Double-targeting exosome as well as construction method and application thereof

Abstract

The invention discloses a double-targeting exosome as well as a construction method and application thereof, the double-targeting exosome is obtained by co-incubation of a targeting exosome with spytag and a targeting protein with spycatcher, and the double-targeting exosome is obtained by connection of the spytag and the spycatcher. The construction method comprises the following steps: constructing a target exosome with spytag, and constructing a target protein with spycatcher; the preparation method comprises the following steps: co-incubating a target exosome of spytag and a target protein with splatcher, so as to obtain the double-target exosome. The lysosome targeting degradation protein based on the double-targeting engineered exosome can reduce the toxic and side effects of compound small molecules on cells, and has better biocompatibility.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a dual-targeting exosome and a construction method and application thereof. Background Art

[0002] Cell membrane-bound proteins play important roles in regulating cell functions and are therefore crucial in the treatment of cancer and immune-related diseases. Methods such as reducing the effective abundance of membrane proteins, including functional inhibition, sequestration, downregulation or degradation, will facilitate therapeutic strategies targeting membrane protein targets and thereby improve human health.

[0003] Protein degradation chimeras have become a drug approach superior to traditional protein inhibitors due to their effective therapeutic properties. To date, various targeted protein degradation strategies, including proteolytic targeting chimeras (PROTACs) and lysosomal targeting chimeras (LYTACs), have become important technologies for addressing diseases caused by abnormal protein expression. The lysosomal targeted degradation strategy uses glycan-antibody conjugates to simultaneously bind to the lysosomal transport 6-mannose-6-phosphate receptor (CI-M6PR) and POIs for the lysosomal degradation pathway, that is, the glycopeptide ligand of CI-M6PR binds to the antibody to transport membrane-associated proteins to the lysosome for degradation. The bispecific WNT and BMP signaling-disabling R-spondin (RSPO) can target different transmembrane receptors (LGR, BMPR1A) of ZNRF3 / RNF43, and its FU1, FU2, and TSP1 domains neatly separate and bind to ZNRF3 / RNF43, LGR, and BMP1RA, respectively, so RSPO is designed as a LYTAC for targeting protein degradation to lysosomes by ZNRF3 / RNF43.

[0004] Exosomes, as endogenous nanocarriers, can mediate intercellular communication. Exosomes are characterized by a phospholipid bilayer and abundant tetraspanin CD9, which can directly fuse the membrane with target cells and promote cellular delivery of therapeutic drugs. Compared with the high immune reactivity exhibited by viruses and synthetic nanocarriers, endogenous exosomes show significantly reduced immunogenicity. Therefore, exosomes have become a new and attractive form of nanomedicine. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art, such as the difficulty in sequence expression caused by constructing engineered exosomes through traditional plasmid expression, and the high toxicity and biocompatibility caused by the targeted degradation of PD-L1 by traditional small molecule compounds. Provided is a dual-targeted exosome and its construction method and application. Dual-targeted exosomes are connected based on spytag and spycatcher to construct a dual-targeted exosome-mediated cell membrane protein degradation method. The SpyCatcher-SpyTag system is based on a modified domain of the surface protein of Streptococcus pyogenes (SpyCatcher), which can recognize a homologous 13 amino acid peptide (SpyTag). After recognition, the two form a covalent isopeptide bond between the lysine side chain in SpyCatcher and the aspartic acid side chain in SpyTag. This method achieves dual targeting function by incubating different spytag engineered exosomes expressing targets with spycatcher proteins. At the same time, LYTAC or ubiquitination degradation pathways are used to target and degrade PDL1 / HER2 respectively, achieving a more biocompatible way to degrade specific proteins.

[0006] To achieve the above purpose, the present invention provides a method for constructing dual-targeted engineered exosomes, by constructing plasmids with different targeting proteins with spytag to express them on exosomes, and then constructing plasmids with different targeting proteins with spycatcher to express and purify them in bacteria. The exosomes are incubated and connected with the purified proteins to achieve the construction of dual-targeted exosomes. The engineered exosomes are then incubated with cells at different concentrations for different times, and the lysosome-targeted chimera method or the ubiquitination degradation method is used to mediate the degradation of PD-L1 / HER2 proteins on the cell surface. The degree of degradation of PD-L1 or HER2 is evaluated by Western blot technology.

[0007] The specific method is:

[0008] A dual-targeted exosome, wherein the dual-targeted exosome is co-incubated with a targeted exosome with a spytag and a targeted protein with a spycatcher, and the dual-targeted exosome is obtained by connecting the spytag with the spycatcher;

[0009] The targeted exosomes with spytag are constructed by expressing a targeted plasmid with spytag in cells, wherein the targeted plasmid with spytag is a plasmid with spytag targeting PDL1 or a plasmid with spytag targeting HER2; the sequence of the plasmid with spytag targeting PDL1 is shown in SEQ ID NO.1; the sequence of the plasmid with spytag targeting HER2 is shown in SEQ ID NO.2. The targeted degradation protein can be selected from other options, not limited to PDL1 and HER2, and can be other proteins highly expressed by tumor cells.

[0010] The above-mentioned dual-targeted exosomes, further, the targeting protein with spycatcher is separated by expressing a targeting plasmid with spycatcher in cells, and the targeting plasmid with spycatcher is one of a plasmid with spycatcher targeting IGF2 protein, a plasmid with spycatcher targeting ZNRF3 protein, and a plasmid with spycatcher targeting CXCR7 protein;

[0011] The sequence of the plasmid targeting IGF2 protein with spycatcher is shown in SEQ ID NO.3;

[0012] The sequence of the plasmid targeting ZNRF3 protein with spycatcher is shown in SEQ ID NO.4;

[0013] The sequence of the plasmid targeting CXCR7 protein with spycatcher is shown in SEQ ID NO.5.

[0014] There are other options for targeted degradation proteins, not limited to IGF2, ZNRF3, and CXCR7. These three proteins are lysosome-targeted proteins and are not proteins to be degraded.

[0015] Based on a general technical concept, the present invention also provides a method for constructing the dual-targeting exosomes, which comprises the following steps:

[0016] S1, construct targeted exosomes with spytag and target protein with spycatcher;

[0017] S2. Co-incubate the spytag-targeted exosomes and the spycatcher-targeted protein to obtain dual-targeted exosomes.

[0018] The above construction method, further, the construction of targeted exosomes with spytag in S1 is specifically as follows:

[0019] SA-1, packaging the targeting plasmid with spytag into lentivirus to obtain lentivirus;

[0020] SA-2, infecting 293T cells with the lentivirus and collecting the cell supernatant;

[0021] SA-3. Extracting exosomes from the cell supernatant by ultracentrifugation.

[0022] The above construction method, further, the construction of the targeting protein with spycatcher described in S1 is specifically:

[0023] SB-1, insert the targeting plasmid with spycatcher into BL21 strain for expression;

[0024] SB-2, after the bacteria were ultrasonically disrupted, the supernatant was collected by centrifugation and purified by nickel column;

[0025] SB-3, the purified protein was dialyzed.

[0026] In the above construction method, further, the co-incubation in S2 is specifically: incubating the connection at 4°C overnight.

[0027] Based on a general technical concept, the present invention also provides an application of the dual-targeting exosomes in the preparation of a drug that mediates cell membrane protein degradation.

[0028] The above application, further, the application is specifically: incubating the dual-targeted exosomes with cells to achieve cell degradation. (The dual-targeted exosomes target two different proteins in the same cell)

[0029] In the above application, further, the cells are breast cancer cells.

[0030] In the above application, further, the concentration of the dual-targeting exosomes is 0.1 μg / μL to 0.3 μg / μL, the incubation time is 3 h to 24 h, and the incubation temperature is 37°C.

[0031] Compared with the prior art, the advantages of the present invention are:

[0032] The present invention provides a new dual-targeted exosome construction method; based on the lysosome-targeted degradation protein of dual-targeted engineered exosomes, compared with the lysosome-targeted degradation protein research in the prior art, the present invention utilizes exosomes to reduce the toxic and side effects of small molecule compounds on cells and has better biocompatibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0034] Figure 1 This is a schematic diagram of the method for constructing a dual-targeted exosome-mediated cell membrane protein degradation method based on the connection between spytag and spycatcher in the present invention.

[0035] Figure 2 This is the confocal imaging image in Experiment 1 of the present invention.

[0036] Figure 3 This is a flow cytometry result diagram in Experiment 2 of the present invention.

[0037] Figure 4 This is the result of the transmission electron microscopy analysis of the exosome morphology in Experiment 3 of the present invention.

[0038] Figure 5 This is the NTA particle size analysis result of exosomes in Experiment 3 of the present invention.

[0039] Figure 6 This is the WB verification result of exosomes in Experiment 3 of the present invention.

[0040] Figure 7 This is the SDS-PAGE gel image of protein purification in Experiment 4 of the present invention.

[0041] Figure 8 This is a Western blot image of the exosomes carrying spytag-aPDL1 in Experiment 5 of the present invention after incubation with spcatcher-FU1-FU2 at 4°C overnight.

[0042] Fig. 9 This is the confocal imaging of endocytosis of single-target and dual-target exosomes after incubation with MDA-MB-231 for 3-4 hours in Experiment 6 of the present invention.

[0043] Fig.10 These are the confocal imaging and flow cytometry images of endocytosis of single-target and dual-target exosomes after incubation with RAW.264.7 for 6 hours in Experiment 6 of the present invention. DETAILED DESCRIPTION

[0044] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0045] The materials, reagents and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples are all conventional methods in the art unless otherwise specified.

[0046] The ultraspeed refrigerated centrifuge was purchased from Thermo Fisher Scientific, the flow cytometer was purchased from BD, and the ultra-high resolution confocal microscope was purchased from ZEISS.

[0047] The plasmids used in this article were synthesized by Anhui General Biotechnology Co., Ltd. and GenScript Biotech Co., Ltd., respectively. Bovine serum albumin (BSA) was purchased from Solarbio. Dulbecco's Modified Eagle Medium (DMEM) and 1*Phosphate Buffered Saline (PBS) were purchased from Servicebio. Fetal bovine serum (FBS) was purchased from Biological Industries. Trypsin was purchased from Gbico. Penicillin-streptomycin was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd. BCA protein quantification kit was purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd. Myc mouse monoclonal antibody was purchased from Cell signaling Technology, His mouse monoclonal antibody was purchased from Yisheng Biotechnology Co., Ltd., horseradish peroxidase-labeled goat anti-mouse IgG (H+L), and His nickel column were purchased from Beyotime Biotechnology Co., Ltd. jetPrime transfection reagent was purchased from Polyplus, and recombinant Anti-CD63 antibody was purchased from abcam. Other chemical reagents were purchased from Sangon Biotechnology Co., Ltd. 293T cells, MDA-MB-231 cells and RAW264.7 cells were purchased from Procell Life Science & Technology Co., Ltd (Wuhan, China). BL21 competent cells were purchased from Anhui General Biotechnology Co., Ltd.

[0048] Example 1

[0049] A spytag-anti PDL1 scfv engineered exosome of the present invention expresses a plasmid for expressing spytag anti-PDL1 scfv in 293T cells, collects the cell supernatant, and extracts the exosomes by ultracentrifugation. Specifically, the following steps are included:

[0050] (1) A plasmid for expressing spytag-anti PDL1 scfv was constructed, the DNA sequence of which is shown in SEQ ID NO.1, specifically:

[0051]

[0052] (2) 2 μg of the plasmid for expressing spytag-anti PDL1 scfv was mixed with 1.5 μg PAX, 0.5 μg PMD, 8 μL jetPrime, and 400 μL jetPrime buffer for 10 min to obtain a mixed system.

[0053] (3) Add the mixed system to the complete medium of 293T cells and incubate the 293T cells at 37°C for 5 h. After replacing the medium with complete medium and culturing for 48 h, collect the supernatant.

[0054] (4) The collected supernatant was filtered through a 0.45 μm filter and used to infect 293T cells for 48 hours. The transfection effect was observed by flow cytometry and confocal imaging.

[0055] (5) Extraction of exosomes: Collect the culture medium of 293T cells transfected with spytag-anti PDL1 scfv and extract exosomes by ultracentrifugation. The specific steps are as follows:

[0056] 5.1. Collect the supernatant of the 293T cell culture medium that stably expresses the plasmid and centrifuge at 4200 rpm and 4°C for 10 min. Use a syringe to draw the supernatant after centrifugation, filter it with a 0.22 μm filter head and put it into an ultracentrifuge tube. Use a Beckman ultracentrifuge with a SW32Ti horizontal rotor and centrifuge it at 120,000 g and 4°C for 80 min.

[0057] 5.2. Slowly extract the supernatant of the solution after centrifugation. When a small amount of liquid remains at the bottom, add 1 ml of PBS buffer and blow to resuspend. Then add it to an ultracentrifuge tube and use a Beckman ultracentrifuge with an NVT 100 fixed-angle rotor to centrifuge for a second time at 120,000 g and 4°C for 80 min.

[0058] 5.3. Slowly extract the supernatant from the centrifuged solution. When a small amount of liquid remains at the bottom, add 100 μL PBS buffer, pipette until resuspended, and store at 4°C.

[0059] Experiment 1: Confocal microscopy imaging characterization.

[0060] After the cells of Example 1 were cultured in a confocal dish, they were rinsed once with PBS buffer, 1 μL Hoechest was mixed with 1 ml complete culture medium, and the cells were incubated at 37° C. for 10 min. The expression of fluorescent protein in the cells was observed under excitation at 405 nm and 560 nm.

[0061] Figure 2The structure was characterized by confocal microscopy imaging. The fluorescence of the mcherry channel showed that mcherry was expressed on the 293T cell membrane, indicating that the plasmid had a certain expression rate on the 293T cell membrane.

[0062] Experiment 2: Flow cytometry characterization.

[0063] The cells after passage in Example 1 were digested and centrifuged, washed once with PBS buffer, and then 500 μL of PBS buffer was added and flow cytometry was performed under 560 excitation.

[0064] Figure 3 The figure shows the characterization results of spytag-anti PDL1 293T cells transfected with lentivirus. As shown in the figure, spytag-anti PDL1 transfected with lentivirus has good expression in 293T cells.

[0065] Example 2

[0066] A Spytag-anti Her2 scfv engineered exosome of the present invention expresses a plasmid for expressing Spytag-anti Her2 scfv in 293T cells, collects the cell supernatant, and extracts the exosomes by ultracentrifugation.

[0067] (1) A plasmid for expressing spytag-anti HER2 scfv was constructed, the DNA sequence of which is shown in SEQ ID NO.2, specifically:

[0068]

[0069] (2) 2 μg of the plasmid for expressing Spytag-anti HER2 scfv was mixed with 1.5 μg PAX, 0.5 μg PMD, 8 μL jetPrime, and 400 μL jetPrime buffer for 10 min to obtain a mixed system.

[0070] (3) Add the mixed system to the complete medium of 293T cells and incubate the 293T cells at 37°C for 5 h. After replacing the medium with complete medium and culturing for 48 h, collect the supernatant.

[0071] (4) The collected supernatant was filtered through a 0.45 μm filter and used to infect 293T cells for 48 hours.

[0072] (5) Extraction of exosomes: The culture medium of 293T cells transfected with spytag-anti HER2 scfv was collected, and exosomes were extracted by ultracentrifugation (the steps were the same as those in Example 1).

[0073] Example 3

[0074] A protein targeting IGF2 with a spycatcher (spycatcher-IGF2 protein), the preparation method of which comprises the following steps:

[0075] (1) Constructing a plasmid for expressing spycatcher-IGF2, the DNA sequence of which is shown in SEQ ID NO.3, specifically:

[0076] .

[0077] (2) The method for purifying spycatcher-IGF2 protein is as follows: the plasmid for expressing spycatcher-IGF2 is expressed in BL21 competent cells, the bacteria are ultrasonically disrupted, and the protein is purified and extracted using a His nickel column. The specific steps are as follows:

[0078] 2.1. Dissolve the spycatcher-IGF2 plasmid powder in 100 μL ddH 2 O to obtain a mixed solution. Take 2 μL of the mixed solution and add it to 20 μL BL21 competent cells and incubate on ice for 30 minutes, then incubate at 42°C for 90 seconds and then incubate on ice for 5 minutes. Then add 500 μL LB medium and incubate in a shaker at 37°C and 200 rpm for 1 hour. After the incubation, centrifuge at 2000×g for 3 minutes, discard 400 μL of the supernatant, resuspend the precipitate in the remaining liquid, apply to the plate, and culture in a 37°C biochemical incubator overnight.

[0079] 2.2. Pick a single colony and place it in 20 ml LB medium. Add 1000× ampicillin antibiotics and culture it in a shaker at 37°C and 200 rpm for 12 h. Then transfer all 20 ml of the bacterial solution to 600 ml LB and add 1000× ampicillin antibiotics. After culturing it in a shaker at 37°C and 200 rpm for 3 h, add 0.5 mM IPTG and induce it in a shaker at 18°C ​​and 200 rpm for 16 to 18 h.

[0080] 2.3. Centrifuge the induced bacterial solution at 4200 rpm and 4°C for 10 min, discard the supernatant, add 30 ml of non-denaturing lysis buffer (non-denaturing lysis buffer is prepared by yourself, the formula is: 0 mM NaH2PO4, 150 mM NaCl, 50 mM Tris, 0.1% triton×100, 0.02% tween-20, adjust pH = 8.0) and PMSF (phenylmethylsulfonyl fluoride), ultrasonically disrupt for 30 min, then centrifuge at 150000 rpm and 4°C for 10 min, collect the supernatant, filter with a 0.45 μm filter head, add activated His nickel column and incubate overnight.

[0081] 2.4. Add the supernatant incubated with the nickel column to the empty column tube and collect the supernatant. Wash the nickel column in the empty column tube with 4 column volumes of non-denaturing washing solution (50 mM NaH 2 PO 4 , 150 mM NaCl, 50 mM Tris, 2 mM imidazole, 0.1% triton×100, 0.02% tween-20, pH = 8.0) for 10 times, and the collected liquids were recorded as A1-A10. The nickel column was then eluted with 2 column volumes of non-denaturing eluent (50 mM NaH 2 PO 4 , 150mM NaCl, 50mM Tris, 50mM imidazole, 0.1% triton×100, 0.02% tween-20, adjust pH=8.0) and wash 10 times, collecting the liquids and recording them as B1-B10. Run the above liquid A and liquid B on the gel to see if there is a target band.

[0082] 2.5. Collect the liquid corresponding to the relatively pure target band, add the liquid to the dialysis bag, dialyze with 2L 1×PBS overnight, collect the liquid in the dialysis bag, filter with a 0.22μm filter head, and run WB to confirm the protein band. Add 5% glycerol to the purified protein, divide it into epoxies and store it at -80℃ for a long time.

[0083] Example 4

[0084] A spycatcher-targeted CXCR7 protein (spcatcher-FU1-FU2), the construction method of which is the same as that in Example 3. The plasmid for expressing spycatcher-FU1-FU2 has a DNA sequence as shown in SEQ ID NO.4, specifically:

[0085] ATGAATCCGATCTGCAAGGGTTGCCTGAGCTGCAGCAAGGACAATGGTTGCAGCCGTTGCCAACAAAAACTGTTCTTCTTTCTGCGTCGCGAGGGTATGCGTCAGTACGGTGAATGCCTGCACAGCTGCCCGAGCGGTTACTATGGCCACCGTGCGCCGGACATGAACCGTTGCGCGCGTTGCCGTATCGAGAACTGCGACAGCTGCTTCAGCAAGGATGCGTGCACCAAGTGCAAAGTGGGTTTCTATCTGCACCGTGGCCGTTGCTTTGATGAATGCCCGGACGGTTTTGCGCCGCTGGAGGAGACCATGGAGTGCGTTGAAGGCTGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGCCATGGTTGATACCTTATCAGGTTTATCAAGTGAGCAAGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCATATTAAATTCTCAAAACGTGATGAGGACGGCAAAGAGTTAGCTGGTGCAACTATGGAGTTGCGTGATTCATCTGGTAAAACTATTAGTACATGGATTTCAGATGGACAAGTGAAAGATTTCTACCTGTATCCAGGAAAATATACATTTGTCGAAACCGCAGCACCAGACGGTTATGAGGTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGCAAAGCAACTAAAGGTGACGCTCATATTCTCGAGCGCGGATCCTATCCGTATGATGTGCCGGACTATGCGGGCGGTAGCGGTGGTAGCGAGTTTCACCACCACCACCACCACTGA。、

[0086] Example 5

[0087] A protein for expressing spycatcher-CXCL12, the construction method of which is consistent with Example 3, wherein the DNA sequence is shown in SEQ ID NO.5, specifically:

[0088] ATGAAACCAGTATCACTAAGTTATAGGTGTCCCTGCCGTTTTTTCGAGAGCCATGTGGCT

[0089] CGCGCAAATGTTAAACACTTGAAGATCCTGAAACCCCGAACTGCGCGTTACAGATCG

[0090] TGGCCCGTCTGAAGAACAACAACCGTCAGGTTGTATTGACCCGAAACTGAAGTGGAT

[0091] TCAAGAGTACCTGGAAAAAGCGTTGAATGGCGGCGGCGGCAGCGGCGGCGGCGGCAG

[0092] CGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGCCATGGTTGATACCTTATCAGGT

[0093] TTATCAAGTGAGCAAGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCA

[0094] TATTAAATTCTCAAAACGTGATGAGGACGGCAAAGAGTTAGCTGGTGCAACTATGGAGT

[0095] TGCGTGATTCATCTGGTAAAACTATTAGTACATGGATTTCAGATGGACAAGTGAAAGATT

[0096] TCTACCTGTATCCAGGAAAATATACATTTGTCGAAAACCGCAGCACCAGACGGTTATGAG

[0097] GTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGCAA

[0098] AGCAACTAAAGGTGACGCTCATATTCTCGAGCGCGGATCCTATCCGTATGATGTGCCGGACTATGCGGGCGGTAGCGGTGGTAGCGAGTTTCACCACCACCACCACCACTGA.

[0099] Example 6

[0100] A dual-targeted exosome-mediated cell membrane protein degradation method based on the connection between spytag and spycatcher, in which spytag-anti PDL1 scfv engineered exosomes and spycatcher-IGF2 protein are co-incubated (incubated at 4°C for more than 12 hours) to obtain dual-target exosomes with the function of targeting both PDL1 and IGF2; the LYTAC / ubiquitination degradation pathway is used to target and degrade cell surface proteins.

[0101] The specific steps include:

[0102] (1) Cell culture: MDA-MB-231 cells or RAW264.7 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 27°C and 5% CO 2 Cultivated under conditions.

[0103] (2) The dual-target exosomes were dissolved in complete culture medium at 0.2 μg / μL and incubated at 37°C for 3 h and 6 h, respectively.

[0104] (3) After rinsing with PBS buffer, 2 μL Hoechest and 0.1 μL Lysotracker were diluted in 1 ml complete culture medium, and the cells were incubated at 37°C for 30 min and observed by confocal imaging.

[0105] Example 7

[0106] A method for constructing dual-targeted exosome-mediated cell membrane protein degradation based on the connection between spytag and spycatcher, incubating spytag-anti PDL1 scfv engineered exosomes and spycatcher-ZNRF3 protein together (incubating at 4°C for more than 12 hours) to obtain dual-target exosomes with the function of targeting both PDL1 and ZNRF3; using LYTAC / ubiquitination degradation pathway to target and degrade cell surface proteins. The details are the same as Example 6.

[0107] Example 8

[0108] A method for constructing dual-targeted exosome-mediated cell membrane protein degradation based on the connection of spytag and spycatcher, incubating spytag-anti PDL1 scfv engineered exosomes and spcatcher-FU1-FU2 proteins together (incubating at 4°C for more than 12 hours) to obtain dual-target exosomes with the function of targeting PDL1 and CXCR7; using LYTAC / ubiquitination degradation pathway to target and degrade cell surface proteins. The specifics are the same as in Example 6.

[0109] Example 9

[0110] A method for constructing dual-targeted exosome-mediated cell membrane protein degradation based on the connection between spytag and spycatcher, incubating Spytag-anti Her2 scfv engineered exosomes and spycatcher-IGF2 protein together to obtain dual-target exosomes with the function of targeting both HER2 and IGF2; using LYTAC / ubiquitination degradation pathway to target and degrade cell surface proteins. The details are the same as Example 6.

[0111] Example 10

[0112] A method for constructing dual-targeted exosome-mediated cell membrane protein degradation based on the connection between spytag and spycatcher, incubating Spytag-anti Her2 scfv engineered exosomes and spycatcher-ZNRF3 protein together to obtain dual-target exosomes with the function of targeting both HER2 and ZNRF3; using LYTAC / ubiquitination degradation pathway to target and degrade cell surface proteins. The details are the same as Example 6.

[0113] Embodiment 11

[0114] A method for constructing dual-targeted exosome-mediated cell membrane protein degradation based on the connection between spytag and spycatcher, incubating Spytag-anti Her2 scfv engineered exosomes and spcatcher-FU1-FU2 proteins together to obtain dual-target exosomes with the function of targeting both HER2 and CXCR7; and using LYTAC / ubiquitination degradation pathway to target and degrade cell surface proteins. The details are the same as in Example 6.

[0115] Figure 1 Schematic diagrams of embodiments 6 to 10 of the present invention. It can be seen from the figure that after incubating the dual-targeted exosomes with tumor cells, the two targets on the exosomes bind to the IGF2 / ZNRF3 / CXCR7 and PDL1 / HER2 proteins on the tumor cells respectively, and the PDL1 / HER2 is brought into the lysosome for degradation through the action of the IGF22 / ZNRF3 / CXCR7 protein targeting the lysosome.

[0116] Because the exosomes themselves carry spytag-apdl1 / aher2, the spytag can only combine with proteins carrying spycatcher, and the principle of dual-target construction is to target a degradation protein and a lysosome-targeted protein to exercise the function of LYTAC. Therefore, spycatcher-IGF2 / FU1-FU2 / CXCL12 can cross-combine with spytag-apdl1 / aher2 exosomes to form dual-targeted exosomes.

[0117] Experiment 3: NTA, transmission electron microscopy and Western Blot were used to verify the morphology, particle size and expressed protein markers of exosomes extracted by the above extraction method.

[0118] 3.1. NTA particle size analysis was performed on the exosomes extracted in Examples 1 to 5.

[0119] The specific method for analyzing the morphology of exosomes by transmission electron microscopy is as follows: dilute the extracted exosomes (exosomes and PBS are diluted at a ratio of 1:2), take 10 μL of the diluted sample and drop it on the copper grid, dry it under an incandescent lamp for 10 minutes, and repeat this operation 3 times. Take 10 μL of 1% phosphotungstic acid negative staining, and repeat this operation once. After rinsing the copper grid with PBS, dry it under an incandescent lamp overnight, and analyze the image.

[0120] Figure 4 The results of the analysis of exosome morphology using transmission electron microscopy; Figure 5 The results of NTA particle size analysis. NTA and TEM images show that the particle size and morphology of exosomes extracted by ultracentrifugation are normal.

[0121] 3.2. Perform WB verification on the extracted exosomes.

[0122] The total protein of the extracted exosomes was quantified using the BCA protein quantification kit. The specific method is: add 5× loading buffer to a certain amount of extracted exosomes and incubate at 100℃ for 10min. The sample was first run at 70V for 20min in a 12% SDS-PAGE protein gel, and then run at 150V for 60min. Next, transfer the membrane at 300mA for 80min. Block with 5% BSA for 5 hours, wash 3 times with 1×TBST, and incubate with anti-CD63 and anti-myc primary antibodies at 4℃ overnight. Wash the membrane after incubation with the primary antibody 3 times with 1×TBST, each time for 10min. Incubate with the secondary antibody at room temperature for 2h and then wash 3 times with 1*TBST. Add ECL developer to the membrane for exposure and development.

[0123] Figure 6The WB verification results show that the left one is spytag-anti PDL1 scfv engineered exosomes, and the right one is Spytag-anti PDL1 scfv+spcatcher-FU1-FU2 engineered exosomes. Both express CD63 protein and belong to exosomes. The expression of Myc band indicates that the exosomes are successfully engineered.

[0124] Experiment 4: Verify protein purification by SDS-PAGE.

[0125] The spycatcher-IGF2 protein of Example 3 and the spcatcher-FU1-FU2 protein of Example 4 were verified by SDS-PAGE.

[0126] Figure 7 This is the SDS-PAGE gel image of protein purification. According to the protein molecular weight, it can be seen from the gel image that FU1-FU2 protein is expressed at 30 kDa and IGF2 protein is expressed at 23 kDa.

[0127] Experiment 5: Western blot verified the successful connection between exosomes and proteins.

[0128] After the proteins purified in Example 6 and Example 7 were incubated with exosomes at 4 degrees Celsius overnight, Western blot was used to verify the change in the position of the His band.

[0129] Figure 8 This is a Western blot image of exosomes with spytag-aPDL1 and spcatcher-FU1-FU2 after incubation at 4°C overnight. It can be seen from the figure that after the protein with the His tag is connected to the exosomes, a new band appears at 75kDa, which corresponds to the total molecular weight after the two are successfully connected, proving that the connection is successful.

[0130] Experiment 6: Observe its endocytosis effect through confocal microscopy imaging.

[0131] The dual-target exosomes constructed in Example 6 and Example 7 were incubated with MDA-MB-231 or RAW264.7 cells, and the co-localization effect of exosomes and cell lysosomes at different concentrations was observed by confocal microscopy, and the mCherry fluorescence level of the experimental group relative to the blank group was observed by flow cytometry to determine the endocytosis of exosomes.

[0132] Fig. 9 The images of single-target and dual-target exosomes after incubation with MDA-MB-231 for 3-4 hours. It can be seen from the figure that the exosomes have entered the cells, and the dual-target exosomes have a better co-localization effect with the lysosomes due to targeting ZNRF3 / IGF2R protein.

[0133] Fig.10 The confocal imaging and flow cytometry of the endocytosis of single-target and dual-target exosomes after incubation with RAW.264.7 for 6 hours. It can be seen from the figure that the exosomes all enter the cells, and the dual-target exosomes have a better co-localization effect with the lysosomes due to targeting ZNRF3 / IGF2R protein. The flow cytometry shows the expression of mcherry fluorescence carried by the exosomes in the cells, and it can be concluded that both single-target and dual-target exosomes are internalized into the cells.

[0134] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A dual-targeting exosome, characterized in that: The dual-targeted exosomes are co-incubated with targeted exosomes with spytag and targeted proteins with spycatcher, and the dual-targeted exosomes are obtained by connecting the spytag and the spycatcher.

2. The dual-targeting exosome according to claim 1, characterized in that The targeted exosomes with spytag are constructed by expressing a targeted plasmid with spytag in cells, wherein the targeted plasmid with spytag includes a plasmid with spytag targeting PDL1 or a plasmid with spytag targeting HER2; the sequence of the plasmid with spytag targeting PDL1 is shown in SEQ ID NO.1; the sequence of the plasmid with spytag targeting HER2 is shown in SEQ ID NO.

2.

3. The dual-targeting exosome according to claim 1, characterized in that The targeting protein with spycatcher is separated by expressing the targeting plasmid with spycatcher in cells, and the targeting plasmid with spycatcher includes one of a plasmid with spycatcher targeting IGF2 protein, a plasmid with spycatcher targeting ZNRF3 protein, and a plasmid with spycatcher targeting CXCR7 protein; The sequence of the plasmid targeting IGF2 protein with spycatcher is shown in SEQ ID NO.3; The sequence of the plasmid targeting ZNRF3 protein with spycatcher is shown in SEQ ID NO.4; The sequence of the plasmid targeting CXCR7 protein with spycatcher is shown in SEQ ID NO.

5.

4. A method for constructing dual-targeting exosomes according to any one of claims 1 to 3, characterized in that: The construction method comprises the following steps: S1. Construction of targeted exosomes with spytag and targeted proteins with spycatcher; S2. Co-incubate the spytag-targeted exosomes and the spycatcher-targeted protein to obtain dual-targeted exosomes.

5. The construction method according to claim 4, characterized in that: The construction of targeted exosomes with spytag described in S1 specifically includes: SA-1, packaging the targeting plasmid with spytag into lentivirus to obtain lentivirus; SA-2, infecting 293T cells with the lentivirus and collecting the cell supernatant; SA-3. Extracting exosomes from the cell supernatant by ultracentrifugation.

6. The construction method according to claim 4, characterized in that: The construction of the targeting protein with spycatcher described in S1 specifically includes: SB-1, insert the targeting plasmid with spycatcher into BL21 strain for expression; SB-2, after the bacteria were ultrasonically disrupted, the supernatant was collected by centrifugation and purified by nickel column; SB-3, the purified protein was dialyzed.

7. The construction method according to claim 4, characterized in that: The co-incubation in S2 specifically includes: overnight incubation at 4°C.

8. Use of the dual-targeting exosomes according to any one of claims 1 to 3 in the preparation of a drug for mediating cell membrane protein degradation, characterized in that: The application method comprises: incubating the dual-targeting exosomes with cells to achieve degradation of the cells.

9. The use according to claim 8, characterized in that: The cells are breast cancer cells or mouse mononuclear macrophage leukemia cells.

10. The use according to claim 8, characterized in that: The concentration of the dual-targeting exosomes is 0.1 μg / μL to 0.3 μg / μL, the incubation time is 3 h to 24 h, and the incubation temperature is 37° C.

Images