Fructose-1, 6-diphosphate aldolase gene OsFBA3 and application of encoded protein of fructose-1, 6-diphosphate aldolase gene OsFBA3 in regulation and control of plant seed vitality

By constructing the CRISPR/Cas9 knockout vector of the rice fructose-1,6-bisphosphate aldolase gene OsFBA3, the vitality of rice seeds was regulated, and the problem of insufficient ability to germinate rice seeds and seedling construction was solved, and the cultivation of high-vibrant rice varieties was achieved.

CN120424977APending Publication Date: 2025-08-05AGRO BIOLOGICAL GENE RES CENT GUANGDONG ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510547744.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

In the prior art, there are few researches on rice fructose-1,6-diphosphate aldolase in regulating the vitality of rice seeds, and insufficient reports affecting rice seed germination and seedling construction capabilities.

Method used

By constructing the CRISPR/Cas9 knockout vector of the rice fructose-1,6-bisphosphate aldolase gene OsFBA3 and transforming Zhonghua 11, the transgenic plants with OsFBA3 gene deletion mutant were obtained, and the expression of the OsFBA3 gene was regulated to affect seed viability.

Benefits of technology

The mutation of OsFBA3 gene affects the germination of rice seeds and the construction capacity of seedlings, indicating that the OsFBA3 gene is regulating the vitality of rice seeds and laying the foundation for cultivating highly viable rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120424977A_ABST
    Figure CN120424977A_ABST
Patent Text Reader

Abstract

The invention discloses a fructose-1, 6-diphosphate aldolase gene OsFBA3 and an application of an encoded protein of the fructose-1, 6-diphosphate aldolase gene OsFBA3 in regulation and control of plant seed vigor. The nucleotide sequence of the fructose-1, 6-diphosphate aldolase gene OsFBA3 is as shown in SEQ ID No. 1, and the amino acid sequence of the encoded protein of the fructose-1, 6-diphosphate aldolase gene OsFBA3 is as shown in SEQ ID No. 2. According to the invention, a CRISPR / Cas9 knockout vector of the OsFBA3 gene is constructed, and rice Zhonghua 11 is transformed, so that an OsFBA3 gene function deletion mutant transgenic plant is obtained; results show that the mutant OsFBA3 gene affects rice seed germination and seedling establishment ability under normal conditions, which indicates that the OsFBA3 gene positively regulates rice seed vigor, and lays a foundation for cultivation of high-vigor rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more particularly to the application of rice fructose-1,6-bisphosphate aldolase gene OsFBA3 and its encoded protein in regulating plant seed vigor. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops. Approximately 50% of the world's population relies on rice as their staple food, making rice production crucial for global food security. With the increasing adoption of direct seeding in rice cultivation, the need for rapid and synchronized germination, even under submerged conditions, has become crucial.

[0003] Fructose-1,6-bisphosphate aldolase (FBA) is one of the most important isoenzymes involved in primary metabolic reactions in plants. It catalyzes the reversible aldol condensation of glyceraldehyde phosphate and dihydroxyacetone phosphate to produce fructose-1,6-bisphosphate. This reaction is a key step in carbon and sugar metabolism in organisms, directly affecting the accumulation of sucrose and starch in plants. Reports indicate that fructose-1,6-bisphosphate aldolase participates in plant stress responses and, to a certain extent, helps plants resist abiotic stresses. With the continuous advancement of rice functional genomic research, the biological functions of numerous genes have been elucidated. However, relatively few studies have been conducted on rice fructose-1,6-bisphosphate aldolase, and their effects on rice growth and development, as well as on rice seed viability, have been reported. Summary of the Invention

[0004] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art and provide the use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 and its encoded protein in regulating plant seed vigor.

[0005] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0006] The present invention constructs a CRISPR / Cas9 knockout vector for the rice fructose-1,6-bisphosphate aldolase gene OsFBA3 and transforms the japonica rice variety Zhonghua 11 to obtain transgenic plants with a loss-of-function mutant of the OsFBA3 gene. The results show that the mutant OsFBA3 gene affects the seed germination and seedling establishment abilities of rice under normal conditions, specifically by reducing the seed germination and seedling establishment abilities. That is, transgenic rice seeds with the loss-of-function mutant of the OsFBA3 gene have lower vigor than wild-type seeds. This indicates that the OsFBA3 gene positively regulates rice seed vigor, laying the foundation for breeding high-vigor rice varieties.

[0007] Therefore, the present invention provides the following new uses of the fructose-1,6-bisphosphate aldolase gene OsFBA3 and its encoded protein:

[0008] Use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in regulating plant seed vigor, wherein the nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences:

[0009] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0010] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0011] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0012] Application of fructose-1,6-bisphosphate aldolase OsFBA3 in regulating plant seed vigor. The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No. 2.

[0013] Specifically, the method regulates the expression level of the fructose-1,6-bisphosphate aldolase gene OsFBA3 or the fructose-1,6-bisphosphate aldolase OsFBA3 in plants, thereby regulating the seed vitality of plants.

[0014] Specifically, the regulation is positive regulation, that is, overexpression of OsFBA3 increases seed vigor, while knockdown / knockout / silencing of OsFBA3 decreases seed vigor.

[0015] Use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in improving plant seed vigor, wherein the nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences:

[0016] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0017] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0018] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0019] The invention discloses an application of fructose-1,6-bisphosphate aldolase OsFBA3 in improving plant seed vigor. The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No. 2.

[0020] Specifically, the method aims to increase the expression level of the fructose-1,6-bisphosphate aldolase gene OsFBA3 or fructose-1,6-bisphosphate aldolase OsFBA3 in plants, thereby improving plant seed vigor, which is specifically manifested in increasing seed germination rate, seedling rate, root length and shoot length.

[0021] Use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in creating plant varieties with high-vigor seeds, wherein the nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences:

[0022] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0023] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0024] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0025] The invention relates to the use of fructose-1,6-bisphosphate aldolase OsFBA3 in creating plant varieties with high-vigor seeds. The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No. 2.

[0026] Specifically, the method is to construct an overexpression plasmid of the OsFBA3 gene, transform plants, and screen plant varieties with high-vigor seeds.

[0027] Therefore, the present invention also provides use of a formulation for promoting the expression of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in plants in creating plant varieties with high-vigor seeds, wherein the nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences:

[0028] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0029] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0030] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0031] Also provided is a preparation for promoting the expression of fructose-1,6-bisphosphate aldolase OsFBA3 in plants for use in creating plant varieties with high-vigor seeds, characterized in that the amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No. 2.

[0032] Specifically, the preparation is a recombinant plasmid that overexpresses the OsFBA3 gene, or a recombinant bacterium containing the recombinant plasmid.

[0033] The fructose-1,6-bisphosphate aldolase gene OsFBA3 or fructose-1,6-bisphosphate aldolase OsFBA3 can also be used to create plants with reduced seed vigor for scientific research. Specifically, by knocking down / knockout / silencing OsFBA3 in plants, plants with reduced seed germination and seedling establishment are obtained.

[0034] Preferably, a CRISPR / Cas9 knockout vector of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is constructed and transformed into plants to obtain stably inherited OsFBA3 loss-of-function mutant transgenic plants, that is, plants with reduced seed germination and seedling establishment abilities are obtained.

[0035] Furthermore, the plant is a grass plant.

[0036] Furthermore, the grass plant is rice.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] The present invention provides the use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 and its encoded protein for regulating plant seed vigor. By constructing a CRISPR / Cas9 knockout vector for the OsFBA3 gene and transforming it into the rice variety Zhonghua 11, transgenic plants harboring a loss-of-function mutant of the OsFBA3 gene were obtained. Results showed that the mutant OsFBA3 gene affected rice seed germination and seedling establishment under normal conditions, specifically by reducing these abilities. This suggests that the OsFBA3 gene positively regulates rice seed vigor, laying the foundation for breeding high-vibrant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Schematic diagram of the construction of the OsFBA3 gene editing vector and sequence analysis of the mutation site of the T0 generation of the OsFBA3 knockout mutant.

[0040] Figure 2 Figures show the seed viability phenotypes and statistical data for wild-type rice Zhonghua 11 (WT) and knockout mutant rice. A: Phenotypes of wild-type (WT) and OsFBA3 knockout lines FBA3-1, FBA3-2, and FBA3-3 seeds on day 7 of germination; B: Germination rate; C: Seedling rate; D: Shoot length on day 7 of germination; E: Root length on day 7 of germination. DETAILED DESCRIPTION

[0041] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0042] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0043] Example 1 Obtaining transgenic rice with knockout of fructose-1,6-bisphosphate aldolase gene OsFBA3

[0044] 1. Construction of CRISPR / Cas9 rice knockout vector

[0045] The target sites were designed using the CRISPR target site online design website E-CRISPR (http: / / www.e-crisp.org / E-CRISP / ) Figure 1 ), used to construct the knockout vector, the corresponding primers are:

[0046] OsFBA3-U6aF: 5'-cagtGGTCTCatgcaGGATCACACCACTTAGGTGC-3';

[0047] OsFBA-U6aR: 5'-cagtGGTCTCaaaacCTTAGGTGCTGGAGGGCACC-3'.

[0048] The specific process of vector construction is as follows:

[0049] (1) Prepare a 50 μL system and perform an amplification reaction according to the following procedure. The PCR reaction system and reaction procedure are shown in Tables 1 and 2 below.

[0050] Table 1 PCR reaction system

[0051]

[0052] Table 2 PCR reaction procedure

[0053]

[0054] (2) Run 1.5% agarose gel electrophoresis at 5 v / cm for 20 minutes. Cut out the t1-t2 (193 bp) electrophoresis fragment under UV light and place it in a system for gel recovery. Dissolve the recovered DNA in a total volume of 30 μL of water (labeled as rDNAt1). After testing, ligate it to the vector. The enzyme digestion and ligation system and reaction conditions are shown in Tables 3 and 4 below.

[0055] Table 3 Enzyme digestion and ligation system

[0056]

[0057] Table 4 Enzyme digestion reaction conditions

[0058]

[0059]

[0060] (3) Transform the ligation product into competent cells. Transform 5-10 μL of the ligation product into competent E. coli (see the standard method for competent transformation of E. coli) and transform into a kanamycin-resistant plate. Incubate at 37°C for 12 hours and perform plaque PCR identification. Pick 10 plaques and simultaneously inoculate 1.5 mL of EP tube bacteria and perform PCR identification. Primers: pYL-HU-U3-CCDB-tRNA (K1) identification primer pyl-R: accggtaaggcgcgccgtagt; Pbw2-: gcgattaagttgggtaacgccaggg. The target band is a fragment of about 1000 bp. Take the bacterial solution corresponding to 1-3 positive bands, take 100 μL of sample for sequencing, and inoculate the remaining 400 μL of bacterial solution into 5-10 mL of kanamycin-resistant LB. Shake the tube and wait for the sequencing results to come out. Take a tube corresponding to the correct sequencing to extract the plasmid. Save the strain and plasmid.

[0061] 2. Agrobacterium-mediated transformation of rice CRISPR / Cas9 knockout vector

[0062] Wild-type Zhonghua 11 callus was transformed with Agrobacterium, and transgenic plants were obtained through pre-culture, infection, co-culture, screening of resistant callus tissue, differentiation, rooting, hardening and transplanting.

[0063] (1) Select plump, mature seeds, remove the shells, shake them in 2.5% NaCl solution at 180 rpm for 45 min, rinse with sterile water 3-5 times, air-dry, and plate on induction medium. Culture in the dark at 26°C for 4 weeks, subculture every 15 days.

[0064] (2) Agrobacterium containing the CRISPR / Cas9 knockout vector for the OsFBA gene was streaked onto LB medium and cultured in the dark at 28°C for 3 days.

[0065] (3) Pick a single colony and inoculate it into 5 mL of LB liquid medium containing antibiotics, and culture it at 28°C with shaking overnight.

[0066] (4) Centrifuge the fresh Agrobacterium culture solution, collect it (to a moderate concentration), and place it in AAM liquid culture medium. Incubate it in the dark at 26°C for 2 to 5 hours.

[0067] (5) Select dense callus particles (3-5 mm in diameter) for transformation. Immerse the callus particles in the prepared AAM suspension for 5 min. Discard the Agrobacterium suspension and remove excess suspension from the callus using sterile filter paper. Transfer the callus to a solid co-culture medium covered with a layer of sterile filter paper and culture in the dark at 28°C for 3 days.

[0068] (6) After co-cultivation, the calli were washed three times with sterile water, rinsed once with AAM culture medium, and air-dried. The calli were then transferred to a screening medium containing antibiotics and screened for one month.

[0069] (7) After screening, the resistant callus is transferred to a differentiation medium containing antibiotics and cultured at 26°C under light conditions until green shoots are differentiated. The seedlings are transferred to a rooting medium (containing antibiotics) for culture. Remove the seedlings from the rooting medium, wash off the remaining medium, and harden the seedlings in clean water. When white new roots grow, transplant them to a greenhouse or field.

[0070] 3. Detection of transgenic positive rice lines and screening of mutant plants

[0071] (1) Using Agrobacterium-mediated rice transgenic technology, callus tissue from Zhonghua 11 was transformed. Four independent transformed lines were obtained by hygromycin selection. Total DNA from rice leaves was extracted using the CTAB method. 2× Taq Master Mix and hygromycin detection primers hpt-t / F and hpt-t / R were used. The sequences are as follows:

[0072] hpt-t / F: 5'-GATGTTGGCGACCTCGTATTGG-3';

[0073] hpt-t / R: 5'-CGTGCTTCAGCTTCGATGTAGGAG-3'.

[0074] PCR amplification was performed according to the following system: DNA template 0.5 μL, 2× Taq Master Mix 10 μL, SP1 0.5 μL, SP2 0.5 μL, ddH2O 8.5 μL;

[0075] PCR program settings: 95°C for 3 min; 95°C for 15 s, 56°C for 20 s, 72°C for 1 min, 72°C for 5 min, 30 cycles; 16°C Hold.

[0076] After PCR, the amplified products were subjected to 1% agarose gel electrophoresis to observe whether the amplification results corresponding to each plant produced a band of about 600 bp. If the target band was produced, it indicated that the knockout vector had been integrated into the chromosome of the plant corresponding to the template DNA.

[0077] (2) Identification of mutant plant types

[0078] Mutant detection primers FBA-F and FBA-R (FBA-F: 5'-GATCGGATGACGTGCATGTTT-3'; FBA-R: 5'-CACCGGCCTCGTAGTACTTG-3') were designed using Primer Premier 5 upstream and downstream of the target site. DNA from positive plants was extracted, and PCR reactions were performed using 2× Gold Mix (green) and primers FBA-F and FBA-R according to the following system:

[0079] A 25 μL PCR reaction system consisted of 0.5 μL DNA template, 22.5 μL 2× Gold Mix, 1 μL FBA-F, and 1 μL FBA-R. The PCR program was as follows: 98°C for 2 min; 98°C for 10 s, 56°C for 15 s, 72°C for 10 s, 72°C for 7 min; and 16°C for 10 min. The second step was repeated for 30–35 cycles. After PCR amplification, the target band was purified using a kit and ligated with the T19simple vector. The resulting fragments were then transformed into Escherichia coli DH5α. Ten clones were selected from each strain and sent to Qingke Biotechnology (Shanghai) Co., Ltd. for sequencing. Sequencing results of the mutants and wild-type strains were aligned using Snapgene software.

[0080] Existing reports divide mutants obtained by Crispr / Cas9 technology into three categories: bi-allelic homozygous mutations, bi-allelic heterozygous mutations, and single chromosome mutations. The results showed that three bi-allelic homozygous mutant strains (FBA3-1, FBA3-2, and FBA3-3) were obtained in transgenic T2. The mutation types of these strains include base deletions and base additions ( Figure 1 The biallelic mutant FBA3-1 had a 2 bp deletion, while both FBA3-2 and FBA3-3 had a 1 bp gain.

[0081] Example 2 Observation of seed vigor phenotype of CRISPR / Cas9 knockout transgenic rice

[0082] After the seeds were harvested and mature, seed germination experiments were performed with WT, FBA3-1, FBA3-2 and FBA3-3. First, the freshly harvested seeds were placed in an oven at 42 ° C for 7 days to break the seed dormancy. The germination experiment of seeds under normal and direct seeding conditions was referred to (He DL, Han C, Yao JL, Shen SH, Yang PF. (2011). Constructing themetabolic and regulatory pathways in germinating rice seeds through proteomic approach. Proteomics, 11: 2693-2713). The seeds were placed in a germination box (12 cm × 12 cm) padded with three layers of moist filter paper and germinated at a constant temperature of 28 ° C. The light was set to 16 h light / 8 h dark, and the light flux was 350 μmol·m -2 s -1 Each treatment was repeated three times, with 30 seeds per repeat. The germination standard was that the radicle of the seed broke through the seed coat by 2mm; when the root length was greater than or equal to the seed length and the bud turned green, the seed was defined as a seedling. After germination, 10 seedlings were randomly selected per box and the seedling height and root length were measured. The results are as follows Figure 2 As shown, after 7 days of germination under normal conditions, the knockout lines FBA3-1, FBA3-2, and FBA3-3 exhibited significantly reduced germination and seedling establishment rates compared to the wild type, and their root and shoot lengths were also shorter than those of the wild type. These results suggest that the OsFBA3 gene positively regulates seed vigor in rice. Gene expression can increase seed germination rate and promote radicle, plumule, and seedling growth. Overexpression of the OsFBA3 gene can be constructed and transformed into plants to screen for high-vibrant seed varieties. Alternatively, knocking down / knockout / silencing OsFBA3 in plants can be used to generate plants with reduced seed germination and seedling establishment for scientific research.

Claims

1. Application of fructose-1,6-bisphosphate aldolase gene OsFBA3 in regulating plant seed vigor, characterized in that: The nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

2. Application of fructose-1,6-bisphosphate aldolase OsFBA3 in regulating plant seed vigor, characterized in that: The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No.

2.

3. The use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in improving plant seed vigor, characterized in that: The nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

4. Use of fructose-1,6-bisphosphate aldolase OsFBA3 in improving plant seed vigor, characterized in that: The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No.

2.

5. Use of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in creating plant varieties with high-vigor seeds, characterized in that: The nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

6. Use of fructose-1,6-bisphosphate aldolase OsFBA3 in creating plant varieties with high-vigor seeds, characterized in that: The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No.

2.

7. Use of a preparation for promoting the expression of the fructose-1,6-bisphosphate aldolase gene OsFBA3 in plants for creating plant varieties with high-vigor seeds, characterized in that: The nucleotide sequence of the fructose-1,6-bisphosphate aldolase gene OsFBA3 is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

8. Use of a preparation for promoting the expression of fructose-1,6-bisphosphate aldolase OsFBA3 in plants for creating plant varieties with high-vigor seeds, characterized in that: The amino acid sequence of the fructose-1,6-bisphosphate aldolase OsFBA3 is shown in SEQ ID No.

2.

9. The use according to any one of claims 1 to 8, characterized in that: The plant is a grass plant.

10. The use according to claim 9, characterized in that: The grass plant is rice.