieved, with a yield of 23.05g/L, and the genetically engineered strains are safe and non-toxic, and the production cost is low.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present invention discloses a genetically engineered bacterium with high heparosan productivity and its application, belonging to the technical fields of genetic engineering and metabolic engineering. The genetically engineered bacterium with high heparosan productivity disclosed by the present invention uses Corynebacterium glutamicum BDH as the starting strain, knocks out the glucose-6-phosphate dehydrogenase gene and the lactate dehydrogenase gene; weakens the fructose-1,6-bisphosphate aldolase gene; overexpresses the glutamine-6-phosphofructotransferase gene, the nucleoside diphosphate kinase gene, the NADH oxidase gene, the glutamine synthetase gene and the polyphosphate kinase gene. The genetically engineered bacterium constructed by the present invention can produce 23.05 g / L of heparosan.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and metabolic engineering, and more particularly to a genetically engineered bacterium with high yield of heparosan and its application. Background Art

[0002] Heparin is an anticoagulant drug expressed by mast cells in mammalian connective tissues, and is a natural glycosaminoglycan composed of glucuronic acid and glucosamine. , Heparin plays multiple roles in vertebrates, such as embryonic development, antibacterial / viral infection (such as COVID-19), inflammatory response, and blood coagulation. With the increasing global demand, the market share of heparin is expected to exceed $14 billion in the next 10 years. The anticoagulant effect of heparin is mainly achieved by forming a complex with antithrombin (AT) and promoting the inhibition of activated coagulation factors by AT. It can stimulate the inactivation of coagulation factor Xa mediated by ATIII. The chemical structure of heparin as a whole is composed of hexuronic acid and D-glucosamine units alternately connected by 1,4-glycosidic bonds, with irregular sulfonation modifications. Among them, the hexuronic acid unit is glucuronic acid (GlcA) or its isomer iduronic acid (IdoA), and this unit may carry 2-O-sulfonation, namely GlcA2S or IdoA2S. The N-position of the D-glucosamine unit may have three different substitution forms: acetyl group, sulfonic acid group, and unsubstituted, namely GlcNAc, GlcNS, and GlcN. The 6-OH position and 3-OH position of this unit may also carry sulfonic acid group substitution, namely GlcNAc(6S), GlcNS(6S), GlcNS(3S), and GlcNS(3,6S). Due to this polydisperse sulfonyl modification and structural changes on the heparin sugar chain, heparin may interact with many different bioactive gene substances, and then achieve its bioactive functions.

[0003] Heparosan is a disaccharide repeating unit formed by the alternating connection of glucuronic acid and glucosamine. Its polysaccharide backbone is similar to that of heparin, except that the glucuronic acid is not isomerized to iduronic acid and no corresponding sulfation modification is carried out. So far, heparosan has been found in E. coli K5, E. coli Nissle1917, Avibacterium paragallinarum, and Pasteurella multocida serotype D. However, E. coli K5 and E. coli Nissle1917 have been used for the fermentative production of heparosan, with yields of 15 g / L and 12.2 g / L respectively. However, E. coli K5 is a pathogenic bacterium, and the heparosan produced is not suitable for direct use in medicinal research and needs to be used after multiple rounds of mutation to reduce toxicity. This increases the cost and difficulty in the research process. Based on this, the safe preparation of heparosan has become a current research hotspot.

[0004] Therefore, it is an urgent problem for those skilled in the art to provide a genetically engineered bacterium with high yield of heparosan and its application. Summary of the Invention

[0005] In view of this, the present invention provides a genetically engineered bacterium with high yield of heparosan and its application. This genetically engineered bacterium is safe and non-toxic, and can produce heparosan with high yield by microbial fermentation method, with relatively low production cost.

[0006] In order to achieve the above object, the present invention adopts the following technical scheme:

[0007] Rationally allocating metabolic fluxes in recombinant Corynebacterium glutamicum BDH (see Patent 201811190689.3) to achieve high yields of target products is a major challenge in metabolic engineering. The key metabolic nodes of the pentose phosphate pathway (PPP) and the heparosan synthesis pathway are glucose-6-phosphate (G6P). Glucose-6-phosphate dehydrogenase (encoded by zwf) catalyzes the oxidation of G6P to 6-phosphogluconolactone, which then enters the PPP. By knocking out zwf, the competition for G6P and the consumption of precursors can be reduced, thus effectively redirecting the carbon flux towards heparosan synthesis. Since cell growth and metabolism consume glucose, which hinders the production of heparosan, the direct competition between heparosan biosynthesis and central carbon metabolism for precursor supply severely limits the production of heparosan. To overcome this limitation and further improve heparosan synthesis, it is necessary to alter central metabolism to introduce more carbon flux into the heparosan synthesis pathway. In the glycolysis pathway, fba (encoding fructose-bisphosphate aldolase) needs to be downregulated. Fructose-6-phosphate (F6P) is another key metabolic node in heparosan synthesis, connecting the glycolysis and heparosan synthesis pathways. Weakening the expression of fba can promote heparosan synthesis and improve the conversion rate of glucose. The present invention designs an antisense RNA (asfba) for fba weakening. In addition, lactate is mainly considered a byproduct of heparosan synthesis. Therefore, the ldh (L-lactate dehydrogenase) gene was knocked out to further increase the yield of heparosan.

[0008] During the heterologous synthesis of heparosan in Corynebacterium glutamicum, many cofactors are required, such as NAD +, UDP, glutamine, ATP, and acetyl-CoA, etc. UDP is required in the synthesis of the two precursors of heparosan, UDP-GlcA and UDP-GlcNAc. Nucleoside-diphosphate kinase catalyzes the reaction of UTP to UDP. Overexpression of nucleoside-diphosphate kinase (ndk) is beneficial to the synthesis of UDP. The present invention discovers that the reaction from fructose-6-phosphate to D-glucosamine-6-phosphate is the rate-limiting step in the heparosan synthesis process. Therefore, strengthening this reaction helps to promote the synthesis of the product. The core of the present invention is to strengthen the rate-limiting step by means of genetic engineering to synergistically enhance the expression of glutamine-fructose-6-phosphate aminotransferase (GlmS) and the expression of glutamine synthetase (glnA), thereby increasing the yield of heterologous production of heparosan by recombinant Corynebacterium glutamicum.

[0009] At the same time, UTP-glucose-1-phosphate uridylyltransferase (GalU) is an NADH-dependent enzyme. The core of the present invention is to oxidize NADH to NAD by heterologously expressing NADH oxidase (nox). + . The intracellular ATP is enhanced by introducing a PPK-based ATP regeneration system. The rapid growth of Corynebacterium glutamicum and the production of heparosan require more ATP and higher dissolved oxygen. The polyphosphate kinase (PPK) encoded by ppk can catalyze the reversible transfer of ATP to inorganic polyphosphate (polyP), which has good economy.

[0010] A genetically engineered bacterium with high yield of heparosan

[0011] The genetically engineered bacterium uses Corynebacterium glutamicum BDH as the starting strain, and knocks out the glucose-6-phosphate dehydrogenase zwf gene and the lactate dehydrogenase ldh gene;

[0012] Weakens the fructose-1,6-bisphosphate aldolase fba gene; and / or

[0013] Overexpresses the glutamine-fructose-6-phosphate aminotransferase glms gene; and / or

[0014] Overexpresses the nucleoside-diphosphate kinase ndk gene or the NADH oxidase nox gene; and / or

[0015] Overexpress the glutamine synthetase glnA gene; and / or

[0016] Overexpress the polyphosphate kinase ppk gene.

[0017] Furthermore, the weakened fructose-1,6-bisphosphate aldolase fba gene is weakened by the antisense RNA (asfba) of fructose-1,6-bisphosphate aldolase fba; the antisense RNA of fructose-1,6-bisphosphate aldolase fba is derived from endogenous Corynebacterium glutamicum;

[0018] The glutamine-6-phosphate fructose aminotransferase glms gene is the glutamine-6-phosphate fructose aminotransferase glms gene derived from Bacillus subtilis 168, abbreviated as the bsglmS gene;

[0019] The nucleoside diphosphate kinase ndk gene is the nucleoside diphosphate kinase ndk gene derived from endogenous Corynebacterium glutamicum;

[0020] The NADH oxidase nox gene is the NADH oxidase nox gene derived from Lactobacillus brevis NCTC13768;

[0021] The glutamine synthetase glnA gene is the glutamine synthetase glnA gene derived from endogenous Corynebacterium glutamicum or Lactobacillus acidophilus ATCC4356, abbreviated as the cgglnA and laglnA genes respectively;

[0022] The polyphosphate kinase ppk gene is the polyphosphate kinase ppk gene derived from endogenous Corynebacterium glutamicum, Escherichia coli K12 or Rhodobacter sphaeroides KD131, abbreviated as the cgppk, ecppk and rspppk genes respectively.

[0023] Furthermore, the nucleotide sequence of the antisense RNA of fructose-1,6-bisphosphate aldolase fba derived from endogenous Corynebacterium glutamicum is as shown in SEQ ID NO.19;

[0024] The nucleotide sequence of the glutamine-6-phosphate fructose aminotransferase glms gene derived from Bacillus subtilis 168 is as shown in SEQ ID NO.28;

[0025] The nucleotide sequence of the nucleoside diphosphate kinase ndk gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.33;

[0026] The nucleotide sequence of the exogenous NADH oxidase nox gene is shown in SEQ ID NO.47;

[0027] The nucleotide sequence of the glutamine synthetase glnA gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.38;

[0028] The nucleotide sequence of the glutamine synthetase glnA gene derived from Lactobacillus acidophilus ATCC4356 is shown in SEQ ID NO.43;

[0029] The nucleotide sequence of the polyphosphate kinase ppk gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.52;

[0030] The nucleotide sequence of the polyphosphate kinase ppk gene derived from Escherichia coli K12 is shown in SEQ ID NO.59;

[0031] The nucleotide sequence of the polyphosphate kinase ppk gene derived from other exogenous sources is shown in SEQ ID NO.63.

[0032] Furthermore, the application of the said genetically engineered bacterium in the production of heparosan.

[0033] Furthermore, the application of the said genetically engineered bacterium in increasing the yield of heparosan.

[0034] Furthermore, a method for producing heparosan, which uses the said genetically engineered bacterium for fermentation.

[0035] Except for Corynebacterium glutamicum ATCC 13032 and the genetically engineered strains based on it, other strains of Corynebacterium glutamicum, Escherichia coli, Bacillus subtilis or Lactobacillus with the ability to produce heparosan and the genetically engineered strains based on them can also be used in the present invention after appropriate verification.

[0036] Through the above technical solutions, compared with the prior art, the present invention discloses a genetically engineered bacterium with high heparosan production and its application. The genetically engineered bacterium constructed in the present invention can produce 23.05 g / L of heparosan. Detailed implementation manners

[0037] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0038] LBHIS medium: Peptone 5.0 g / L, yeast extract 2.5 g / L, NaCl 5.0 g / L, Brain Heart Infusion (BHI) 18.5 g / L, sorbitol 91.0 g / L. For the corresponding LBHIS solid medium, 1.8% - 2% agar is added.

[0039] LBG medium: Peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, glucose 20.0 g / L.

[0040] EPO medium: Peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, glycine 30.0 g / L, Tween80 10.0 g / L.

[0041] 30% sucrose medium: Peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, sucrose 300.0 g / L.

[0042] 20% sucrose solid medium: Peptone 10.0 g / L, yeast extract 5.0 g / L, NaCl 10.0 g / L, sucrose 200.0 g / L, agar 15.0 g / L.

[0043] Fermentation medium: Glucose 65.0 g / L, urea 5.0 g / L, corn steep powder 20.0 g / L, biotin 4×10 -4 g / L, VB1 4×10 -4 g / L, K2HPO4 1.0 g / L, KH2PO4 1.0 g / L, CaCl2•2H2O 29.4 mg / L, MgSO4•7H2O 1.2325 g / L, trace element solution 0.2%.

[0044] Preparation method of trace element solution: Weigh 1g of FeSO4·7H2O, 1g of MnSO4·H2O, 0.1g of ZnSO4·7H2O, 0.2g of CuSO4, 0.002g of NiCl2·6H2O, add water to make up to 100 mL, then add 100 μl of concentrated hydrochloric acid to adjust the pH, and then filter through a membrane to sterilize the bacteria, and add 0.2% to the fermentation medium system.

[0045] Example 1

[0046] (1) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, zwf-up (shown in SEQ ID NO.1) was amplified using primers zwf-up-F / zwf-up-R, and zwf-down (shown in SEQ ID NO.2) was amplified using primers zwf-down-F / zwf-down-R to obtain the upstream and downstream homologous arms for knocking out zwf.

[0047] The primer sequences are as follows:

[0048] zwf-up-F: 5’-ATTCGAGCTCGGTACCCGGGGATCC GCAACCCCAGGTTCTTTG -3’; SEQ ID NO.3.

[0049] zwf-up-R: 5’-TGACCGTTGC GTTTGTCCAGCTGGAGGG -3; SEQ ID NO.4.

[0050] zwf-down-F: 5’-CTGGACAAAC GCAACGGTCACACCTGGC -3’; SEQ ID NO.5.

[0051] zwf-down-R: 5’-TAAAACGACGGCCAGTGCCAAGCTT TGGTGCGAACGATCTCCAG -3’; SEQ ID NO.6.

[0052] Gene amplification system: 25 μL of PrimestarMax (Takara), 2 μL of each upstream and downstream primer, 1 μL of template, 20 μL of ddH2O.

[0053] Gene amplification program: Pre-denaturation at 98 °C for 3 minutes; denaturation at 98 °C for 10 seconds, annealing at 57 °C for 30 seconds, extension at 72 °C for 10 s / kb, 35 cycles; extension at 72 °C for 10 minutes.

[0054] After agarose gel electrophoresis and product recovery of the PCR products, gene fragments zwf-up and zwf-down were obtained.

[0055] The plasmid vector pk18mobsacb was linearized with primers pK18-zwf-F / pK18-zwf-R to obtain the pk-zwf vector. The specific primer sequences are as follows:

[0056] pK18-zwf-F: 5’-AAGCTTGGCACTGGCCGTCGTTTTA-3’; SEQ ID NO.7.

[0057] pK18-zwf-R: 5'-GGATCCCCGGGTACCGAGCTCGAAT-3'; SEQ ID NO.8.

[0058] Add 3 μL of zwf-up, 3 μL of zwf-down, 4 μL of pK-zwf vector and 10 μl of Gibson ligase into a PCR tube. The ligation temperature is 50 °C and the ligation time is 15 min. The total system is 20 μL.

[0059] The total 20 μl ligation system of Gibson ligation was transformed into E.coli Trans10 competent cells (TransGen Biotech, Beijing) for cultivation. The transformation process was carried out strictly according to the instructions: after culturing at 37 °C for 1 h, plate onto LB plates (containing 50 μg / mL kanamycin), and then culture at 37 °C for 12 h. Select 10 - 20 single colonies for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing are zwf-up-F / zwf-down-R.

[0060] Select a correct single colony, name it Escherichia coli EC001, name the plasmid pK18-zwf. After expansion, plasmid extraction was performed to obtain the pK18-zwf plasmid, which was electrotransformed into the competent cells of Corynebacterium glutamicum ATCC13032.

[0061] The preparation of competent cells of Corynebacterium glutamicum ATCC13032 is as follows: Pick the glycerol-preserved strain of Corynebacterium glutamicum ATCC13032 and streak it onto an LBHIS plate, culture it in an incubator at 30 °C until the colonies are clear. Pick colonies from the plate and inoculate them into an LBHIS liquid test tube medium for 12 h. Then inoculate with an initial OD 600 of about 0.3 into the EPO medium. Continue to culture until OD 600The OD value is 0.9. Take the bacterial solution and place it in a centrifuge tube, ice-bath for 15 min, centrifuge at 4500 rpm for 10 min to collect the bacteria (aliquoted into 1.5 mL centrifuge tubes), resuspend the bacteria with 100 μL of pre-cooled 10% glycerol, and repeat the above centrifugation three times. After washing, resuspend the bacteria with 100 μL of 10% sterile glycerol to obtain the competent cells of Corynebacterium glutamicum ATCC13032. The electrotransformation method is as follows: Add 4 μL of plasmid to each tube of competent cells and ice-bath for 10 min. Transfer the mixture into a pre-cooled electroporation cuvette and perform electroporation under the conditions of 1.8 kv, 5 ms, 50 μF, and 100 Ω. Immediately after electroporation, add 800 μL of LBHIS medium, then incubate in a 46 °C water bath for 6 min, and then incubate at 30 °C for 3 h. Spread the cells on a solid LBHIS plate containing 50 μg / mL kanamycin and verify after culturing at 30 °C for 36 h.

[0062] For the gene knockout strains, several single colonies grown on the above plates need to be picked for the verification of the sacB gene. The verification primers are as follows:

[0063] sacB-F: 5’-CTCAAGCGTTTGCGAAAGAAACG-3’; SEQ ID NO.9.

[0064] sacB-R: 5’-GAGTCAGTGAACAGGTACCATTTGCC-3’; SEQ ID NO.10.

[0065] Inoculate the strains with correct verification into 30% sucrose medium and culture for 24 h. After the bacterial solution becomes turbid, streak it on 20% sucrose medium and verify using the primers zwf-up-F / zwf-down-R. If the PCR fragment result is 2000 bp and is confirmed to be correct, it is the target gene knockout strain, which can be stored for later use and named Corynebacterium glutamicum CG1.

[0066] (2) Using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, amplify ldh-up (as shown in SEQ ID NO.11) using the primers ldh-up-F / ldh-up-R, and amplify ldh-down (as shown in SEQ ID NO.12) using the primers ldh-down-F / ldh-down-R to obtain the upstream and downstream homologous arms for ldh knockout.

[0067] The primer sequences are as follows:

[0068] ldh-up-F: 5’-gattacgaattc AAAACCCTGGTCACGGTGAATG -3’; SEQ ID NO.13.

[0069] ldh-up-R: 5'-GGGATCGAAA ATCTTTGGCGCCTAGTTGGC -3'; SEQ ID NO.14.

[0070] ldh-down-F: 5'-GGCGCCAAAGAT TTTCGATCCCACTTCCTGATTTCCC -3'; SEQ ID NO.15.

[0071] ldh-down-R: 5'-gtaccgagctc TTTCATACGACCACGGGCTACCC -3'; SEQ ID NO.16.

[0072] The plasmid vector pk18mobsacb was linearized with primers pK18-ldh-F / pK18-ldh-R to obtain the pk-ldh vector. The primer sequences are as follows:

[0073] pK18-ldh-F: 5'-GTGGTCGTATGAAAgagctcggtacccgggga-3'; SEQ ID NO.17.

[0074] pK18-ldh-R: 5'-CGTGACCAGGGTTTTgaattcgtaatcatgtcatagctgtttcctg-3'; SEQID NO.18.

[0075] The gene amplification system and gene amplification program were the same as above. The ldh-up, ldh-down, and pk-ldh vectors were obtained. The connection, transformation, and verification methods were the same as above. Escherichia coli EC002 was obtained. The plasmid was named pK18-ldh. After propagation and plasmid extraction, the pK18-ldh plasmid was obtained.

[0076] The plasmid pK18-ldh was electrotransformed into the competent cells of Corynebacterium glutamicum CG1. The preparation of competent cells, electrotransformation, sacB verification, and culture in sucrose medium were the same as above. The primers for ldh knockout verification were the above ldh-up-F / ldh-down-R.

[0077] The strains that had successfully knocked out ldh were verified by the verification primers, inoculated into LBHIS liquid medium for culture, and streaked on the LBHIS solid medium plate for purification and re-verification. After confirmation, they could be stored for use and named Corynebacterium glutamicum CG2.

[0078] (3) For the antisense RNA (asfba) of fba, using the genomic DNA of Corynebacterium glutamicum ATCC13032 as a template, the asfba fragment (as shown in SEQ ID NO.19) was amplified with primers asfba-F / asfba-R.

[0079] The primer sequences are as follows:

[0080] asfba-F: 5’-TTCCTTCTGGCAGTGGTCAGTG-3’; SEQ ID NO.20.

[0081] asfba-R: 5’-ATGCCTATCGCAACTCCCGAG-3’; SEQ ID NO.21.

[0082] The plasmid vector pEC-XK99E-kfiA-kfiC (see Patent 201811190689.3) was linearized with primers pEC-F1 / pEC-R1 to obtain the linear vector pEC-XK99E-kfiA-kfiC. The primer sequences are as follows:

[0083] pEC-F1: 5’-CTCGGGAGTTGCGATAGGCATAAGGAGGATATACATATGAACGCAGAATATATAAATTTAGTTGAACG-3’; SEQ ID NO.22.

[0084] pEC-R1: 5’- CACTGACCACTGCCAGAAGGAAggtctgtttcctgtgtgaaattgtt-3’; SEQ IDNO.23.

[0085] The gene amplification system and gene amplification program were the same as above to obtain the asfba fragment and the linear vector pEC-XK99E-kfiA-kfiC. 3 μL of the asfba fragment, 2 μL of the linear vector pEC-XK99E-kfiA-kfiC, and 5 μL of Gibson ligase were added to a PCR tube. The ligation temperature was 50 °C and the ligation time was 15 min. The total system was 10 μL.

[0086] The total 10 μL ligation system of Gibson ligation was transformed into E. coli Trans10 competent cells (TransGen Biotech, Beijing) for culture. The transformation process was strictly carried out according to the instructions: after culturing at 37 °C for 1 h, it was plated onto an LB plate (containing 50 μg / mL kanamycin), and then cultured at 37 °C for 12 h. 10 - 20 single colonies were selected for colony PCR amplification and DNA sequencing verification. The primers for colony PCR amplification and DNA sequencing were asfba-F / asfba-R.

[0087] Select a correct single colony, name it Escherichia coli EC003, and name the plasmid pEC-XK99E-kfiA-kfiC-asfba. After amplification and plasmid extraction, the pEC-XK99E-kfiA-kfiC-asfba plasmid was obtained.

[0088] Electroporate plasmid pEC-XK99E-kfiA-kfiC-asfba and PXMJ19-kfiB-kfiD-hasB (see Patent 201811190689.3) into the competent cells of Corynebacterium glutamicum CG2. The preparation of competent cells is the same as above. Add 2 μL of each of pEC-XK99E-kfiA-kfiC-asfba and PXMJ19-kfiB-kfiD-hasB to the competent cells of Corynebacterium glutamicum CG2, gently mix, and incubate on ice for 6 min. Then transfer the mixture into a pre-chilled 0.2 cm electroporation cuvette. The electroporation conditions are: 1.8 kv, 5 ms of electroporation, 50 μF, 100 Ω. Immediately after electroporation, add 800 μL of LBHIS medium preheated at 46 °C, gently mix and then aspirate and place it in a 1.5 mL centrifuge tube. Incubate in a water bath at 46 °C for 6 min, and then incubate at 30 °C for 3 h for recovery. After recovery, take a certain amount of the bacterial solution and spread it on an LBHIS solid medium containing 50 mg / mL kanamycin and 5 mg / mL chloramphenicol, and culture at 30 °C for 24 - 36 h. Verify the kana and cm genes for the grown single colonies. Only the colonies that can grow on the double-resistant plate of kanamycin and chloramphenicol and can amplify the kana and cm genes are the target strains. The verification primers are as follows:

[0089] kana-F: 5’-ATGATTGAACAAGATGGATTGCACG-3’; SEQ ID NO.24.

[0090] kana-R: 5’-TCAGAAGAACTCGTCAAGAAGGC-3’; SEQ ID NO.25.

[0091] Cm-R: 5’-CCTGCCACTCATCGCAGTAC-3’; SEQ ID NO.26.

[0092] Cm-F: 5’-ATGGAGAAAAAAATCACTGGATATACCACC-3’; SEQ ID NO.27.

[0093] (4)Pick appropriate positive clones and inoculate them into a test tube containing 4 mL of LBHIS medium. After overnight culture, name it Corynebacterium glutamicum HS1, preserve the glycerol bacteria, and store the preserved glycerol bacteria in a -80 °C refrigerator. And conduct fermentation verification on Corynebacterium glutamicum HS1 in a 50 mL system.

[0094] The fermentation of Corynebacterium glutamicum HS1 is divided into three steps:

[0095] ① Inoculate the test tube: Take 100 μL of Corynebacterium glutamicum HS1 stored at -80 °C and transfer it to a test tube containing 4 mL of LBHIS liquid medium (containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate at 30 °C for 12 - 14 h.

[0096] ② Inoculate the seed: Take out the test tube after culturing for 12 - 14 h, and transfer 1 mL of the bacterial liquid in the test tube to 20 mL of LBG liquid medium (the container is a 100 mL non-baffled conical flask, containing 50 μg / mL kanamycin and 5 μg / mL chloramphenicol). Incubate in a constant temperature shaker at 30 °C and 200 rpm for 12 - 14 h.

[0097] ③ Inoculate the fermentation medium: The amount of seed inoculated in the 50 mL fermentation broth (the container is a 250 mL baffled conical flask, and the fermentation medium contains 50 μg / mL kanamycin and 5 μg / mL chloramphenicol) is 5% of the total fermentation system, and the final concentration of OD 600 is 0.3. Use concentrated ammonia water to adjust the pH of the fermentation broth to neutral, and incubate in a constant temperature shaker at 30 °C and 200 rpm for 48 h (add 0.8 mM IPTG for induction at 2 h). Detect OD 600 and the concentration of the target product heparosan after 48 h.

[0098] 1) Detection of OD 600 : Inject the fermentation broth into a cuvette, dilute it 50 times with deionized water, and then measure the absorbance value (600 nm) with a UV spectrophotometer to measure OD 600 .

[0099] 2) Determination of heparosan content

[0100] The present invention uses the carbazole sulfate method to quantify heparosan. By measuring the content of glucuronic acid, heparosan is indirectly quantified. Heparosan will be acid-hydrolyzed into glucuronic acid and glucosamine in the presence of concentrated sulfuric acid. Among them, glucuronic acid reacts with the carbazole reagent to form a magenta substance, and the content of this substance is proportional to the content of glucuronic acid. The content of heparosan is determined by the proportion of glucuronic acid in the heparin precursor.

[0101] The specific measurement method is as follows: Take 1 mL of the treated sample to be measured in a colorimetric tube, slowly add 5 mL of ice-bath borax sulfuric acid solution (weigh 0.954 g of Na2B4O7•10H2O reagent, add 100 mL of concentrated sulfuric acid to dissolve it), mix well and insert it into the ice-water bath to release heat. After the heat release is completed, heat it in boiling water for 10 min, and then cool the sample in the ice-water bath. After cooling to room temperature, add 0.2 mL of carbazole reagent (weigh 0.125 g of carbazole reagent and dissolve it in 100 mL of absolute ethanol), mix well, and heat it in boiling water for 15 min to develop color. After the reaction is completed, wait for the sample to cool to room temperature and measure its OD 530 。

[0102] Determination of the standard curve: Use a volumetric flask to accurately prepare glucuronic acid standard solutions with concentrations of 10, 20, 30, 40, and 50 mg / L respectively, and measure the OD of each standard solution by the above carbazole sulfate method 530 。Based on the measurement results, take the concentration of glucuronic acid as the abscissa and OD 530 as the ordinate to draw the standard curve.

[0103] When Corynebacterium glutamicum HS1 is fermented and cultured for 48 h, the OD 600 and the heparosan content results are shown in Table 1.

[0104] Table 1

[0105]

[0106] Note: The BDH strain refers to 201811190689.3.

[0107] Example 2

[0108] Using the genomic DNA of Bacillus subtilis 168 as a template, the fragment bsglmS (as shown in SEQ ID NO.28) was amplified using primers bsglmS-F and bsglmS-R to obtain a bsglmS fragment from Bacillus subtilis 168 with seamless cloning homologous arms connected to the plasmid.

[0109] The primer sequences are as follows:

[0110] bsglmS-F: 5'-GTTGCGATAGGCATAAGGAGGATATACAT atgtgtggaatcgtaggttatatcg -3'; SEQ ID NO.29.

[0111] bsglmS-R: 5'-ttctctcatccgccaaaacagccCT ttactccacagtaacactcttcgcaag -3'; SEQ ID NO.30.

[0112] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba was linearized with primers PEC-F2 / PEC-R2 to obtain the linear vector pEC-XK99E-kfiA-kfiC-asfba. The primer sequences are as follows:

[0113] PEC-F2: 5'-ggctgttttggcggatgagagaag-3'; SEQ ID NO.31.

[0114] PEC-R2: 5'-ccacacatATGTATATCCTCCTTATGCCTATCGCAACTCCCG-3'; SEQ ID NO.32.

[0115] The gene amplification system and gene amplification program were the same as in Example 1 to obtain the bsglmS fragment and the pEC-XK99E-kfiA-kfiC-asfba linear vector. 3 μl of the bsglmS fragment, 2 μl of the pEC-XK99E-kfiA-kfiC-asfba linear vector, and 5 μl of Gibson enzyme were added to the PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were the above bsglmS-F / bsglmS-R, and the sequencing method was full-length sequencing. The plasmid of the correctly sequenced bacterial solution was extracted to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS plasmid. The corresponding colony was named Escherichia coli EC004.

[0116] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS and PXMJ19-kfiB-kfiD-hasB were simultaneously electrotransformed into the competent cells of Corynebacterium glutamicum CG2. The experimental steps were the same as in Example 1, and the verification of the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes was carried out simultaneously. The strain with both verified correctly was named Corynebacterium glutamicum HS2.

[0117] The shake flask fermentation verification of Corynebacterium glutamicum HS2 was carried out in a 50 mL system. The fermentation medium and fermentation operation were the same as in Example 1.

[0118] In the shake flask fermentation of Corynebacterium glutamicum HS2 in a 50 mL system, the OD at 48 h of fermentation culture 600 was 39.7, and 1076.3 mg / L of heparosan was produced.

[0119] Example 3

[0120] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the fragment ndk (shown in SEQ ID NO.33) was amplified using the primers ndk-F / ndk-R to obtain the ndk fragment derived from Corynebacterium glutamicum ATCC13032 with seamless cloning homologous arms connected to the plasmid.

[0121] The primer sequences are as follows:

[0122] ndk-F: 5’-TGGAAGGGTAA AAGGAGGATATACATATGACTGAACGTACTCTCATCCTTATCAAG -3’; SEQ ID NO.34.

[0123] ndk-R: 5’- TTACAGGTTAGGGAACCAGATGGAGATCTC -3’; SEQ ID NO.35.

[0124] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS was linearized using the primers PEC-F3 / PEC-R3 to obtain the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS, and the primer sequences are as follows:

[0125] PEC-F3: 5’-CCATCTGGTTCCCTAACCTGTAA agaaggccatcctgacggatggccttttgcgtctg ag -3’; SEQ ID NO.36.

[0126] PEC-R3: 5’-TTCAGTCATATGTATATCCTCCTTTTACCCTTCCACATTATACACTAATTCGAGGTTAA-3’; SEQ ID NO.37.

[0127] The gene amplification system and gene amplification procedure were the same as in Example 1 to obtain the ndk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector. 3 μl of the ndk fragment, 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector, and 5 μl of Gibson enzyme were added to a PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were the above-mentioned ndk-F / ndk-R, and the sequencing method was full-length sequencing. The plasmid of the correctly sequenced bacterial solution was extracted to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-ndk plasmid. The corresponding colony was named Escherichia coli EC005.

[0128] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-ndk and PXMJ19-kfiB-kfiD-hasB were simultaneously electrotransformed into the competent cells of Corynebacterium glutamicum CG2. The experimental steps were the same as in Example 1, and the verification of the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes was carried out simultaneously. The strain with both verified correctly was named Corynebacterium glutamicum HS3.

[0129] The shake flask fermentation of Corynebacterium glutamicum HS3 was verified in a 50 mL system. The fermentation medium and fermentation operation were the same as in Example 1.

[0130] In the shake flask fermentation of Corynebacterium glutamicum HS3 in a 50 mL system, the OD 600 was 52.1 at 48 h of fermentation culture, and 1177.5 mg / L of heparosan was produced.

[0131] Example 4

[0132] (1) Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the fragment cgglnA (as shown in SEQ ID NO.38) was amplified using the primers cgglnA-F / cgglnA-R to obtain the cgglnA fragment from Corynebacterium glutamicum ATCC13032 with seamless cloning homologous arms for plasmid ligation.

[0133] The primer sequences are as follows:

[0134] cgglnA-F: 5’-CACGTGATATTTTCCAGCGTGACTAAAAGGAGGATATACATatggtggcgtttgaaaccc-3’; SEQ ID NO.39.

[0135] cgglnA-R: 5’-gccaagctgaattcgatcctctaga ttagcagtcgaagtacaattcgaattc -3'; SEQ ID NO.40.

[0136] The plasmid vector PXMJ19-kfiB-kfiD-hasB was linearized with primers PX-F1 / PX-R1 to obtain the linear vector PXMJ19-kfiB-kfiD-hasB. The primer sequences are as follows:

[0137] PX-F1: 5’-tctagaggatcgaattcagcttggc-3’; SEQ ID NO.41.

[0138] PX-R1: 5’-TTAGTCACGCTGGAAAATATCACGTG-3’; SEQ ID NO.42.

[0139] The gene amplification system and gene amplification program were the same as in Example 1 to obtain the cgglnA fragment and the PXMJ19-kfiB-kfiD-hasB linear vector. 3 μl of the cgglnA fragment, 2 μl of the PXMJ19-kfiB-kfiD-hasB linear vector, and 5 μl of Gibson enzyme were added to the PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were cgglnA-F / cgglnA-R, and the sequencing method was full-length sequencing. The plasmid of the correctly sequenced bacterial solution was extracted to obtain the PXMJ19-kfiB-kfiD-hasB-cgglnA plasmid.

[0140] (2) Using the genome of Lactobacillus acidophilus ATCC4356 as a template, the fragment laglnA (as shown in SEQ ID NO.43) was amplified with primers laglnA-F / laglnA-R to obtain the laglnA fragment from Lactobacillus acidophilus ATCC4356 with seamless cloning homologous arms for plasmid ligation.

[0141] The primer sequences are as follows:

[0142] laglnA-F: 5’-ACACGTGATATTTTCCAGCGTGACTAAAAGGAGGATATACAT atgagtaaacaata cactgcag -3’; SEQ ID NO.44.

[0143] laglnA-R: 5’- atcctctaga ttaccagttcatgtaacgttgacgttccc-3’; SEQ ID NO.45.

[0144] The plasmid vector PXMJ19-kfiB-kfiD-hasB was linearized using primers PX-F2 / PX-R1 to obtain the PXMJ19-kfiB-kfiD-hasB2 vector. The primer sequences are as follows:

[0145] PX-F2: 5’-gaactggtaatctagaggatcgaattcagcttggctgttttgg-3’; SEQ ID NO.46.

[0146] PX-R1: The same as above.

[0147] The gene amplification system and gene amplification program were the same as in Example 1 to obtain the laglnA fragment and the PXMJ19-kfiB-kfiD-hasB2 linear vector. 3 μl of the laglnA fragment, 2 μl of the PXMJ19-kfiB-kfiD-hasB2 linear vector, and 5 μl of Gibson enzyme were added to the PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were the above-mentioned laglnA-F / laglnA-R, and the sequencing method was full-length sequencing. The plasmid of the correctly sequenced bacterial solution was extracted to obtain the PXMJ19-kfiB-kfiD-hasB-laglnA plasmid.

[0148] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-ndk were co-electroporated into the competent cells of Corynebacterium glutamicum CG2 with PXMJ19-kfiB-kfiD-hasB-cgglnA and PXMJ19-kfiB-kfiD-hasB-laglnA respectively. The experimental steps were the same as in Example 1. At the same time, the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified. The strains with both verified correctly were named Corynebacterium glutamicum HS4 and Corynebacterium glutamicum HS5.

[0149] Corynebacterium glutamicum HS4 and Corynebacterium glutamicum HS5 were respectively verified by shake flask fermentation in a 50 mL system. The fermentation medium and fermentation operation were the same as in Example 1.

[0150] The OD of Corynebacterium glutamicum HS4 and HS5 at 48 h of fermentation culture 600 and the heparosan content results are shown in Table 2.

[0151] Table 2

[0152]

[0153] Table 2 results showed that strain HS4 produced 1207.0 mg / L of heparosan in 50 mL shake flask fermentation; strain HS5 produced 1220.0 mg / L of heparosan in 50 mL shake flask fermentation.

[0154] (3)Corynebacterium glutamicum HS5 was subjected to 50 mL shake flask fermentation, and 2, 4, 6, 8 g / L of sodium glutamate was added to the fermentation medium (Table 3).

[0155] Table 3

[0156]

[0157] Table 3 results showed that the highest heparosan yield was obtained when 6 g / L of sodium glutamate was added to the fermentation medium.

[0158] Example 5

[0159] Using the synthetic gene nox from BGI (shown in SEQ ID NO.47) as a template, the fragment nox was amplified using primers nox-F / nox-R to obtain the nox fragment with seamless cloning homologous arms for ligation with the plasmid.

[0160] The primer sequences are as follows:

[0161] nox-F: 5’-gcgaagagtgttactgtggagtaaAAGGAGGATATACAT atgaaagtcacagttgttgg ttgtac -3’; SEQ ID NO.48.

[0162] nox-R: 5’-ctctcatccgccaaaacagcc ttaagcgttaactgattgggcaactttc -3’; SEQ IDNO.49.

[0163] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS was linearized using primers PEC-F4 / PEC-R4 to obtain the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS. The primer sequences are as follows:

[0164] PEC-F4: 5’-ggctgttttggcggatgagag-3’; SEQ ID NO.50.

[0165] PEC-R4: 5’-actttcatATGTATATCCTCCTTttactccacagtaacactcttcgcaag-3’; SEQID NO.51.

[0166] The gene amplification system and gene amplification procedure were the same as in Example 1 to obtain the nox fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector. 3 μl of the bsglmS fragment, 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS linear vector, and 5 μl of Gibson enzyme were added to a PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were the above nox-F / nox-R, and the sequencing method was full-length sequencing. The plasmid of the bacteria with correct sequencing was extracted to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox plasmid.

[0167] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox and PXMJ19-kfiB-kfiD-hasB-laglnA were simultaneously electrotransformed into the competent cells of Corynebacterium glutamicum CG2. The experimental steps were the same as in Example 1, and the verification of the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes was carried out simultaneously. The strain with correct verification of both was named Corynebacterium glutamicum HS6.

[0168] The shake flask fermentation of Corynebacterium glutamicum HS6 was verified in a 50 mL system. The fermentation medium and fermentation operation were the same as in Example 1, and 6 g / L of sodium glutamate was added to the fermentation medium.

[0169] In the shake flask fermentation of Corynebacterium glutamicum HS6 in a 50 mL system, the OD 600 was 42.6 at 48 h of fermentation culture, and 2060.7 mg / L of heparosan was produced.

[0170] Example 6

[0171] (1) Using the genomic DNA of Corynebacterium glutamicum ATCC 13032 as a template, the fragment cgppk (as shown in SEQ ID NO.52) was amplified using the primers cgppk-F / cgppk-R to obtain the cgppk fragment from Corynebacterium glutamicum ATCC 13032 with seamless cloning homologous arms for plasmid ligation.

[0172] The primer sequences are as follows:

[0173] cgppk-F: 5’-gttaacgcttaaAAGGAGGATATACAT ATGGTGGGTAAACTTCCCATCATG -3’; SEQ ID NO.53.

[0174] cgppk-R: 5’-CTAGTCACCGATCTGGTCGCGC -3'; SEQ ID NO.54.

[0175] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox was linearized using primers PEC-F5 / PEC-R5 to obtain the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox. The primer sequences are as follows:

[0176] PEC-F5: 5'- GGCGCGACCAGATCGGTGACTAG ggctgttttggcggatgag-3'; SEQ ID NO.55.

[0177] PEC-R5: 5'-GTTTACCCACCATATGTATATCCTCCTTttaagcgttaactgattgggcaactttc-3'; SEQ ID NO.56.

[0178] The gene amplification system and gene amplification program were the same as in Example 1 to obtain the cgppk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox linear vector. 3 μl of the cgppk fragment, 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox linear vector, and 5 μl of Gibson enzyme were added to the PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were jun-F / jun-R, and the sequencing method was full-length sequencing. The plasmid was extracted from the correctly sequenced bacterial solution to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-cgppk plasmid. The primer sequences are as follows:

[0179] jun-F: 5'-cttgctccgttggtatctgttg-3'; SEQ ID NO.57.

[0180] jun-R: 5'-ttccctactctcgcatggggag-3'; SEQ ID NO.58.

[0181] (2) Using the Escherichia coli K12 genomic DNA as a template, the fragment ecppk (as shown in SEQ ID NO.59) was amplified using primers ecppk-F / ecppk-R to obtain the ecppk fragment derived from Escherichia coli K12 with seamless cloning homologous arms for ligation with the plasmid.

[0182] The primer sequences are as follows:

[0183] ecppk-F: 5’-tgcgaagagtgttactgtggagtaaAAGGAGGATATACAT atgggtcaggaaaagct atacatcg -3'; SEQ ID NO.60.

[0184] ecppk-R: 5’-ctctcatccgccaaaacagcc ttattcaggttgttcgagtgatttgatgtag -3'; SEQ ID NO.61.

[0185] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox was linearized with primers PEC-F4 / PEC-R6 to obtain the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox2. The primer sequences are as follows:

[0186] PEC-F4: The same as above.

[0187] PEC-R6: 5’-ttactccacagtaacactcttcgcaag-3'; SEQ ID NO.62.

[0188] The gene amplification system and gene amplification program were the same as in Example 1 to obtain the ecppk fragment and the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox2 linear vector. 3 μl of the ecppk fragment, 2 μl of the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox2 linear vector, and 5 μl of Gibson enzyme were added to the PCR tube. The ligation and transformation methods were the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were jun-F / jun-R, and the sequencing method was full-length sequencing. The plasmid was extracted from the correctly sequenced bacterial solution to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-ecppk plasmid.

[0189] (3) Using the rspppk gene synthesized by BGI (as shown in SEQ ID NO.63) as a template, the rspppk fragment was amplified with primers rsppk-F / rsppk-R to obtain the rspppk fragment with seamless cloning homologous arms for plasmid ligation.

[0190] The primer sequences are as follows:

[0191] rspppk-F: 5’-cagttaacgcttaaAAGGAGGATATACAT ATGGCCGAAGACCGCGCGA -3'; SEQID NO.64.

[0192] rspppk-R: 5'-tctctcatccgccaaaacagcc TTATCCCTGACGCGGCTTGCGCA -3'; SEQ ID NO.65.

[0193] The plasmid vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox was linearized using primers PEC-F4 / PEC-R7 to obtain the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox3. The primer sequences are as follows:

[0194] PEC-F4: The same as above.

[0195] PEC-R7: 5'-CGGCCATATGTATATCCTCCTTttaagcgttaactgattgggcaactttc-3'; SEQ ID NO.66.

[0196] The gene amplification system and gene amplification program were the same as in Example 1 to obtain the rspppk fragment and the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox3. 3 μl of the rspppk fragment, 2 μl of the linear vector pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox3, and 5 μl of Gibson enzyme were added to a PCR tube. The ligation and transformation method was the same as in Example 1. Several grown colonies were picked and sent to BGI for sequencing. The sequencing primers were jun-F / jun-R, and the sequencing method was whole-genome sequencing. The plasmid of the correctly sequenced bacterial solution was extracted to obtain the pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-rspppk plasmid.

[0197] The plasmids pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-cgppk, pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-ecppk, and pEC-XK99E-kfiA-kfiC-asfba-bsglmS-nox-rspppk were respectively electrotransformed into the competent cells of Corynebacterium glutamicum CG2 together with PXMJ19-kfiB-kfiD-hasB-laglnA. The experimental steps were the same as in Example 1. At the same time, the kana (primers kana-F / kana-R) and Cm (primers Cm-F / Cm-R) genes were verified. The strains with both verified correctly were named Corynebacterium glutamicum HS7, HS8, and HS9.

[0198] (4) Shake flask fermentation verification of Corynebacterium glutamicum HS7, HS8, and HS9 was carried out in a 50 mL system. The fermentation medium and fermentation operation were the same as in Example 1, and 6 g / L sodium glutamate was added to the fermentation medium; additionally, sodium tripolyphosphate (5 g / L or 10 g / L) or sodium hexametaphosphate (5 g / L or 10 g / L) was added.

[0199] When Corynebacterium glutamicum HS7, HS8, and HS9 were fermented and cultured for 48 h, the OD 600 and the heparosan content results are shown in Table 4.

[0200] Table 4

[0201]

[0202] The results in Table 4 show that for the HS7 strain, when 6 g / L sodium glutamate + 10 g / L sodium hexametaphosphate was added to the fermentation medium, the yield of heparosan was the highest.

[0203] (5) Fed-batch fermentation in a 5 L fermenter

[0204] Using Corynebacterium glutamicum HS7 as the fermentation strain, fermentation was carried out using a fermentation medium supplemented with 6 g / L sodium glutamate and 10 g / L sodium hexametaphosphate. The fermenter conditions were 30 °C, 500 rpm, an initial pH of 7.0, and an inoculation final concentration of OD 600 = 0.4 (the inoculation amount was approximately 5 - 10% of the fermentation volume), and aeration was carried out at 0.2 L / min; the filling volume of the fermenter was 1.5 L; during the fermentation process, 10% sulfuric acid and 25% ammonia water were used to automatically adjust the pH to 7.0. When the OD 600 reached 15, the inducer IPTG (final concentration of 0.8 mM) was added. Samples were taken at different time points to detect the residual glucose concentration by HPLC, and 800 g / L glucose was used for fed-batch feeding to adjust the glucose feeding rate. The results are shown in Table 5.

[0205] Table 5: Heparosan results in a 5 L fermenter

[0206]

[0207] The results in Table 5 show that in a 5 L fermenter, the HS7 strain produced 23.05 g / L of heparosan at 76 h.

[0208] The foregoing description of the disclosed embodiments enables those skilled in the art to practice or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered bacterium that produces high heparosan yield, characterized in that: The genetically engineered bacteria uses Corynebacterium glutamicum BDH as a starting strain, and knocks out the glucose-6-phosphate dehydrogenase gene and the lactate dehydrogenase gene; Attenuated fructose-1,6-bisphosphate aldolase gene; and / or Overexpression of the glutamine-6-phosphofructotransferase gene; and / or Overexpression of nucleoside diphosphate kinase gene or NADH oxidase gene; and / or Overexpression of the glutamine synthetase gene; and / or Overexpression of polyphosphate kinase gene; The Corynebacterium glutamicum BDH is from a Chinese patent application with application number 201811190689.3; The weakened fructose-1,6-bisphosphate aldolase gene is weakened by antisense RNA of fructose-1,6-bisphosphate aldolase; the antisense RNA of fructose-1,6-bisphosphate aldolase is derived from endogenous Corynebacterium glutamicum; The glutamine-6-phosphate fructose aminotransferase gene is a glutamine-6-phosphate fructose aminotransferase gene derived from Bacillus subtilis 168; The nucleoside diphosphate kinase gene is a nucleoside diphosphate kinase gene derived from endogenous Corynebacterium glutamicum; The NADH oxidase gene is derived from Lactobacillus brevis NCTC13768; The glutamine synthetase gene is a glutamine synthetase gene derived from endogenous Corynebacterium glutamicum or Lactobacillus acidophilus ATCC4356; The polyphosphate kinase gene is a polyphosphate kinase gene derived from endogenous Corynebacterium glutamicum, Escherichia coli K12 or Rhodobacter phaeroides KD131.

2. A genetically engineered bacterium with high heparosan production according to claim 1, characterized in that: The nucleotide sequence of the antisense RNA of fructose-1,6-bisphosphate aldolase derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.19; The nucleotide sequence of the glutamine-6-phosphofructotransaminase gene derived from Bacillus subtilis 168 is shown in SEQ ID NO.28; The nucleotide sequence of the nucleoside diphosphate kinase gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.33; The nucleotide sequence of the NADH oxidase gene derived from Lactobacillus brevis NCTC13768 is shown in SEQ ID NO.47; The nucleotide sequence of the glutamine synthetase gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.38; The nucleotide sequence of the glutamine synthetase gene derived from Lactobacillus acidophilus ATCC4356 is shown in SEQ ID NO.43; The nucleotide sequence of the polyphosphate kinase gene derived from endogenous Corynebacterium glutamicum is shown in SEQ ID NO.52; The nucleotide sequence of the polyphosphate kinase gene derived from Escherichia coli K12 is shown in SEQ ID NO.59; The nucleotide sequence of the polyphosphate kinase gene derived from Rhodobacter sphaeroides KD131 is shown in SEQ ID NO.

63.

3. Use of the genetically engineered bacteria according to any one of claims 1 to 2 in the production of heparosan.

4. Use of the genetically engineered bacteria according to any one of claims 1 to 2 in increasing the yield of heparosan.

5. A method for producing heparosan, characterized in that: Fermentation is carried out using the genetically engineered bacteria described in any one of claims 1-2.

Citation Information

Patent Citations

  • Genetically engineered bacteria that produce heparosan and their applications

    CN109321508B

  • Genetic engineering bacterium producing heparosan and application thereof

    CN109321508A

  • Genetically engineered bacterium for producing heparin precursor by using mixed carbon source as well as construction method and application of genetically engineered bacterium

    CN116949079A