A PRSS1 gene site-directed knock-in MDCK cell line and its construction method and application

Abstract

The present invention provides an MDCK cell strain with a PRSS1 gene site-specific knock-in, wherein the cell strain is obtained by knocking in the bovine trypsinogen gene PRSS1 optimized with canine codons at the Rosa26 gene site of the MDCK cell through a gene knock-in technique; wherein the Rosa26 gene safety site sequence is shown in SEQ ID No.1; and the optimized PRSS1 gene sequence is shown in SEQ ID No.2. The safe site Rosa26 for knocking in the exogenous gene PRSS1 provided by the present invention has no effect on the growth of cells after PRSS1 is knocked in, and the knock-in gene protein can be expressed normally. The constructed cell strain can autonomously express trypsinogen, can reduce the amount of pancreatic enzyme added during influenza virus culture, reduce the influence of potential exogenous factors on the stability of influenza virus, and improve the hemagglutination titer of H1N1 influenza virus, and can be used for the preparation of influenza virus vaccine.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an MDCK cell strain with a PRSS1 gene site-specific knock-in, and a construction method and application thereof. Background Art

[0002] Influenza virus, belonging to the family of Orthomyxoviridae, is a type of RNA virus that can spread rapidly among people and cause influenza. Influenza virus often causes periodic pandemics in various regions around the world, which can seriously affect the physical and mental health of humans, especially the elderly, children with low immunity and patients with other diseases. In the face of influenza pandemics, vaccination is an economical, safe and effective preventive measure. The preparation of influenza vaccine requires the selection of a suitable production matrix. Since the influenza virus receptor α-2,6-linked sialic acid on the surface of MDCK cells is relatively more, it is highly sensitive and influenza virus is easier to replicate. MDCK cells have been widely selected for the research and development and production of influenza virus vaccines. However, the yield and virus titer of influenza virus cultured in cells are low, which has also become a bottleneck in the production of influenza vaccines. Therefore, by genetically engineering the cell line to construct a suitable engineering cell line, it provides ideas for the process development of vaccines and provides professional technical support for influenza pandemics.

[0003] Hemagglutinin (HA) is an important glycoprotein on the surface of influenza virus, which plays an important role in the process of influenza virus entering target cells. HA mediates the fusion of influenza virus and target cell membrane by binding to the corresponding receptors on the surface of target cells, and promotes the replication of influenza virus in cells. Therefore, the cleavage and activation of influenza virus surface protein HA is the key to the proliferation of influenza virus. HA is usually synthesized in the form of inactive HA0 precursor, which needs to be cleaved into HA1 and HA2 by protease before it can play a role. However, MDCK cells do not express proteases that can cleave HA0. When culturing influenza virus, TPCK-Trypsin is usually added to increase the infection of the virus and improve the titer of the virus. Studies have shown that adding TPCK-Trypsin 24h and 48h after the virus is inoculated into MDCK cells is more conducive to the reproduction of the virus. This is because the added TPCK-Trypsin may be inhibited by factors produced by cells after 24h. Supplementing TPCK-Trypsin in different time periods can improve the cleavage efficiency of HA and promote virus proliferation. Therefore, constructing a cell line that continuously and autonomously expresses pancreatic zymogen can partially replace external pancreatic enzymes in influenza virus culture and increase virus production.

[0004] However, adding trypsin to the culture of influenza virus increases the process steps of influenza vaccine production and increases the difficulty of the process. On the other hand, TPCK-Trypsin is extracted and prepared from the pancreas of animals such as cattle, and there are potential animal exogenous factors. Excessive addition may affect the stability of influenza virus. Therefore, it is urgent to construct an MDCK cell line that can autonomously express trypsinogen in order to better apply it to the production of influenza vaccine. Summary of the invention

[0005] In view of this, the present invention provides an MDCK cell line capable of autonomously expressing trypsinogen by gene knocking-in PRSS1 using CRISPR-Cas9 gene editing technology, which is used to increase the virus yield in influenza vaccine production.

[0006] One of the purposes of the present invention is to provide an MDCK cell line with a PRSS1 gene site-specific knock-in, wherein the cell line is obtained by knocking in a bovine trypsinogen gene PRSS1 optimized with canine codons at the Rosa26 gene site of the MDCK cell through a gene knock-in technique; The Rosa26 gene safety site sequence is shown in SEQ ID No. 1; the optimized PRSS1 gene sequence is shown in SEQ ID No. 2.

[0007]

[0008] SEQ ID No. 2 is specifically as follows: atgaagaccttcatcttcctggccctgctgggcgccgccgtggccttccccgtggacgacgacgacaagatcgtgggcggctacacctgcggcgccaacaccgtgccctaccaggtgagcctgaacagcggctaccacttctgcggcggcagcctgatcaacagccagtgggtggtgagcgccgcccactgctacaagagcggcatccaggtgaggctgggcgaggacaacatcaacgtggtggagggcaacgagcagttcatcagcgccagcaagagcatcgtgcaccccagctacaacagcaacaccctgaacaacgacatcatgctgatcaagctgaagagcgccgccagcctgaacagcagggtggccagcatcagcctgcccaccagctgcgccagcgccggcacccagtgcctgatcagcggctggggcaacaccaagagcagcggcaccagctaccccgacgtgctgaagtgcctgaaggcccccatcctgagcgacagcagctgcaagagcgcctaccccggccagatcaccagcaacatgttctgcgccggctacctggagggcggcaaggacagctgccagggcgacagcggcggccccgtggtgtgcagcggcaagctgcagggcatcgtgagctggggcagcggctgcgcccagaagaacaagcccggcgtgtacaccaaggtgtgcaactacgtgagctggatcaagcagaccatcgccagcaactaa。

[0009] The second object of the present invention is to provide a method for constructing the above-mentioned cell line, which is to construct an sgRNA expression vector and a PRSS1 gene homologous recombination vector based on the CRISPR-Cas9 system according to the Rosa26 gene sequence of MDCK cells, and then the constructed sgRNA expression vector and the PRSS1 gene homologous recombination vector are co-transfected into MDCK cells to obtain an MDCK cell line with site-directed knock-in of the PRSS1 gene; the cell line with site-directed knock-in of the PRSS1 gene is named Madin Darby Canine Kidney cells, MDCK-PRSS1-KI, which has been deposited in the China Center for Type Culture Collection on November 20, 2024, with a deposit number of CCTCC NO: C2024392.

[0010] In some specific embodiments, preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID No.4.

[0011] SEQ ID No. 4 is specifically: 5'-CTGGAATCCTCTTCTGAGCC-3'.

[0012] Furthermore, the sgRNA expression vector is constructed by digesting the pX330 plasmid with the restriction endonuclease BbsI and then connecting it with the sgRNA using T7 DNA ligase.

[0013] In some specific embodiments, preferably, the PRSS1 gene homologous recombination vector contains a 5' homology arm and a 3' homology arm for the sgRNA sequence recognition site; The sequence of the 5' homology arm is shown as SEQ ID No.5, and the sequence of the 3' homology arm is shown as SEQ ID No.6.

[0014] SEQ ID No. 5 is specifically as follows: agtgccgcaatacctttatgggagttctcggctgcctcctgtctcctaaggaccgccctgggcctagaagaatccctccctcccccgcgatctcgtcatcgcctccatgtcgagttgctccttctcgattgtgggcgggactctctgtgcccaggctttacctggtgtctgggcgttgtcctgcaggggattgagcaggtgtgagatttctctcttcaccctgcttgagtttgtgtcacaaaataattataataggggtggaggagggaaatgggagtccaggcattcatctcgggctgattttatgcagcaaggctgcgtgttattactacttaagatcgtttttgtagtgcttttcctgtggataaaaggaggttaagggcatggtcatctgagttttttactcacgtcgtttgagaacgttgtttacaccaccaaagtgtagcattttaaattagatactaatcttaaaattttaggccctttccgttgcatccctagggttagggatcgtagcaactcgtactcctactttgaatccattttgcatttcttttacttgctctttcagtccccagatatagcattggctttctcctctcctgtttttggcagcccggtgagtcatcaaaccagacagatcagttctactgccaattaaggctacccagtttgaagtgaggcctcttacccagtaatgcatttttttcctccttgaatgtttaccttgttttacacttgatctttttcctcagctaggattctacctgttgatccctttctcttcagagtccggttgaccttgactgttgccttaatgagaattagatatgaggttcagtaacctctccctt。

[0015]

[0016] Furthermore, the method also includes using puromycin to screen monoclonal cells with site-directed knock-in of the PRSS1 gene.

[0017] Furthermore, the concentration of puromycin was 8 μg / mL, and puromycin was added when the cells grew to a confluence of 50-70%.

[0018] In some specific embodiments, preferably, puromycin is added when the cells grow to a confluence of 60%.

[0019] The application of the above cell lines in improving the production of influenza virus vaccines.

[0020] The influenza virus in the above application is H1N1 influenza virus.

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention provides a safe site Rosa26 that can be used for site-specific knock-in of the exogenous gene PRSS1 in MDCK cells. After knock-in of PRSS1, there is no effect on cell growth, and the knock-in gene protein can be expressed normally.

[0022] (2) Compared with the original MDCK cell strain, the MDCK-PRSS1-KI cell strain provided by the present invention can autonomously express trypsinogen; during the influenza virus culture process, the amount of trypsin added can be reduced, thereby reducing the impact of potential exogenous factors on the stability of the influenza virus.

[0023] (3) TPCK-rypsin added during influenza virus culture may be inhibited by factors produced by cells after 24 hours, affecting the cleavage efficiency of HA0. However, the MDCK-PRSS1-KI cell line provided by the present invention can continuously express trypsinogen and increase the influenza virus yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a comparison diagram of the Rosa26 sequence in Example 1 in canine origin.

[0025] Figure 2 This is the plasmid map of pcDNA3.1 (+) in Example 1.

[0026] Figure 3 This is the gel electrophoresis diagram of the PCR product of the bacterial solution of the positive colony after the PRSS1 gene is inserted into the plasmid in Example 1.

[0027] Figure 4 This is the plasmid map of pX330 in Example 1.

[0028] Figure 5This is the gel electrophoresis diagram of the PCR product of the bacterial solution containing the pX330-sgRNA plasmid positive colony in Example 1.

[0029] Figure 6 This is the plasmid map of pY75 in Example 1.

[0030] Figure 7 This is the gel electrophoresis diagram of the PCR product of the bacterial solution containing the pY75-5-3 plasmid positive colony in Example 1.

[0031] Figure 8 This is the gel electrophoresis diagram of the monoclonal cell PCR product in Example 1.

[0032] Fig. 9 This is the gel electrophoresis diagram of the PCR products of MDCK-WT cells and MDCK-PRSS1-KI cells in Example 2.

[0033] Fig.10 This is the gel electrophoresis diagram of qPCR products of MDCK-WT cells and MDCK-PRSS1-KI cells in Example 2.

[0034] Fig.11 This is a graph showing the protein secretion results of MDCK-WT cells and MDCK-PRSS1-KI cells in Example 2.

[0035] Fig.12 This is a growth curve diagram of MDCK-WT cells and MDCK-PRSS1-KI cells in Example 3.

[0036] Fig.13 This is a graph showing the proliferation ability of MDCK-WT cells and MDCK-PRSS1-KI cells in Example 3.

[0037] Fig.14 This is a diagram showing the enzyme activity results of the pancreatic zymogen expressed by MDCK-PRSS1-KI cells in Example 3 after activation by enterokinase.

[0038] Fig.15 This is a graph showing the virus titer results after influenza virus was cultured in MDCK-WT cells and MDCK-PRSS1-KI cells in Example 4. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0040] Sources and physical and chemical parameters of key test materials: MDCK cell line was purchased from ATCC with the number CCL-34, W-63 (working library).

[0041] Cell culture used VP-SFM medium, 5% fetal bovine serum, and 1% glutamine supplements, all purchased from GIBCO.

[0042] The polymerase chain reaction (PCR) experiment used polymerase 2×Phanta Max Master Mix (Dye Plus) (Cat. No.: P525), 2×Phanta Flash Master Mix (Dye Plus) (Cat. No.: P520), T4 PNK (Cat. No.: N102), and ClonExpress Ultra One Step Cloning Kit (Cat. No.: C115), all of which were purchased from Nanjing Novozymes Biotech Co., Ltd.

[0043] T7DNA Ligase (Cat. No.: M0318S) and other restriction endonucleases and ligases used in enzyme ligation were purchased from NEB.

[0044] TPCK-trypsin was purchased from Sigma.

[0045] The influenza virus H1N1 (IVR215) strain was stored in Wuhan Institute of Biological Products Co., Ltd., China with batch number 202210W05H1. Primer synthesis and sequencing were completed by Sangon Biotech (Shanghai) Co., Ltd.

[0046] Example 1 This example provides an MDCK cell line with site-directed knock-in of the PRSS1 gene, and the specific construction method is as follows: 1. Selection of safe sites for targeted knock-in gene The Rosa26 locus is located in a non-coding gene on chromosome 6 of mice. Since this region is prone to homologous recombination and no functional expression protein has been found, the protein inserted into this region can be expressed without affecting the expression and function of other endogenous genes. Therefore, the Rosa26 locus has been widely used in mice, pigs, etc. as a safe site for gene targeting. There are literatures showing that the Rosa26 safe site is available in dogs, so the Rosa26 sequence was compared in dogs, such as Figure 1 As shown, the homology between the two is 74%. Based on the homologous sequences obtained, primers were designed for PCR amplification. The specific primers are as follows: Upstream primer: 5′-TCAGTGAAAGTGCCTCCCGA-3′; Downstream primer: 5′-TTCCCACCCCTGTTTTAAGTGAA-3′.

[0047] The PCR amplification reaction system is shown in the following table:

[0048] The PCR amplification reaction procedure is shown in the following table:

[0049] The PCR product was sequenced to obtain the working sequence SEQ ID No. 1 for site-directed knock-in of the Rosa26 locus in MDCK cells, which was used as a working template for subsequent gRNA design.

[0050] 2. Construction of PRSS1 gene knock-in module The CDS sequence SEQ ID No.2 of the PRSS1 gene (Gene ID: 780933 on the NCBI website) constructed in the laboratory and optimized by canine codons was amplified by high-fidelity enzymes and purified as the insert fragment for seamless cloning. At the same time, the pcDNA3.1 (+) plasmid (see the plasmid map) was Figure 2 ) After being linearized by double restriction enzyme digestion with EcoRⅠ and Hind Ⅲ, the fragment was purified and used as a vector for seamless cloning. Using ClonExpress seamless cloning technology, the inserted fragment with the vector end consensus sequence at both ends was directionally cloned into the vector under the catalysis of the recombinase. The CMV promoter and PRSS1 gene cDNA knock-in module SEQ ID No.3 can be obtained to prepare for the subsequent construction of homologous recombination plasmids.

[0051]

[0052] The recombination reaction system is as follows:

[0053] Recombination reaction procedure: incubate at 50°C for 5 min; then cool to 4°C or immediately place on ice.

[0054] Using heat shock transformation, add the reaction product to TOP10 competent cells and mix gently, place in ice for 30 minutes, heat shock in a 42°C water bath for 45 seconds, and quickly return to ice for 2 minutes; add 700µL of sterile culture medium without antibiotics and shake culture at 37°C for 1 hour (160-225rpm), draw an appropriate volume and evenly spread it on the LB agar medium plate containing Amp resistance, invert and culture overnight. Pick a single colony for bacterial liquid PCR identification, the primers are as follows: Upstream primer: 5′-AATGGGCGGTAGGCGTGTAC-3′; Downstream primer: 5′-GGCAAACAACAGATGGCTGGC-3′.

[0055] The PCR reaction system is as follows:

[0056] The PCR reaction program is as follows:

[0057] The reaction product was verified by 1% agarose gel electrophoresis. Figure 3 As shown in the figure, the colony corresponding to the band size of about 1000bp is a positive colony, and the corresponding positive single colony was sent to Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0058] 3. Design sgRNA for knock-in genes in MDCK cells based on safe sites The efficient sgRNA sequence was designed and screened for the Rosa26 safe site of MDCK cells on the sgRNA design website (http: / / www.e-crisp.org / E-CRISP / ), and the specific sgRNA sequence is shown in SEQ ID No. 4; and single-stranded F: 5'-CACCGGCTCAGAAGAGGATTCCAG-3'; R: 5'-CCGAGTCTTCTCCTAAGGTCCAAA-3' was synthesized.

[0059] The phosphorylation and annealing reaction system is as follows:

[0060] The reaction procedure was as follows: incubate at 37°C for 30 min; then incubate at 95°C for 5 min, decreasing by 5°C per minute until reaching 25°C.

[0061] 4. Construction of pX330-sgRNA plasmid The pX330 plasmid (see the plasmid map for details) was inserted into Figure 4 ) was digested and ligated with the synthesized double-stranded sgRNA by a one-step enzyme ligation method to obtain the pX330-sgRNA plasmid.

[0062] The reaction system is as follows:

[0063] The reaction procedure was: incubate at 37°C for 30 min; then incubate at 23°C for 30 min.

[0064] The reaction product was transformed into competent cells, and a single colony was picked for bacterial liquid PCR identification. The specific primers are as follows: Upstream primer: 5′-CACCGGCTCAGAAGAGGATTCCAG-3′; Downstream primer: 5′-CTTGATGTACTGCCAAGTGG-3′.

[0065] The reaction system and procedure were the same as above. The reaction product was verified by electrophoresis, and the results were as follows Figure 5 As shown in the figure, the colony corresponding to the band size of about 500bp is a positive colony, and the corresponding positive single colony was sent to Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0066] 5. Design of homology arms on both sides of sgRNA Sequences of about 1000 bp in length were selected from the upstream and downstream of the sgRNA sequence to design homology arm sequences, wherein the 5' end homology arm sequence is shown in SEQ ID No.5, and the 3' end homology arm sequence is shown in SEQ ID No.6.

[0067] A high-fidelity enzyme was used to amplify the PCR method (the PCR reaction system and reaction procedure were the same as those in Section 1 of Example 1), using wild-type MDCK cell genomic DNA and pcDNA3.1 (+) plasmid as templates to obtain the 5' homology arm sequence, knock in the PRSS1 gene module sequence and the 3' homology arm sequence, and purify the fragments.

[0068] The 5' homology arm PCR amplification primers are as follows: Upstream primer: 5′-ACGGCCAGTGAATTCATCGATAGTGCCGCAATACCTTTATGGG-3′; Downstream primer: 5′-GATGCGGTGGGCTCTATGGAAGGGAGAGGTTACTGAACCTCATA-3′.

[0069] The knock-in PRSS1 gene amplification primers are as follows: Upstream primer: 5′-TATGAGGTTCAGTAACCTCTCCTTCCATAGAGCCCACCGCATC-3′; Downstream primer: 5′-ATTATACGAAGTTATGATATCGACATTGATTATTGACTAGTTATTAATAGTAATCA-3′.

[0070] The 3' homology arm PCR amplification primers are as follows: Upstream primer: 5′-GCTATACGAAGTTATGTCGACCTGATGGAACCTCTTACATTAGCTCC-3′; Downstream primer: 5′-GATTACGCCAAGCTTGGATCCCCAAATTAGTTAACCCTTGCTTTTT-3′.

[0071] 6. Construction of homologous recombination vector pY75-5-3 plasmid The pY75 plasmid (see the plasmid map for details) Figure 6 )Use ClaI and EcoRⅤ enzymes for linearization and incubate at 37°C overnight. The digestion product is purified to obtain a linearized vector. Using ClonExpress seamless cloning technology, the 5' end homology arm fragment and the knock-in PRSS1 gene fragment are recombined together.

[0072] The recombination reaction system is as follows:

[0073] Reaction procedure: Incubate at 50°C for 15 min; then cool to 4°C or immediately place on ice.

[0074] The reaction product was transformed into competent cells, and single colonies were picked for PCR and gel electrophoresis identification, and the corresponding positive single colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After the sequencing results showed that the pY75-5-PRSS1 plasmid was correctly connected, the homologous recombination of the 3' homologous arm was performed according to the above method, and the SalI and BamHⅠ restriction sites used in the 3' homologous arm fragment recombination vector were linearized to finally obtain the homologous recombinant pY75-5-PRSS1-3 plasmid. Similarly, single colonies were picked for PCR and gel electrophoresis identification, and the corresponding positive single colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The results are as follows Figure 7As shown, the colonies corresponding to the pY75-5-PRSS1 plasmid identification band size of about 2800 bp were positive colonies, and the colonies corresponding to the pY75-5-PRSS1-3 plasmid identification band size of about 1200 bp were positive colonies.

[0075] The primers for 5' homology arm PCR identification are as follows: Upstream primer: 5′-GCTGCAAGGCGATTAAGTTG-3′; Downstream primer: 5′-CATGCTCCAGACTGCCTTG-3′.

[0076] The primers for 3' homology arm PCR identification are as follows: Upstream primer: 5′-GTGGTTTGTCCAAACTCATC-3′; Downstream primer: 5′-TGTGTGGAATTGTGAGCG-3′.

[0077] 7. Cell electroporation and screening of monoclonal cells After the construction of pX330-sgRNA plasmid and pY75-5-PRSS1-3 plasmid was completed, the two plasmids were electroporated into MDCK cells simultaneously using an electroporator (model: GenePulserXcell, Bio-Rad). 106 MDCK cells, 8μg of pX330-sgRNA plasmid and 8μg of pY75-5-PRSS1-3 plasmid should be added to each electroporation cup, and finally the electroporation solution was added to make up the total volume to 200μL.

[0078] The electroporation program settings are as follows:

[0079] After the electroporation is completed, the contents of each electroporation cup are evenly divided into a 6-well cell culture plate, complete cell culture medium is added, and the plate is cultured at 37°C.

[0080] Observe the growth of cells in the cell culture plate under a microscope. When the cell confluence reaches 60%, replace the complete medium in the cell culture plate with complete medium supplemented with 8μg / mL puromycin for screening. The puromycin screening medium is replaced every 2 days. After about 1 week of screening, small cell clusters with puromycin resistance can be observed. Monoclonal cells are obtained from small cell clusters by limiting dilution method: digest the small cell clusters in the cell culture plate, count the cells and dilute the cell concentration to 30-50 / 10mL, then fully mix the diluted cell suspension, add 100μL / well to a 96-well cell culture plate, and culture at 37°C. Closely observe the cell growth status under an optical microscope, mark the wells containing only monoclonal cell clusters, expand the culture after the cells in the wells are full, identify and freeze the cells.

[0081] 8. Monoclonal cell PCR identification Primers are designed upstream and downstream of the outer side of the homologous arms at both ends of the cell genome insertion sequence for PCR identification. This pair of primers can simultaneously identify wild-type, single knockout and double knockout clones, and eliminate interference from plasmid residues in the cells. The entire gene sequence is about 6000bp long, so primers are designed in 3 sections for identification. The first pair of primers is for 5' end cell PCR identification. Primers are designed on the outer side of the 5' end homologous arm and on the puromycin gene. In theory, MDCK-WT cells cannot amplify without this sequence, while MDCK-PRSS1-KI cells have inserted a PRSS1 gene knock-in module containing a promoter of about 1730bp in length, and the amplification length is about 3000bp; the second pair of primers is for knock-in gene PCR identification. Primers are designed near the 3' end of the 5' end homologous arm and near the 5' end of the 3' end homologous arm. In theory, the amplified sequence of MDCK-WT cells is 300bp. , while the MDCK-PRSS1-KI cells have inserted a PRSS1 gene knock-in module containing a promoter of about 1730bp and a puromycin resistance gene fragment of 1371bp, and the amplified length is about 3000bp; the third pair of primers is 3' end cell PCR identification, and primers are designed outside the 3' end homology arm and on the puromycin gene. In theory, MDCK-WT cells do not have this sequence and cannot be amplified, while the MDCK-PRSS1-KI cells have inserted a puromycin resistance gene fragment, and the amplified length is about 1700bp. The primers for cell PCR identification are as follows: The primers for 5' end cell PCR identification are as follows: Upstream primer: 5′-CTGAAGGACGAGACGAGCTG-3′; Downstream primer: 5′-CTAAAGCGCATGCTCCAGAC-3′.

[0082] The primers for knock-in gene PCR identification are as follows: Upstream primer: 5′-GCTAGGATTCTACCTGTTGATC-3′; Downstream primer: 5′-GTAGTAGGAGCTAATGTAAGAGG-3′.

[0083] The primers for 3' end cell PCR identification are as follows: Upstream primer: 5′-CTCATGCTGGAGTTCTTCGC-3′; Downstream primer: 5′-TTCCCACCCCTGTTTTAAGTGAA-3′.

[0084] The PCR reaction system is as follows:

[0085] The PCR reaction program is as follows:

[0086] First, extract the genomic DNA of the monoclonal cells and use it as a template for PCR identification. The reaction system and procedure are the same as above. The reaction product is verified by 1% agarose gel electrophoresis. The results are as follows: Figure 8 As shown, WT represents the original MDCK cell line, and KI represents the MDCK cell line with PRSS1 gene knocked in, indicating that the heterozygous monoclonal cell (MDCK-PRSS1+ / -) with PRSS1 site-specific knock-in of the MDCK cell Rosa26 safety site was obtained. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0087] Example 2 This example measures the transcription level and protein level of the MDCK cell line with site-directed knock-in of the PRSS1 gene prepared in Example 1, and the specific steps are as follows: 1. Genomic PCR verification of MDCK cells with site-directed knock-in of PRSS1 gene Primers were designed based on the PRSS1 gene sequence, and the cell genome was extracted for PCR verification. The reaction system and procedure were the same as above (the PCR reaction system and reaction procedure were the same as those in Section 8 of Example 1). The results were as follows: Fig. 9 As shown, MDCK-WT cells do not have this sequence and cannot be amplified, while the band of MDCK-PRSS1-KI cells is about 750bp. The primers are as follows: Upstream primer: 5′-ATGAAGACCTTCATCTTCCTGGC-3′; Downstream primer: 5′-TTAGTTGCTGGCGATGGTCT-3′.

[0088] 2. qPCR verification of MDCK cells with site-directed knock-in of PRSS1 gene qPCR primers were designed according to the PRSS1 gene and GAPDH internal reference gene, and the total RNA of MDCK-WT cells and MDCK-PRSS1-KI cells was extracted using MiniBEST Universal RNA Extraction Kit (TaKaRa), and reverse transcription was performed using PrimeScript™ IV 1st strand cDNA Synthesis Mix (TaKaRa) to synthesize cDNA.

[0089] The reverse transcription reaction system is as follows:

[0090] The reaction procedure was: incubate at 30°C for 10 min; then incubate at 42°C for 20 min; and finally incubate at 95°C for 5 min.

[0091] The reverse transcription products were then subjected to qPCR experiments using the Applied Biosystems 7500 system. The qPCR reaction system is as follows:

[0092] The qPCR reaction procedure is as follows:

[0093] The primers for qPCR identification are as follows: PRSS1 upstream primer: 5′-CTGGGCGAGGACAACATCAA-3′; PRSS1 downstream primer: 5′-TGTTCAGGGTGTTGCTGTTG-3′.

[0094] GAPDH upstream primer: 5′-CAAGGCTGTGGGCAAGGTCATC-3′; GAPDH downstream primer: 5′-TTCTCCAGGCGGCAGGTCAG-3′.

[0095] The results of qPCR detection of cell mRNA expression levels were analyzed by 1% agarose gel electrophoresis. Fig.10 As shown, there is no target band in MDCK-WT cells, and the band size of MDCK-PRSS1-KI cells is about 100 bp.

[0096] 3. SDS-PAGE & Western Blot verification of MDCK cells with site-directed knock-in of PRSS1 gene When MDCK-WT cells and MDCK-PRSS1-KI cells were cultured to 90% cell confluence, serum-free medium was replaced. After the cells secreted trypsinogen for 48 hours, the culture supernatant was collected. Centrifuged at 1000 rpm for 10 minutes at 4°C to remove cell debris, and the supernatant was transferred to a Millipore 3K ultrafiltration tube, centrifuged at 7500 x g for 30 minutes at 4°C, ultrafiltered and concentrated, and the harvested liquid was aliquoted and stored at -80°C.

[0097] Two groups of samples with the same loading amount were taken, TPCK-Trypsin was used as the positive control, and after protein denaturation, 4-12% SDS-PAGE precast gel (GenScript) was used for protein separation. One group was stained with Coomassie Brilliant Blue using the eStain® L1 protein stainer; the other group was transferred to a nitrocellulose membrane (NC membrane) using the eBlot™ fast wet transfer instrument, blocked with 5% skim milk powder at room temperature for 2 hours, and incubated with the primary antibody (Trypsin antibody; Abcam; 1:2000) at room temperature for 2 hours after rinsing with PBST. After rinsing with PBST, the secondary antibody (HRP-labeled goat anti-rabbit IgG, Shanghai Bioengineering; 1:50000) was incubated at room temperature for 1 hour. The membrane protein was developed using ECL reagent (Millipore); scanned and photographed using the Amersham ImageQuant 800 system (Cytiva, Japan). The experimental results are shown in the figure. Fig.11 As shown, the staining results showed that the loading amounts of the two cells were consistent, and the Western Blot results showed that the trypsin protein of MDCK-PRSS1-KI cells was expressed normally.

[0098] Example 3 In this example, the growth characteristics and proliferation ability of the MDCK cell line with site-directed knock-in of the PRSS1 gene prepared in Example 1 were measured, and the specific steps were as follows: 1. Cell growth curve MDCK-WT cells and MDCK-PRSS1-KI cells were cultured to the logarithmic growth phase, and the cells were digested with trypsin. After pipetting and counting, 5 × 10 4 Cells / well were inoculated in a six-well plate and cultured in a 37°C cell culture incubator. Cells were digested and counted every day until the 10th day. A cell growth curve was drawn with time (h) as the horizontal axis and the number of cells as the vertical axis. The results are shown in Fig.12 As shown, the cell proliferation capacity of MDCK-PRSS1-KI cells was similar to that of MDCK-WT cells.

[0099] 2. Plate colony formation experiment MDCK-WT cells and MDCK-PRSS1-KI cells were cultured to the logarithmic growth phase, and the cells were digested with trypsin. After pipetting and counting, 2 × 103 Cells / well were inoculated into a six-well plate and cultured in a cell culture incubator at 37°C. The plates were observed under an optical microscope every 24 hours. After 96 hours of culture, when small cell clusters appeared and did not form a sheet, the culture medium was removed, the cells were rinsed with PBS buffer, 4% paraformaldehyde was added to fix the cells for 20 minutes, and finally stained with 1% crystal violet for 20 minutes. After the plates were dried, the cell clustering was observed. The results are as follows: Fig.13 As shown, the number and area of ​​MDCK-WT cell and MDCK-PRSS1-KI cell clones were basically the same, indicating that the proliferation ability was the same.

[0100] Example 4 In this example, the enzyme activity of the MDCK cell line with site-directed knock-in of the PRSS1 gene prepared in Example 1 was measured, and the specific steps were as follows: First, sample processing. The trypsinogen secreted by MDCK-PRSS1-KI cells needs to be activated by a physiological activator to work better. Enterokinase can specifically recognize the Asp-Asp-Asp-Asp-Asp-Lys sequence of four aspartic acids and one lysine, and cut behind the carboxyl end of lysine. Therefore, the sample is activated. Take 150μL of sample and add an equal volume of PBS, and divide it into two parts. 1μL EK is added to the experimental group, and no EK is added to the control group. After incubation at 25℃ for 3h; then incubate at 37℃ for 30min, it can be used for enzyme activity determination.

[0101] Secondly, the enzyme activity standard curve was established. TPCK-trypsin with known enzyme activity was used as the positive standard, 50mmol / L Tris-HCl buffer at pH 7.9 was used as the diluent, the standard was diluted to an initial concentration of 100ng / mL, and then diluted to about 1ng / mL, and duplicate wells and blank control wells were set. 50μL of the fluorescent peptide substrate Boc-Leu-Gly-Arg-AMC (MCE) with a final concentration of 25μmol / L was added to each well, and after gentle shaking and mixing, it was placed at 37℃ and incubated in the dark for 30min. The fluorescence microplate reader was used with an excitation wavelength of 355nm and an emission wavelength of 460nm for detection. The enzyme activity standard curve was drawn with the enzyme activity of the positive standard as the horizontal axis and the average fluorescence value as the vertical axis, and the linear range of the detection method was analyzed.

[0102] Finally, the sample control group and the experimental group were diluted 10 times, 100 times, and 1000 times with diluent. After adding the fluorescent enzyme label plate to the duplicate wells, the reading analysis was performed according to the above method. The results are as follows Fig.14 As shown, the trypsinogen expressed by KI cells of MDCK-PRSS1-KI cells has higher enzyme activity after being activated by enterokinase.

[0103] Example 5 In this example, influenza virus was cultured in the MDCK cell line with site-directed knock-in of the PRSS1 gene prepared in Example 1, and virus titer was detected. The specific steps are as follows: When the MDCK-WT cells and MDCK-PRSS1-KI cells were cultured to a confluence of 90%, the medium was removed and the cells were washed with PBS buffer. The laboratory knew that the optimal amount of TPCK pancreatin added to MDCK-WT cells was 2 μg / mL. Virus maintenance solution containing 2 μg / mL TPCK pancreatin was added to MDCK-WT cells, and pancreatinogen could be activated with pancreatin commonly used for culturing influenza viruses. Virus maintenance solution containing 0, 0.5, 1, 1.5, and 2 μg / mL TPCK pancreatin was added to MDCK-PRSS1-KI cells, inoculated with H1N1 (IVR215), and cultured in a 34°C incubator for 96 hours. Virus supernatant was collected every 24 hours for hemagglutination virus titer detection.

[0104] Add 25 μL PBS to the 2nd to 12th columns of the 96-well microplate, and add 50 μL of the virus solution to be tested to the 1st column; take 25 μL of the virus solution in the 1st column and mix it evenly in the corresponding well of the 2nd column, and make two-fold dilutions from the 2nd to the 12th column in sequence, and discard 25 μL of the liquid in the last column. Add 25 μL of 1% chicken red blood cell suspension to each well, mix thoroughly, and let it stand for 30 minutes before judging the results. Fig.15 As shown, when 1 μg / mL trypsin was added to MDCK-PRSS1-KI cells, KI cells could reach the maximum virus titer of MDCK-WT cells. As the concentration of trypsin increased, the maximum virus titer was significantly higher than that of WT cells.

[0105] Through the above series of research and determination, it is proved that the MDCK cell line with site-directed knock-in of PRSS1 gene provided by the present application can autonomously express trypsinogen. In the process of influenza virus culture, the amount of pancreatic enzyme added can be reduced, the influence of potential exogenous factors on the stability of influenza virus can be reduced, and the yield of influenza virus can be increased.

[0106] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0107] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A MDCK cell line with site-directed knock-in of PRSS1 gene, characterized in that: The cell line is obtained by knocking in the bovine trypsinogen gene PRSS1 optimized by canine codons at the Rosa26 gene site of MDCK cells through gene knock-in technology; The Rosa26 gene safety site sequence is shown in SEQ ID No. 1; the optimized PRSS1 gene sequence is shown in SEQ ID No.

2.

2. A method for constructing the cell line according to claim 1, characterized in that: According to the Rosa26 gene sequence of MDCK cells, an sgRNA expression vector and a PRSS1 gene homologous recombination vector based on the CRISPR-Cas9 system are constructed, and then the constructed sgRNA expression vector and the PRSS1 gene homologous recombination vector are co-transfected into MDCK cells to obtain an MDCK cell line with site-directed knock-in of the PRSS1 gene; the cell line with site-directed knock-in of the PRSS1 gene is named MDCK-PRSS1-KI, which was deposited in the China Center for Type Culture Collection on November 20, 2024, with the deposit number of CCTCC NO: C2024392.

3. The method according to claim 2, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID No.

4.

4. The method according to claim 2, characterized in that: The sgRNA expression vector is constructed by digesting the pX330 plasmid with the restriction endonuclease BbsI and then connecting it with the sgRNA using T7 DNA ligase.

5. The method according to claim 3, characterized in that: The PRSS1 gene homologous recombination vector contains a 5' homology arm and a 3' homology arm for the sgRNA sequence recognition site; The sequence of the 5' homology arm is shown in SEQ ID No.5, and the sequence of the 3' homology arm is shown in SEQ ID No.

6.

6. The method according to claim 2, characterized in that The method further comprises using puromycin to screen monoclonal cells with site-directed knock-in of the PRSS1 gene.

7. The method according to claim 6, characterized in that The concentration of puromycin was 8 μg / mL, and puromycin was added when the cells grew to a confluence of 50-70%.

8. Use of the cell line according to claim 1 in increasing the yield of influenza virus vaccine.

9. The application according to claim 8, characterized in that: The influenza virus is an H1N1 influenza virus.

Images