A P450 enzyme mutant, fusion protein and its applications

Abstract

This invention provides a P450 enzyme mutant, a fusion protein, and their applications. The mutant is selected from any one of the following: SEQ ID NO:1 shows a sequence with positions 282 and 387 both mutated to leucine; SEQ ID NO:2 shows a sequence with positions 286 and 391 both mutated to leucine; SEQ ID NO:3 shows a sequence with positions 290 and 395 both mutated to leucine; SEQ ID NO:4 shows a sequence with positions 282 and 387 both mutated to leucine; and SEQ ID NO:5 shows a sequence with positions 286 and 391 both mutated to leucine. The above-mentioned P450 enzyme mutant can catalyze intramolecular C-S bond formation, and by improving the product selectivity of the P450 enzyme, it enables the specific synthesis of high-purity sulfur-containing compounds.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a P450 enzyme mutant, a fusion protein, and its applications. Background Technology

[0002] Organosulfur compounds are important components and structural frameworks of many natural metabolites, drugs, and functional materials. Traditional chemical methods, such as transition metal-involved cross-coupling reactions, often face challenges in synthesizing CS bonds due to harsh reaction conditions, low catalytic efficiency, and poor sustainability. In contrast, enzymatic methods can synthesize CS-bonded compounds under mild and green conditions. Cytochrome P450 enzymes, as "gold catalysts," possess advantages such as broad substrate spectrum and diverse catalytic functions, and have been widely studied and applied in various fields such as drug synthesis and fine chemical production.

[0003] All P450 enzyme catalytic reactions require the participation of an electron transport system, which is classified into Class I-X based on the electron transport system. For example: Class I consists of three parts: heme, ferricoxin containing iron-sulfur clusters, and ferricoxin reductase containing FAD; a typical example is CYP101A1. Class II consists of two parts: heme and cytochrome P450 reductase containing FAD / FMN. Class VII is a single-component catalytic system formed by the natural fusion of heme and a reduction chaperone protein containing FMN / Fe2S2, such as P450RhF. Since Narhi and Fulco identified the self-sufficient catalytic system of P450 BM3 in 1986, P450 enzyme fusion proteins have been widely studied and applied. Protein fusion engineering can not only improve the catalytic efficiency of P450 enzymes but also potentially improve protein stability. Researchers often fuse the heme domain and reductase domain of P450 enzymes to obtain artificially self-sufficient P450 enzymes.

[0004] In recent years, research on key P450 enzymes in the synthetic pathways of sulfur-containing compounds has made some progress, such as those for gibberellin, phytoalexins, and neomycin. Among them, the P450 TleB enzyme can catalyze the formation of the intramolecular CS bond in (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, thereby yielding two sulfur-containing indolelacamide derivatives. However, currently, there are still relatively few reported P450 enzymes capable of catalyzing CS bond synthesis. Furthermore, the natural TleB enzyme exhibits a mixture problem when catalyzing the production of (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, making it difficult to specifically synthesize high-purity sulfur-containing indolelacamide derivatives. Therefore, to solve this problem, it is necessary to develop novel P450 enzymes or their mutants with high product specificity. This will help to elucidate the molecular mechanism of the selective catalytic formation of CS bonds by the P450 TleB enzyme, and provide new ideas and methods for the synthesis of sulfur-containing compounds. Summary of the Invention

[0005] To address the problems existing in the background art, the present invention provides a P450 enzyme mutant and its application. This mutant can catalyze the synthesis of CS bonds within substrate molecules and can significantly improve the selectivity of catalytic reactions.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] In a first aspect, the present invention provides a P450 enzyme mutant, said mutant being selected from any one of the following:

[0008] (a) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:1, with amino acid position 282 mutated to leucine and amino acid position 387 mutated to leucine;

[0009] (b) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:2, with amino acid 286 mutated to leucine and amino acid 391 mutated to leucine.

[0010] (c) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:3, with amino acid 290 mutated to leucine and amino acid 395 mutated to leucine;

[0011] (d) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:4, with amino acid position 282 mutated to leucine and amino acid position 387 mutated to leucine.

[0012] (e) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:5, with amino acid 286 mutated to leucine and amino acid 391 mutated to leucine.

[0013] Furthermore, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:1 is mutated to phenylalanine or histidine, the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:2 is mutated to phenylalanine or histidine, the amino acid at position 242 of the amino acid sequence shown in SEQ ID NO:3 is mutated to phenylalanine or histidine, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:4 is mutated to phenylalanine or histidine, and the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:5 is mutated to phenylalanine or histidine.

[0014] The P450 enzymes with amino acid sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 are TleB(CYP107E48), CYP107E49, CYP107E50, CYP107E51 and CYP107E52, respectively.

[0015] In one or more embodiments, the nucleotide sequences of TleB(CYP107E48), CYP107E49, CYP107E50, CYP107E51 and CYP107E52 are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11, respectively.

[0016] Furthermore, the mutant may also be selected from polypeptides formed by adding tag sequences, restriction site sequences or signal sequences to one or both ends of any of the amino acid sequences (a) to (e).

[0017] In a second aspect, the present invention provides a P450 enzyme mutant fusion protein, comprising:

[0018] (i) A fusion protein formed by linking the CYP116B46 reductase domain to the C-terminus of the above-mentioned P450 enzyme mutant;

[0019] (ii) A polypeptide formed by adding a tag sequence, restriction site sequence, or signal sequence to one or both ends of the amino acid sequence of the fusion protein described in (i).

[0020] Furthermore, the amino acid sequence of the CYP116B46 reductase domain is shown in SEQ ID NO:6.

[0021] Thirdly, the present invention provides a polynucleotide encoding the above-mentioned P50 enzyme mutant or the above-mentioned P450 enzyme mutant fusion protein.

[0022] Fourthly, the present invention provides an expression vector comprising the aforementioned polynucleotides.

[0023] Fifthly, the present invention provides a genetically engineered host cell comprising the above-described expression vector.

[0024] The host cell includes prokaryotic or eukaryotic cells. In one or more embodiments, the host cell is *Escherichia coli*, *Corynebacterium glutamicum*, *Bacillus subtilis*, *Saccharomyces cerevisiae*, *Pichia pastoris*, or *Aspergillus oryzae*; more preferably, the host cell is *Escherichia coli*.

[0025] In a sixth aspect, the present invention provides the application of the above-mentioned P450 enzyme mutant, P450 enzyme mutant fusion protein, expression vector or genetically engineered host cell in catalytic CS bonding within substrate molecules.

[0026] Preferably, the substrate used to catalyze the formation of a CS-containing product from (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide substrate, and to significantly improve the selectivity for product P2, has the following structural formula:

[0027] The reaction equation for catalysis is as follows:

[0028]

[0029] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + Glucose and glucose dehydrogenase (GDH);

[0030] In one or more other embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADPH is added to the reaction system;

[0031] In a preferred embodiment, a reducing agent such as TCEP may be added to the reaction system to prevent substrate oxidation.

[0032] Compared to the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for substrate catalysis, it is necessary to add ferroredoxin (Fdx) containing iron-sulfur clusters and ferroredoxin reductase (Fdr) containing FAD.

[0033] The beneficial effects of this invention are:

[0034] The P450 enzyme mutant provided by this invention can catalyze the formation of intramolecular CS bonds and improve the product selectivity of the P450 enzyme, achieving the specific synthesis of high-purity sulfur-containing indolelactam derivatives. When the P450 enzyme mutant of this invention is used to catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, it can improve the selectivity for the catalytic synthesis of product P2, and can even catalyze the formation of a single product P2, with yields of product P2 exceeding 89%.

[0035] When the P450 enzyme mutant is fused with the CYP116B46 reductase domain to form the P450 enzyme mutant fusion protein, no additional reductase is needed for the enzyme catalytic reaction, achieving self-sufficiency, improving the enzyme's catalytic efficiency and stability. Attached Figure Description

[0036] Figure 1 The HPLC chromatograms of TleB and TleB-CYP116B46 catalytic products in Example 6 of this invention;

[0037] Figure 2 The above is an HPLC chromatogram of the catalytic products TleB TPM and TleB TPM-CYP116B46 in Example 6 of the present invention. Detailed Implementation

[0038] The principles and features of the present invention are described below with reference to the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0039] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0040] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention.

[0041] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0042] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0043] In this invention, the terms "P450 enzyme TleB", "TleB", or "CYP107E48" have the same meaning and can be used interchangeably herein. They all refer to the wild-type TleB enzyme with the amino acid sequence shown in SEQ ID NO:1. This enzyme is derived from *Streptomyces blastmyceticus*, and its NCBI publication number is BAP27940.1. This enzyme catalyzes the synthesis of intramolecular CS bonds, catalyzing the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutana mide to generate products P1 and P2. The structural formulas of the substrate, product P1, and product P2 are as follows:

[0044] Substrate

[0045] Product P1

[0046] Product P2

[0047] The yield ratios of the two products P1 and P2 generated by catalysis were 60% and 40%, respectively.

[0048] The P450 enzyme mutant of the present invention can be a chemically synthesized product or can be generated from a prokaryotic or eukaryotic host using recombinant technology.

[0049] In this invention, the terms "CYP116B46" or "CYP116B46 reductase domain" have the same meaning and can be used interchangeably herein. They refer to the reductase domain of CYP116B46 with an amino acid sequence as shown in SEQ ID NO:6. For example, TleB-CYP116B46 is a fusion protein formed by TleB and the CYP116B46 reductase domain, and CYP107E49-CYP116B46 is a fusion protein formed by CYP107E49 and the CYP116B46 reductase domain, etc.

[0050] Using bioinformatics methods, sequence searches were performed in the NCBI database, and four P450 enzymes were identified: CYP107E49, CYP107E50, CYP107E51, and CYP107E52. These four P450 enzymes originated from *Kitasatospora humi*, *Streptomyces clavuligerus*, *Streptomyces alkaliphilus*, and *Streptomyces luteoverticillatus* (their NCBI publication numbers are WP_230051513.1, WP_065757225.1, WP_182604341.1, and WP_126913049.1, respectively). Their amino acid sequences are SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:52, respectively. As shown in NO:5, the sequence similarity with TleB is 83.59%, 84.09%, 81.66%, and 79.34%, respectively, with only about 100 amino acids not completely identical. The difference lies between positions T82 and L392, around the active site. The 40 amino acids within the range are basically the same. According to the P450 enzyme nomenclature committee, TleB and four other P450 enzymes belong to the CYP107E family, and TleB is named CYP107E48.

[0051] The four P450 enzymes CYP107E49, CYP107E50, CYP107E51, and CYP107E52 can also catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide to generate carbon-sulfur heterocyclic products P1 and P2. Specifically, CYP107E49 catalyzes the generation of P1 and P2 in proportions of 67% and 33%, CYP107E50 in proportions of 69% and 31%, CYP107E51 in proportions of 65% and 35%, and CYP107E52 in proportions of 67% and 33%.

[0052] To improve the catalytic activity of TleB and enhance product selectivity, the inventors first obtained the three-dimensional structure of TleB (PDB: 6J83) from the PDB database. Then, using Yasara, they performed molecular docking between the TleB structure and the substrate molecule to identify hotspot amino acids around the active pocket and some potentially interacting amino acid sites. Through rational analysis and semi-rational design, and using directed evolution, they constructed a mutant library by performing site-directed and saturation mutations on these amino acids. Finally, they screened out the mutants TleB DPM, TleB TPM1, and TleB TPM2. In mutant TleB DPM, amino acid positions 282 and 387 were mutated to leucine; in mutant TleB TPM1, amino acid positions 282 and 387 were mutated to leucine, and amino acid position 234 was mutated to phenylalanine; in mutant TleB TPM2, amino acid positions 282 and 387 were mutated to leucine, and amino acid position 234 was mutated to histidine. The mutants TleB DPM, TleB TPM1 and TleB TPM2 can significantly increase the yield of product P2, with selectivity for product P2 of 74%, 90% and 77%, respectively.

[0053] When TleB and its mutants catalyze the above reaction, additional reductases (ferroredoxin containing iron-sulfur clusters (Fdx) and ferroredoxin reductase containing FAD (Fdr)) are required. In order to achieve self-sufficiency in catalytic reaction, the inventors prepared a fusion protein in which the above mutants are bound to the reductase domain of CYP116B46, wherein the amino acid sequence of the reductase domain of CYP116B46 is shown in SEQ ID NO:5. Specifically, the inventors fused the original wild-type TleB protein and performed Gibson assembly using the T5 exonuclease. They then linked the reductase domain of CYP116B46 (CYP116B46) to the C-terminus of TleB to obtain TleB-CYP116B46. This allows electrons to be transferred directly to the active site of TleB through CYP116B46, enabling TleB-CYP116B46 to be self-sufficient without the need for additional reductase. This process also facilitates protein purification and mutant library construction and screening.

[0054] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + Glucose and glucose dehydrogenase (GDH);

[0055] In one or more other embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADPH is added to the reaction system;

[0056] In a preferred embodiment, a reducing agent such as TCEP may be added to the reaction system to prevent substrate oxidation.

[0057] Compared to the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for substrate catalysis, it is necessary to add ferroredoxin (Fdx) containing iron-sulfur clusters and ferroredoxin reductase (Fdr) containing FAD.

[0058] Preferably, the catalytic reaction temperature is 25°C.

[0059] The mutation sites of the fusion proteins are consistent with those of TleB. In the fusion protein TleB-CYP116B46, amino acid positions 282 and 387 are mutated to leucine, forming the mutant TleB DPM-CYP116B46. Similarly, in TleB-CYP116B46, amino acid positions 282 and 387 are mutated to leucine, and amino acid position 234 is mutated to phenylalanine, forming the mutant TleB TPM1-CYP116B46. Likewise, in TleB-CYP116B46, amino acid positions 282 and 387 are mutated to leucine, and amino acid position 234 is mutated to histidine, forming the mutant TleB TPM2-CYP116B46. All of these mutations significantly increased the yield of product P2, with selectivities of 77%, 95%, and 81%, respectively.

[0060] Simultaneously, the inventors used AlphaFold to construct 3D models of four P450 enzymes: CYP107E49, CYP107E50, CYP107E51, and CYP107E52. These models were then compared with the sequence and spatial structure of TleB to identify the corresponding sites for the four enzymes at the key TleB sites I234, I282, and Q387. Site-directed mutagenesis was then performed, ultimately yielding mutants: CYP107E49 DPM (mutation sites: I286L, I391L), CYP107E49 TPM1 (mutation sites: I238F, I286L, I391L), CYP107E49 TPM2 (mutation sites: I238H, I286L, I391L), and CYP107E50 DPM (mutation sites: I290L, Q395L). TPM1 (mutation sites: I242F, I290L, Q395L), CYP107E50 TPM2 (mutation sites: I242H, I290L, Q395L), CYP107E51 DPM (mutation sites: I282L, I387L), CYP107E51 TPM1 (mutation sites: I234F, I282L, I387L), CYP107E51 TPM2 (mutation sites: I234H, I282L, I387L), CYP107E52DPM (mutation sites: I286L, I391L), CYP107E52 The mutants obtained from TPM1 (mutation sites: I238F, I286L, I391L) and CYP107E52TPM2 (mutation sites: I238H, I286L, I391L) can all significantly increase the yield of product P2.

[0061] The above-mentioned TleB DPM, TleB TPM1, TleB TPM2, CYP107E49 DPM, CYP107E49TPM1, CYP107E49 TPM2, CYP107E50 DPM, CYP107E50 TPM1, CYP107E50 TPM2, CYP107E51 DPM, CYP107E51 TPM1, CYP107E51 TPM2, CYP107E52 DPM, CYP107E52 TPM1, and CYP107E52 TPM2 all belong to the "P450 enzyme mutant" described in this invention.

[0062] Similarly, the inventors combined the aforementioned mutants CYP107E49 DPM, CYP107E49 TPM1, CYP107E49 TPM2, CYP107E50 DPM, CYP107E50 TPM1, CYP107E50 TPM2, CYP107E51 DPM, CYP107E51 TPM1, CYP107E51 TPM2, CYP107E52 DPMM, CYP107E52 TPM1, and CYP107E52 TPM2 with the reducing domain of CYP116B46 to prepare fusion proteins CYP107E49DPM-CYP116B46, CYP107E49 TPM1-CYP116B46, and CYP107E49TPM2-CYP116B46, CYP107E50, and CYP107E50, respectively. The P450 enzyme mutant fusion proteins obtained from DPM-CYP116B46, CYP107E50TPM1-CYP116B46, CYP107E50 TPM2-CYP116B46, CYP107E51DPM-CYP116B46, CYP107E51 TPM1-CYP116B46, CYP107E51TPM2-CYP116B46, CYP107E52DPM-CYP116B46, CYP107E52TPM1-CYP116B46, and CYP107E52 TPM2-CYP116B46 all significantly increased the yield of product P2.

[0063] The above TleB DPM-CYP116B46, TleB TPM1-CYP116B46, TleB TPM2-CYP116B46, CYP107E49 DPM-CYP116B46, CYP107E49TPM1-CYP116B46, CYP107E49 TPM2-CYP116B46, CYP107E50DPM-CYP116B46, CYP107E50 TPM1-CYP116B46, CYP107E50TPM2-CYP116B46, CYP107E51 DPM-CYP116B46, CYP107E51TPM1-CYP116B46, CYP107E51 TPM2-CYP116B46, CYP107E52DPM-CYP116B46, CYP107E52TPM1-CYP116B46 and CYP107E52TPM2-CYP116B46 all belong to the “P450 enzyme mutant fusion protein” described in this invention.

[0064] In this invention, the term "P450 enzyme mutant" should also include: deletion, insertion, or substitution of several amino acids, as well as the addition or deletion of one or more amino acids at the C-terminus and / or N-terminus, but maintaining the P450 enzyme activity and function of this invention. For example, in the art, substitution with amino acids with similar or comparable properties usually does not change the function of the protein. Adding one or more amino acids at the C-terminus and / or N-terminus, such as adding a tag sequence, restriction site sequence, signal sequence, or secretion signal sequence, usually does not change the function of the resulting protein. However, the following mutations exist in these derivatives: the amino acid at position 282 of the amino acid sequence shown in SEQ ID NO:1 is mutated to leucine and the amino acid at position 387 is mutated to leucine; or the amino acid at position 286 of the amino acid sequence shown in SEQ ID NO:2 is mutated to leucine and the amino acid at position 391 is mutated to leucine; or the amino acid at position 290 of the amino acid sequence shown in SEQ ID NO:3 is mutated to leucine and the amino acid at position 395 is mutated to leucine; or the amino acid at position 282 of the amino acid sequence shown in SEQ ID NO:4 is mutated to leucine and the amino acid at position 387 is mutated to leucine; or the amino acid at position 286 of the amino acid sequence shown in SEQ ID NO:5 is mutated to leucine and the amino acid at position 391 is mutated to leucine. More preferably, the 234th amino acid of the amino acid sequence shown in SEQ ID NO:1 is mutated to phenylalanine or histidine, the 238th amino acid of the amino acid sequence shown in SEQ ID NO:2 is mutated to phenylalanine or histidine, the 242nd amino acid of the amino acid sequence shown in SEQ ID NO:3 is mutated to phenylalanine or histidine, the 234th amino acid of the amino acid sequence shown in SEQ ID NO:4 is mutated to phenylalanine or histidine, and the 238th amino acid of the amino acid sequence shown in SEQ ID NO:5 is mutated to phenylalanine or histidine.

[0065] In this invention, the term "P450 enzyme mutant" shall also include: a derived protein that retains its protein activity and has at least 80%, preferably at least 85%, more preferably at least 90%, further preferably at least 95%, such as at least 98% or at least 99% sequence identity with the amino acid sequence of the said P450 enzyme mutant. Similarly, these derived proteins certainly contain the mutations described above in this invention: amino acid position 282 of the amino acid sequence shown in SEQ ID NO:1 is mutated to leucine and amino acid position 387 is mutated to leucine; or amino acid position 286 of the amino acid sequence shown in SEQ ID NO:2 is mutated to leucine and amino acid position 391 is mutated to leucine; or amino acid position 290 of the amino acid sequence shown in SEQ ID NO:3 is mutated to leucine and amino acid position 395 is mutated to leucine; or amino acid position 282 of the amino acid sequence shown in SEQ ID NO:4 is mutated to leucine and amino acid position 387 is mutated to leucine; or amino acid position 286 of the amino acid sequence shown in SEQ ID NO:5 is mutated to leucine and amino acid position 391 is mutated to leucine. More preferably, the 234th amino acid of the amino acid sequence shown in SEQ ID NO:1 is mutated to phenylalanine or histidine, the 238th amino acid of the amino acid sequence shown in SEQ ID NO:2 is mutated to phenylalanine or histidine, the 242nd amino acid of the amino acid sequence shown in SEQ ID NO:3 is mutated to phenylalanine or histidine, the 234th amino acid of the amino acid sequence shown in SEQ ID NO:4 is mutated to phenylalanine or histidine, and the 238th amino acid of the amino acid sequence shown in SEQ ID NO:5 is mutated to phenylalanine or histidine.

[0066] This invention also provides polynucleotides encoding the aforementioned P450 enzyme mutants and P450 enzyme mutant fusion proteins. The polynucleotides of this invention can be in DNA or RNA form, and the DNA form includes genomic DNA, cDNA, or artificially synthesized DNA, which can be a coding strand or a non-coding strand.

[0067] The present invention also provides a vector comprising the polynucleotides of the present invention, and a host cell genetically engineered using the coding sequence of the vector of the present invention or a P450 enzyme mutant or a P450 enzyme mutant fusion protein.

[0068] Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce P450 enzyme mutants or P450 enzyme mutant fusion proteins. Generally, the steps are as follows: (1) transforming or transducing suitable host cells with the polynucleotide of the P450 enzyme mutant or P450 enzyme mutant fusion protein of the present invention or a recombinant expression vector containing the polynucleotide; (2) culturing host cells in a suitable culture medium; and (3) isolating and purifying the protein from the culture medium or cells.

[0069] In this invention, the polynucleotide sequence of a P450 enzyme mutant or a P450 enzyme mutant fusion protein can be inserted into a recombinant expression vector. Any plasmid and vector can be used, provided it can replicate stably in the host. An important characteristic of the expression vector is that it typically contains an origin of replication, a promoter, a marker gene, and translation control elements. Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a P450 enzyme mutant or a P450 enzyme mutant fusion protein and suitable transcription / translation control signals. The DNA sequence can be efficiently ligated to an appropriate promoter of the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. The expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells at the site of transformation.

[0070] Vectors containing the appropriate DNA sequence and appropriate promoter or control sequence can be used to transform appropriate host cells so that they can express proteins.

[0071] In this invention, the host cell can be any microorganism suitable for expressing P450 enzyme or P450 enzyme mutant or P450 enzyme mutant fusion protein, including bacteria and fungi, preferably Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Aspergillus oryzae, more preferably Escherichia coli, and in one or more of the following embodiments, Escherichia coli BL21(DE3) is used.

[0072] In this invention, the polynucleotide sequence (coding sequence) encoding the P450 enzyme mutant or the P450 enzyme mutant fusion protein can also be used in this invention. The coding sequences of the TleB, CYP107E49, CYP107E50, CYP107E51, CYP107E52 and CYP116B46 reductase domains are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12, respectively. The coding sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein can also be a degenerate variant of the polynucleotide sequence provided in this invention. A degenerate variant refers to a nucleic acid sequence that encodes the P450 enzyme mutant or the P450 enzyme mutant fusion protein in this invention, but differs from the nucleotide sequence in the embodiments of this invention.

[0073] As is well known, the expression results of the same nucleotide sequence often vary greatly in different microbial hosts. In order to optimize the expression of P450 enzymes or their mutants in Escherichia coli, which is the most commonly used gene in genetic engineering, codon optimization can be performed on the expression genes of these enzymes.

[0074] Codon optimization is a technique used to maximize protein expression in an organism by increasing the translation efficiency of genes of interest. Different organisms often exhibit a particular preference for one of a set of codons encoding the same amino acid due to mutational predisposition and natural selection. For example, in fast-growing microorganisms such as *E. coli*, optimized codons reflect the composition of their respective genomic tRNA repertoires. Therefore, in fast-growing microorganisms, low-frequency codons for amino acids can be replaced with high-frequency codons for the same amino acid. Consequently, the expression of optimized DNA sequences is improved in fast-growing microorganisms.

[0075] Those skilled in the art will understand how to select appropriate vectors, promoters, enhancers, and host cells. The recombinant cells (host cells) established in this invention can be cultured using conventional methods to express the polypeptide encoded by the genes of this invention. Depending on the host cells used, the culture medium can be selected from various conventional culture media. Culture is carried out under conditions suitable for host cell growth. Once the host cells have grown to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature change or chemical induction), and the cells are cultured for a further period.

[0076] When expressed, the P450 enzyme mutant or P450 enzyme mutant fusion protein of the present invention can be expressed intracellularly and secreted extracellularly. If desired, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitants (salting out), centrifugation, permeation, sonication, high-speed centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high-performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations thereof.

[0077] The P450 enzyme mutant and the P450 enzyme mutant fusion protein of the present invention can be used to catalyze intramolecular CS bond formation, and the enzyme forms include purified enzyme, crude enzyme, etc.

[0078] Substrate is At the same time, the P450 enzyme mutant-based P450 mutant fusion protein of the present invention can improve the selectivity of catalytic production of product P2, and is used for selective catalytic synthesis of product P2. The structural formula of P2 is:

[0079] It should be understood that host cells expressing P450 enzyme mutants or P450 enzyme mutant fusion proteins, or their expression products (such as lysis products or secretion products), also have this use.

[0080] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + Glucose and glucose dehydrogenase (GDH);

[0081] In one or more other embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + glucose-6-phosphate and glucose-6-phosphate dehydrogenase;

[0082] In a preferred embodiment, a reducing agent such as TCEP may be added to the reaction system to prevent substrate oxidation.

[0083] Compared to the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for substrate catalysis, it is necessary to add ferroredoxin (Fdx) containing iron-sulfur clusters and ferroredoxin reductase (Fdr) containing FAD.

[0084] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0085] The molecular biology experiments in the following examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation. These were primarily conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook et al., published by Science Press. Specific experimental conditions could be determined through simple experiments if necessary. PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments could be made through simple experiments if necessary.

[0086] Materials and Methods

[0087] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. (LB solid medium with an additional 20 g / L agar powder)

[0088] TB medium: 24 g / L yeast extract, 12 g / L tryptone, 16.43 g / L K₂HPO₄·3H₂O, 2.31 g / L KH₂PO₄, 5 g / L glycerol, pH 7.0-7.5. (TB solid medium with an additional 20 g / L agar powder)

[0089] Substrate Product P1 Product P2 Detection methods:

[0090] The substrate, product P1, and product P2 were analyzed and determined by HPLC. Instrument model: SHIMADZU LC-2030Plus; Column model: Yuexu Ultimate C18 (4.6×300mm, 5μm). Specific conditions were as follows: mobile phase: methanol (0.1% formic acid), ultrapure water; 0-15min: methanol (0.1% formic acid) concentration increased from 60% to 90%; 15-16min: 90% methanol (0.1% formic acid); 16-20min: 60% methanol (0.1% formic acid); flow rate: 1.0mL / min; column temperature: 25℃; detection wavelength: 280nm; detection time: 20min; injection volume: 20μL.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. For ease of description, in the embodiments, the strain number, plasmid number, enzyme number, and enzyme-encoding gene number may share a single number, which is readily understood by those skilled in the art, meaning that the same number can refer to different biological forms in different environments.

[0092] Example 1: Construction of TleB / TleB-CYP116B46 genetically engineered bacteria

[0093] The amino acid sequence of the P450 enzyme TleB is shown in SEQ ID NO:1, and its encoding nucleotide sequence is shown in SEQ ID NO:7. The amino acid sequence of the reducing domain of CYP116B46 is shown in SEQ ID NO:6, and its encoding nucleotide sequence is shown in SEQ ID NO:12.

[0094] The plasmid pET28a-TleB carrying the TleB gene was synthesized, and the plasmid pET28a-CYP116B46 carrying the reducing domain of CYP116B46 was also synthesized.

[0095] The amplification primers for pET28a-TleB are:

[0096] Primer pET28a-TleB-F: AAGCTTGCGGCCGCACT (SEQ ID NO: 13)

[0097] Primer pET28a-TleB-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO: 14)

[0098] The amplification primers for the reductive domain of CYP116B46 are:

[0099] Primer CYP116B46-F1: CTGCCGGTTCTGTGGGACCCGGCGCAGAAT CCGGAAC (SEQ ID NO:15)

[0100] Primer CYP116B46-R1: TGCGGCCGCAAGCTTTTATCAGGTCCAGAAC CAGAC (SEQ ID NO:16)

[0101] E. coli BL21(DE3) / pET28a-TleB and E. coli BL21(DE3) / pET28a-CYP116B46 strains were cultured in LB medium at 37°C and 200 rpm for 12–16 h. Cells were then collected, and genomic DNA was extracted using the TransZol™ UP Plus Genome Mini-Prep Kit. Using pET28a-TleB as a template and pET28a-TleB-F and pET28a-TleB-R as primers, pET28a-TleB was amplified. Similarly, using pET28a-CYP116B46 as a template and CYP116B46-F1 and CYP116B46-R1 as primers, the CYP116B46 reducing domain sequence was amplified.

[0102] PCR reaction system (50μL): 1-50ng template, 2μL (10μM) each of a pair of upstream and downstream primers, 25μL Prime STARMax DNA polymerase (2×), and sterile water to make up to 50μL.

[0103] PCR amplification program: (1) 98℃ pre-denaturation for 3 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 5 sec; (4) 72℃ extension for 80 s / 20 s, using pET28a-TleB as template, extension for 80 s, using pET28a-CYP116B46 as template, extension for 20 s; Steps (2) to (4) are performed for a total of 30 cycles, and finally the extension is performed at 72℃ for 5 min, and the PCR product is stored at 12℃.

[0104] The two amplified PCR products were detected by 1% agarose gel electrophoresis and recovered from the gel using an OMEGA gel extraction kit. The two recovered PCR products were digested with T5 exonuclease for 3–5 min to obtain the recombinant expression vector pET28a-TleB-CYP116B46. pET28a-TleB-CYP116B46 was then transformed into DH5α competent cells and evenly spread on LB solid medium containing 50 μg / mL kanamycin, and incubated overnight in an inverted incubator at 37°C. Single clones were selected, colony PCR was performed for verification, and the colonies were sent to the company for sequencing. Strains with correct sequencing results were cultured, plasmids were extracted, and the cells were re-transformed into E. coli BL21(DE3) competent cells. The cells were then added to culture medium and cultured at 37°C for 45-60 min. The cells were then plated on LB solid medium containing 50 μg / mL kanamycin and cultured overnight at 37°C inverted to obtain the recombinant transformant E. coli BL21(DE3) / pET28a-TleB-CYP116B46 strain for expressing the TleB-CYP116B46 enzyme.

[0105] Example 2: Construction of the TleB / TleB-CYP116B46 site-directed mutant library

[0106] Site-directed mutagenesis was performed on multiple sites around the active pocket of TleB and TleB / TleB-CYP116B46 to construct a mutant library.

[0107] Taking the mutation at position 282 of TleB and TleB / TleB-CYP116B46 to leucine (I282L) as an example,

[0108] Template: pET28a-TleB or pET28a-TleB-CYP116B46

[0109] Primer TleB I282L-F: GTTCCGTTGCTGAGCCACGTGACCTTCG (SEQ ID NO: 17)

[0110] Primer TleB I282L-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO:18)

[0111] PCR reaction system (20μL): 1-50ng template, 0.5μL (10μM) each of a pair of upstream and downstream primers, 10μL of PrimeSTAR Max DNA polymerase (2×), and sterile water to make up to 20μL.

[0112] The PCR amplification program is as follows: (1) 98℃ pre-denaturation for 3 min; (2) 98℃ denaturation for 10 s; (3) 58℃ annealing for 5 s; (4) 72℃ extension for 80 s. Steps (2) to (4) are performed for a total of 30 cycles. Finally, the extension is performed at 72℃ for 5 min, and the PCR product is stored at 12℃.

[0113] The amplified PCR products were digested with Dpn I at 37°C for 3-6 hours, then inactivated at 80°C for 20 minutes. They were then transferred to E. coli BL21(DE3) competent cells, added to culture medium, and cultured at 37°C for 45-60 minutes. The cells were then plated on LB solid medium containing kanamycin and cultured overnight at 37°C with the plates inverted. Single clones were picked and sent to the company for sequencing. The sequencing results peaks were viewed using SnapGene bioanalysis software to confirm the correct amino acid mutation at the mutation site.

[0114] Example 3: Construction of a TleB or TleB / TleB-CYP116B46-point saturated mutant library

[0115] Based on the screening results of the site-directed mutant library, point saturation mutations were performed on positions I282 and Q387 of TleB or TleB-CYP116B46 to construct a mutant library.

[0116] First, perform a saturation mutation at the I282 site:

[0117] Template: pET28a-TleB or pET28a-TleB-CYP116B46

[0118] Primer I282-F: GTTCCGTTGNNKAGCCACTGTGACCTTCG (SEQ ID NO: 19),

[0119] Primer I282-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO:20).

[0120] Except for the template and primers, the PCR reaction system, PCR amplification procedure, and subsequent steps were the same as in Example 2. Single clones were selected and sent to the company for sequencing. The sequencing results peak diagram was viewed using SnapGene bioanalysis software, yielding all 19 mutants.

[0121] The template and method for the Q387 site saturation mutation are the same as in the above embodiments; the template used for the I282L / Q387 iterative saturation mutation is pET28a-TleB-CYP116B46-I282L, and the template used for the I282L / Q387L / I234 iterative saturation mutation is pET28a-TleB-CYP116B46-I282L / Q387L, and the method is the same as in the above embodiments; the primers used are shown in the table below:

[0122]

[0123] Example 4: Screening of TleB / TleB-CYP116B46 mutants

[0124] The expression strains pET28a-TleB and pET28a-TleB-CYP116B46 obtained in Example 1, as well as the corresponding mutants obtained in Example 3, were inoculated into 2 mL of LB liquid medium containing kanamycin and cultured at 37°C and 220 rpm for 5-6 h. Then, they were inoculated into 100 mL of TB medium containing kanamycin at a rate of 1 v / v%. OD was then calculated. 600 When the OD value reaches 0.6–0.8, add IPTG to a final concentration of 0.2 mM and induce culture for 18 h at 25 °C and 220 rpm in a shaker. Collect the cells by centrifugation at 4000 rpm for 10 min, wash twice with 0.1 M, pH 7.0 potassium phosphate buffer, and then resuspend the cells in 0.1 M, pH 6.5 potassium phosphate buffer to adjust OD. 600 =20; Place a 10 mL shake tube containing resuspended cells in an ice-water bath and sonicate for 3-5 min at 500 W; collect the lysate, centrifuge at 12000 rpm for 5 min at 4 °C, and use the supernatant for the catalytic reaction.

[0125] The crude enzyme-catalyzed reaction system (2 mL) is as follows: 0.25 mM substrate; 2 mM TCEP; 1 mM NADP. +1 U GDH; 5% (m / V) Glucose; crude enzyme supernatant added to make up the difference. In a 25 mL reaction flask, react at 25 °C and 220 rpm for 2 h. After the reaction, transfer 500 μL of the reaction solution to a clean 2 mL EP tube, add 1 mL of ethyl acetate to terminate the reaction, and extract thoroughly by vortexing. Centrifuge at 12000 rpm for 5 min, and transfer 900 μL of supernatant to a clean 1.5 mL EP tube. Open the tube cap and place it in a fume hood to evaporate. After the ethyl acetate has completely evaporated, add 200 μL of acetonitrile, vortex briefly, and then transfer to a 96-well microplate for HPLC analysis. Calculate the ratio of the two products by peak area integration to screen for mutants.

[0126] The mutants and catalytic products obtained through screening are shown in the table below:

[0127] Table 1 Catalytic properties of TleB, TleB-CYP116B46 and their mutants

[0128]

[0129]

[0130] Example 5: Expression and purification of the TleB / TleB-CYP116B46 / TleB-CYP116B46 mutant

[0131] Taking the expression and purification of TleB-CYP116B46 as an example, the expression strain pET28a-TleB-CYP116B46 obtained in Example 1 was inoculated into 2 mL of LB liquid medium containing kanamycin and cultured at 37°C and 220 rpm for 5-6 h. Then, it was inoculated into 100 mL of TB medium containing kanamycin at an inoculation rate of 1 v / v%. The OD was then calculated. 600 When the concentration reaches 0.6–0.8, add IPTG to a final concentration of 0.2 mM and induce culture in a shaker at 25°C and 220 rpm for 18 h.

[0132] The bacterial cells were collected by centrifugation at 4000 rpm for 10 min and washed twice with 0.1 M, pH 7.0 potassium phosphate buffer. The resulting cells were then resuspended in 0.1 M, pH 7.0 potassium phosphate buffer (containing 10 mM imidazole), sonicated on ice, and the supernatant was collected by high-speed centrifugation. The supernatant was filtered through a 0.45 μm filter and purified using a nickel column at 4 °C. The column was washed with 5x ultrapure water and 5x equilibration buffer. The filtered supernatant was loaded onto the nickel column, with multiple loadings to ensure complete column adhesion of the target protein. The protein was eluted with different concentrations of equilibration buffer (10 mM, 20 mM, 250 mM imidazole), then desalted, ultrafiltered, concentrated, flash-frozen in liquid nitrogen, and stored at -80 °C.

[0133] Both TleB and the TleB-CYP116B46 mutant were expressed and purified using the above method.

[0134] Example 6 Pure enzyme-catalyzed reaction

[0135] The pure enzyme catalytic system for TleB or TleB mutants consisted of: 10 μM TleB or TleB mutant, 10 μM ferroredoxin containing iron-sulfur clusters (Fdx), 10 μM ferroredoxin reductase containing FAD (Fdr), 2 mM NADPH, 2 mM TCEP (tris(2-carboxyethyl)phosphine), 0.1 mM substrate, reaction temperature 25 °C, and reaction time 2 h.

[0136] The pure enzyme catalytic system of TleB-CYP116B46 or its mutant: 10 μM TleB-CYP116B46 or its mutant, 2 mM NADPH, 2 mM TCEP (tris(2-carboxyethyl)phosphine), 0.1 mM substrate, reaction temperature 25℃, reaction time 2 h.

[0137] The HPLC chromatograms of the TleB and TleB-CYP116B46 catalytic products are shown below. Figure 1 As shown, no enzyme solution was added in the control group.

[0138] The HPLC chromatograms of the catalytic products TleB TPM1 and TleB TPM1-CYP116B46 are shown below. Figure 2 As shown, no enzyme solution was added in the control group.

[0139] Example 7

[0140] Fusion proteins were prepared using the reducing domains of CYP107E49, CYP107E50, CYP107E51, CYP107E52, and CYP116B46, respectively, and then subjected to site-directed mutagenesis and saturation mutagenesis. Except for the primers, all other procedures were the same as in Examples 1-6.

[0141] The upstream primers for the amplification primers of pET28a-CYP107E49, pET28a-CYP107E50, pET28a-CYP107E51, and pET28a-CYP107E52 are all:

[0142] pET28a-CYP107E-F:GAACGTCTGGTTCTGGACCTGTAAAAGCTTG CGGCCGCACTCGAG(SEQID NO:29)

[0143] The downstream primers are as follows:

[0144] pET28a-CYP107E49-R: TCCGGATTCTGCGCCGGGTCCCACTGAACCGGCAGTTGCAGCAGGCTACG (SEQ ID NO: 30)

[0145] pET28a-CYP107E50-R: TCCGGATTCTGCGCCGGGTCCCACAGAACC GGCAGACGCAGCAGGC (SEQ ID NO: 31)

[0146] pET28a-CYP107E51-R: TCCGGATTCTGCGCCGGGTCCCAGGTGATCGGCAGACGCAGCAGGCTACG (SEQ ID NO: 32)

[0147] pET28a-CYP107E52-R: TCCGGATTCTGCGCCGGGTCCCAAGCAACCGGCAGTTTCAGCAGGCTACG (SEQ ID NO: 33).

[0148] The primers for amplifying the CYP116B46 reducing domain are:

[0149] CYP116B46-F2:GACCCGGCGCAGAATCCGGAACGTCGCGATCCGG AC (SEQ ID NO:34)

[0150] CYP116B46-R2: TTACAGGTCCAGAACCAGACGTTCGGTTTTAGCA CGAGAGC (SEQ ID NO:35)

[0151] The primers for the site-directed mutagenesis of CYP107E49-CYP116B46 are CYP107E49-I238F-F, CYP107E49-I238F-R, CYP107E49-I286L-F, and CYP107E49-Q391L-R.

[0152] The site-directed mutagenesis primers for CYP107E50-CYP116B46 are CYP107E50-I242F-F, CYP107E50-I242F-R, CYP107E50-I290L-F, and CYP107E50-Q395L-R.

[0153] The site-directed mutagenesis primers for CYP107E51-CYP116B46 are CYP107E51-I234F-F, CYP107E51-I234F-R, CYP107E51-I282L-F, and CYP107E51-Q387L-R.

[0154] The site-directed mutagenesis primers for CYP107E52-CYP116B46 are CYP107E52-I238F-F, CYP107E52-I238F-R, CYP107E52-I286L-F, and CYP107E52-Q391L-R.

[0155] The nucleotide sequences of the primers are shown in the table below:

[0156] Table 2. Point mutation primers for CYP107E49-CYP116B46, CYP107E50-CYP116B46, CYP107E51-CYP116B46, and CYP107E52-CYP116B46.

[0157]

[0158] The catalytic results for CYP107E49 TPM1-CYP116B46, CYP107E50 TPM1-CYP116B46, CYP107E51 TPM1-CYP116B46, and CYP107E52 TPM1-CYP116B46 are given below.

[0159] The products generated by the substrates catalyzed by CYP107E49-CYP116B46, CYP107E50-CYP116B46, CYP107E51-CYP116B46, CYP107E52-CYP116B46, and the screened mutants are shown in the table below:

[0160] Table 3

[0161]

[0162] The above results indicate that the mutants CYP107E49 TPM1-CYP116B46(I238F / I286L / I391L), CYP107E50 TPM1-CYP116B46(I242F / I290L / Q395L), CYP107E51 TPM1-CYP116B46(I234F / I282L / I387L), and CYP107E52TPM1-CYP116B46(I238F / I286L / I391L) of the present invention have catalytic effects that are basically equivalent to those of TleB TPM1-CYP116B46(I234F / I282L / Q387L), and the P2 content can reach about 90% in all cases.

[0163] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A P450 enzyme mutant, characterized in that, The mutant is selected from any of the following: (a) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:1, with amino acid position 282 mutated to leucine and amino acid position 387 mutated to leucine; (b) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:1, with the 282nd amino acid mutated to leucine, the 387th amino acid mutated to leucine, and the 234th amino acid mutated to phenylalanine or histidine. (c) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:2, with amino acid 286 mutated to leucine, amino acid 391 mutated to leucine, and amino acid 238 mutated to phenylalanine. (d) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:3, with amino acid position 290 mutated to leucine, amino acid position 395 mutated to leucine, and amino acid position 242 mutated to phenylalanine. (e) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:4, with amino acid position 282 mutated to leucine, amino acid position 387 mutated to leucine, and amino acid position 234 mutated to phenylalanine. (f) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO:5, with amino acid 286 mutated to leucine, amino acid 391 mutated to leucine, and amino acid 238 mutated to phenylalanine.

2. The P450 enzyme mutant according to claim 1, characterized in that, The mutant may also be selected from the following: (g) A polypeptide formed by adding a tag sequence or signal sequence to one or both ends of any of the amino acid sequences in (a) to (f).

3. A P450 enzyme mutant fusion protein, characterized in that, The fusion protein includes (i) A fusion protein formed by linking the CYP116B46 reductase domain to the C-terminus of the P450 enzyme mutant of claim 1; (ii) A polypeptide formed by adding a tag sequence or signal sequence to one or both ends of the amino acid sequence of the fusion protein described in (i); The amino acid sequence of the CYP116B46 reductase domain is shown in SEQ ID NO:

6.

4. A polynucleotide, characterized in that, Encodes the P450 enzyme mutant of claim 1 or 2 or the P450 enzyme mutant fusion protein of claim 3.

5. An expression carrier, characterized in that, It comprises the polynucleotide of claim 4.

6. A genetically engineered host cell, characterized in that, It includes the expression vector as described in claim 5.

7. The application of the P450 enzyme mutant of claim 1 or 2, the P450 enzyme mutant fusion protein of claim 3, the expression vector of claim 5, or the genetically engineered host cell of claim 6 in catalyzing CS bonding within substrate molecules, characterized in that, This material is used to catalyze the following substrate reaction, improving the selectivity for the catalytic product P2. The structural formula of the substrate is as follows: The catalytic reaction formula is as follows: 。

Images