Aldose reductase mutant and application thereof in production of D-tagatose

Abstract

The invention discloses an aldose reductase mutant and application thereof in production of D-tagatose, and belongs to the technical field of genetic engineering. The aldose reductase mutant disclosed by the invention has relatively high catalytic activity, and can be coupled with galactitol 2-dehydrogenase to realize cyclic regeneration of NADH (nicotinamide adenine dinucleotide), so that the preparation cost of D-tagatose is greatly reduced. When the aldose reductase mutant is used for preparing D-tagatose, 98.2 g / L of D-tagatose can be obtained through conversion within 5 h, the yield reaches up to 98.2%, and the conversion effect is better than that of wild type and other mutant enzymes, so that the aldose reductase mutant has good industrial application prospects.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to an aldose reductase mutant and application thereof in the production of D-tagatose. Background Art

[0002] D-tagatose is a rare ketohexose found in nature. It is an isomer of D-galactose and also a diastereomer of fructose. Its sweetness is similar to that of sucrose, but the calories it provides are only 30% of sucrose. It can be used as a low-calorie sweetener and will not cause a rapid increase in blood sugar after consumption. It can be used as a special sweetener for diabetics and is widely used in low-sugar health foods and various weight-loss foods.

[0003] D-tagatose is very rare in nature. It is difficult to obtain D-tagatose by natural extraction. The extraction amount is very rare and cannot meet the market demand. In addition, the extraction cost is high. The reaction conditions of the chemical synthesis method are harsh, and more by-products are produced during the synthesis process, which increases the difficulty of the subsequent separation and purification process. The yield of D-tagatose is low. The biotransformation method has the advantages of high specificity, green environmental protection, mild reaction conditions, and no need for multi-step separation and purification. It has received widespread attention.

[0004] At present, scholars at home and abroad have reported a variety of biological preparation routes for D-tagatose. Zheng Xu co-expressed L-arabinose isomerase from Lactobacillus fermentum CGMCC2921 and β-D-galactosidase from Thermus thermophilus HB27 in Escherichia coli, and balanced the expression levels of the two enzymes by optimizing the SD sequence and its distance from the start codon. After 16 hours of reaction, the recombinant bacteria was able to convert lactose to obtain 101g / L D-tagatose, with a yield and time-space yield of 20.2% and 6.3g / L / h, respectively; Chinese patent CN103045575 constructed a recombinant L-arabinose isomerase Bacillus subtilis, and investigated the expression of L-arabinose isomerase and the conditions for converting galactose to prepare D-tagatose. With 100g / L galactose as the substrate, the conversion rate was only about 40% after 10 hours of conversion.

[0005] The D-tagatose preparation method reported above is an isomerization reaction, which has thermodynamic limitations and low substrate conversion efficiency, which greatly increases the raw material cost and downstream separation and purification costs. Jing-Jing Liu et al. heterologously expressed xylose reductase and galactitol dehydrogenase in Saccharomyces cerevisiae to convert galactose into D-tagatose. This reaction has no thermodynamic limitations and the theoretical conversion rate can reach 100%. However, since the two enzymes require different types of coenzymes, they cannot complement each other to achieve coenzyme regeneration, which requires additional coenzymes or live bacteria fermentation, which greatly increases the raw material cost and reaction cycle. Therefore, it would be of great significance if a D-tagatose preparation method with low raw material cost and high conversion efficiency could be obtained.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The present invention aims to provide an aldose reductase mutant and its application in the production of D-tagatose. By performing site-directed mutation on aldose reductase, the aldose reductase mutant obtained can be coupled with galactitol 2-dehydrogenase to cyclically regenerate NADH, and there is no need to add expensive coenzymes NADPH and NAD + , which greatly reduces the preparation cost of D-tagatose.

[0008] The present invention is achieved in that:

[0009] The existing route for preparing D-tagatose is: using galactose as a substrate, D-tagatose is prepared by coupling and converting wild-type aldose reductase (AR) and galactitol 2-dehydrogenase (GDH). However, wild-type AR is an NADPH-dependent enzyme and cannot complement GDH to achieve coenzyme regeneration. Therefore, additional coenzymes need to be added during the production process, which increases the cost of raw materials and prolongs the reaction cycle. In order to improve this problem, the present invention changes the coenzyme preference of AR from NADPH to NADH by site-directed mutagenesis, and combines with NADPH to form NADH. + The D-tagatose is prepared by the GDH-dependent coupled conversion, and the cyclic regeneration of the coenzyme NADH is realized at the same time. The optimized route for synthesizing D-tagatose of the present invention is as follows Figure 1 shown.

[0010] For wild-type AR, the present invention first screens AR with higher enzyme activity from different sources (derived from Candidaboidinii, Genbank number AAL47846.2, amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2), and then performs site-directed mutagenesis on the screened AR to obtain AR mutants. Specifically, the mutation sites of the AR mutant include at least one of the 24th, 50th, 81st, 130th and 225th positions.

[0011] Among them, the mutation mode at position 24 is: valine mutates to any one of alanine, serine or threonine, namely V24A, V24S and V24T.

[0012] The mutation pattern at position 50 is: tyrosine mutates to any one of phenylalanine, leucine, isoleucine or histidine, namely Y50F, Y50L, Y50I and Y50H.

[0013] The mutation pattern at position 81 is: tryptophan mutates to any one of phenylalanine, tyrosine, proline, histidine or methionine, namely W81F, W81Y, W81P, W81H and W81M.

[0014] The mutations at position 130 are: phenylalanine mutates to any one of histidine, lysine or glutamine, namely F130H, F130K and F130Q.

[0015] The mutation pattern at position 225 is: glutamic acid is mutated to any one of glutamine, asparagine, aspartic acid or arginine, namely E225Q, E225N, E225D and E225R.

[0016] The mutations at positions 24, 50, 81, 130, and 225 can convert AR into an NADH-dependent enzyme. + The GDH-dependent coupling can efficiently prepare D-tagatose.

[0017] Furthermore, the mutation mode of the AR mutant is any one or a combination of V24S, Y50L, W81Y, F130K and E225R.

[0018] Furthermore, the AR mutant with the amino acid sequence shown in SEQ ID NO.7 has higher enzyme activity and better production efficiency for D-tagatose. The amino acid sequence shown in SEQ ID NO.7 is a five-point mutation of V24S, Y50L, W81Y, F130K and E225R on the basis of the amino acid sequence shown in SEQ ID NO.1.

[0019] Relevant biological materials can be obtained through the above-mentioned AR mutants, which include: nucleic acid molecules encoding the above-mentioned AR mutants; expression cassettes containing the above-mentioned nucleic acid molecules; recombinant vectors containing the above-mentioned nucleic acid molecules, or recombinant vectors containing the above-mentioned expression cassettes; recombinant bacteria containing the above-mentioned nucleic acid molecules, or recombinant bacteria containing the above-mentioned expression cassettes, or recombinant bacteria containing the above-mentioned recombinant vectors.

[0020] In some embodiments, the method for constructing a recombinant bacterium expressing the above-mentioned AR mutant includes: connecting the nucleotide sequence of the AR mutant to an expression vector, then transforming the obtained recombinant vector into a host cell, culturing the host cell, and inducing expression of the AR mutant.

[0021] The expression vector and host cell can be selected conventionally in the art. In some embodiments, the expression vector is pET28a(+) and the host cell is E. coli BL21(DE3). The catalytic activity of the obtained AR mutant is better than that of the wild-type enzyme by inducing protein expression and crushing cells to obtain a crude enzyme solution using the above method.

[0022] In the present invention, the nucleotide sequence encoding the above AR mutant is shown as SEQ ID NO.8.

[0023] The AR mutant can be used in combination with GDH to synthesize D-tagatose. Based on this, the present invention also provides a whole cell catalyst, which includes the above recombinant bacteria.

[0024] At the same time, the present invention also provides a method for producing D-tagatose, comprising: crushing the recombinant bacteria expressing the AR mutant and the recombinant bacteria expressing GDH, and then adding the supernatant thereof to the transformation system for reaction to obtain D-tagatose.

[0025] In the present invention, GDH is derived from Agrobacterium fabrum, and its amino acid sequence is shown in SEQ ID NO.9, and its nucleotide sequence is shown in SEQ ID NO.10.

[0026] In some embodiments, the host of the recombinant bacteria expressing the AR mutant and GDH includes Escherichia coli.

[0027] In some embodiments, the transformation system comprises: galactose, NADH, K2HPO4-KH2PO4 buffer (pH 7.5-8.0) and recombinant bacteria.

[0028] In some embodiments, the transformation system is: 50-200 mM K2HPO4-KH2PO4 buffer (pH=8.0), 1-20 g / L galactose, 1-5 mM NADH, 2-20 g / L of recombinant bacteria expressing aldose reductase mutants, and 2-20 g / L of recombinant bacteria expressing galactitol 2-dehydrogenase.

[0029] In some embodiments, the reaction conditions are: pH 6.5-8.5, temperature 20-40° C., shaker speed 150-250 rpm, and reaction time 1-10 h.

[0030] The present invention has the following beneficial effects:

[0031] The present invention provides a highly active NADH-dependent aldose reductase mutant and its application in catalyzing galactose to prepare D-tagatose. The mutant has high catalytic activity and can be coupled with galactitol 2-dehydrogenase (GDH) to achieve NADH cyclic regeneration, thereby significantly reducing the preparation cost of D-tagatose. The aldose reductase mutant of the present invention is used to prepare D-tagatose, and 98.2 g / L of D-tagatose can be converted within 5 hours, with a yield of up to 98.2%, which is better than the conversion effect of the wild type and other mutant enzymes. Therefore, the aldose reductase mutant of the present invention has good industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0033] Figure 1 The present invention provides a route map for synthesizing D-tagatose. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0035] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0036] The present invention analyzes the substrate concentration and the product concentration by high performance liquid chromatography (HPLC), and the specific analysis method is as follows:

[0037] The conversion solution was analyzed by Shimadzu LC-20AT high performance liquid chromatograph (HPLC), differential detector RID-20A, and the chromatographic conditions were:

[0038] A BioRad chromatographic column (Aminex HPX-87H 7.8×300 mm, 5 μm) was used; the mobile phase was a 5 mM sulfuric acid aqueous solution; the flow rate was 0.6 mL / min, the column temperature was 60° C., and the injection volume was 20 μL.

[0039] Example 1

[0040] This example is the screening of enzymes, which is as follows:

[0041] 1. Enzyme source and construction of recombinant bacteria

[0042] Aldose reductases were obtained from the NCBI database, which were derived from Candida boidinii (Genbank No. AAL47846.2), Cryptococcus deuterogattii (Genbank No. XP_062884251.1), and Wickerhamomyces ciferrii (Genbank No. XP_011276858.1), and were named CbAR, CdAR, and WcAR, respectively. According to the amino acid sequence, codon optimization was performed according to the codon preference of Escherichia coli, and three nucleotide sequences were synthesized by a total synthesis method through conventional genetic engineering operations, as shown in SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.6, respectively; the amino acid sequences encoding the enzymes are shown in SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.5, respectively. A 6×His-tag was added to the end of the nucleotide sequence, and restriction sites NdeI and XhoI were added at both ends. The gene was cloned into the NdeI and XhoI sites corresponding to pET28a(+) to obtain recombinant expression plasmids pET28a-CbAR, pET28a-CdAR and pET28a-WcAR. The three plasmids were respectively transformed into Escherichia coli BL21(DE3) competent cells to obtain recombinant bacteria Escherichia coli BL21(DE3) / pET28a-CbAR, Escherichia coli BL21(DE3) / pET28a-CdAR and Escherichia coli BL21(DE3) / pET28a-WcAR, respectively.

[0043] 2. Inducible expression of aldose reductase and galactitol 2-dehydrogenase from different sources

[0044] The galactitol 2-dehydrogenase gene GDH (derived from Agrobacterium fabrum, the nucleotide sequence is shown in SEQ ID No. 10, and the amino acid sequence is shown in SEQ ID No. 9) was synthesized to obtain a recombinant galactitol 2-dehydrogenase strain E. coli BL21 (DE3) / pET28a-GDH.

[0045] The recombinant E. coli was inoculated into LB medium containing 50 mg / L kanamycin and cultured at 37°C and 200 rpm for 12 h to obtain seed solution. The seed solution was inoculated into fresh LB medium at a 2% inoculum and cultured at 37°C and 200 rpm until the bacterial concentration OD 600nmWhen the p-value reaches 0.7, 0.5 mM IPTG is added, and the mixture is induced at 28°C for 15 h, followed by centrifugation at 8000 rpm for 10 min, and the supernatant is discarded. The wet cells are washed twice with 0.9% saline, and then centrifuged for later use.

[0046] 3. Comparison of recombinant bacterial enzyme activities

[0047] Enzyme activity determination method: NADH has a maximum absorption peak at 340nm, NAD + The absorption peak at 340nm is zero. By measuring the absorbance of NADH standards with different concentration gradients at 340nm, the relationship curve between different concentrations of NADH and absorbance is obtained.

[0048] The wet cells were ultrasonically disrupted. 1 g of the prepared wet cells were resuspended in 50 mL of 50 mM K2HPO4-KH2PO4 buffer (pH 8.0), and ultrasonically disrupted at 35 W for 15 min to obtain a suspension after ultrasonic disruption. The suspension was centrifuged, the supernatant was collected, and 1 mL of the supernatant was used for the reaction.

[0049] Reaction system: 50 mM K2HPO4-KH2PO4 buffer (pH 8.0), 2 g / L galactose, 2 mM NADH and 100 μL AR crushing supernatant, a total of 1 mL system.

[0050] Reaction conditions: react at 35°C for 5 min, and measure the absorbance of the system at 340 nm using a SpectraMax M5 microplate reader.

[0051] Enzyme activity definition: 1 μmol NADH is oxidized to NAD per minute at 35°C and pH 8.0 + The amount of enzyme required.

[0052] Table 1 Comparison of the activities of various recombinant enzymes

[0053] Strains / plasmids Enzyme activity (U / mL) E. coli BL21(DE3) 0 E.coli BL21(DE3) / pET28a 0 E.coli BL21(DE3) / pET28a-CdAR 0 E.coli BL21(DE3) / pET28a-WcAR 0.01 E.coli BL21(DE3) / pET28a-CbAR 0.03

[0054] As can be seen from Table 1, the aldose reductase from Candida boidinii has a higher enzyme activity.

[0055] Example 2

[0056] This example is the construction and screening of single-site mutants of CbAR screened in Example 1, as follows:

[0057] 1. Construction of mutants

[0058] According to the CbAR parent sequence (amino acid sequence SEQ ID NO.1, nucleotide sequence SEQ ID NO.2), site-directed mutagenesis primers were designed. Rapid PCR technology was used to introduce a single mutation at position 225 using recombinant pET28a-CbAR as a template. The primers were:

[0059] Forward primer 225E: TGTT NNN CTGGACCACCCAAAGGTAAAAGACT(SEQ ID No.11);

[0060] Reverse primer 225E: GGTGGTCCAG NNN AACAAAGCTCTGCGGACCG (SEQ ID No. 12).

[0061] PCR reaction system: 2×FastPfu Fly Reaction Mix 25μL, forward primer 225E (10μM) 2μL, reverse primer 225E (10μM) 2μL, template DNA 1μL, FastPfu Fly DNA Polymerase 1μL, add ddH2O to 50μL.

[0062] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0063] 2. Mutant transformation and expression

[0064] The PCR results were verified by agarose gel electrophoresis. The PCR product was digested with DpnI enzyme template at 37°C for 1 h and inactivated at 65°C for 1 min. 10 μL of PCR product was added to the competent E. coli BL21 (DE3) and heat-shocked for transformation. The culture was cultured at 37°C and 200 rpm for 1 h. The bacterial solution was spread on the plate and cultured at 37°C for 12 h.

[0065] 3. High-throughput screening of positive transformants

[0066] Reaction mixture: 50mM K2HPO4-KH2PO4 buffer (pH 8.0), 2g / L galactose, 2mM NADH; add 200μL LB medium containing a final concentration of 50mg / L kanamycin to each well of a 96-well plate, pick different single colonies in a 96-well plate, culture at 37°C and 200rpm until OD600 reaches 0.5-0.6, add IPTG with a final concentration of 0.5mM to the culture solution, induce expression at 28°C for 12h, centrifuge at 20°C and 4200rpm for 10min, and discard the supernatant. Take 100μL of the reaction mixture and add it to the 96-well plate containing the bacteria, mix well, react at 35°C for 5min, and measure the absorbance of the system at 340nm using an ELISA reader SpectraMax M5. The reaction of the recombinant bacteria E. coli BL21 (DE3) / pET28a-CbAR was used as a control, and the mutant strain with lower absorbance than that of the reaction of E. coli BL21 (DE3) / pET28a-CbAR was taken for accurate determination of enzyme activity.

[0067] 4. Accurate determination of enzyme activity of positive transformants

[0068] The operation was the same as that in Example 1 "Comparison of recombinant bacterial enzyme activity".

[0069] The results of this example are as follows: 522 recombinant transformed bacteria were initially screened, 4 mutants with improved enzyme activity were screened out, and then the enzyme activity was accurately measured, and the specific results are shown in Table 2. After analysis, it was determined that the reason why the enzyme activity of the remaining 518 recombinant bacteria remained unchanged or decreased was that the 225th glutamic acid (E) mutated to other amino acids except Q, N, D and R.

[0070] Table 2 Enzyme activity determination of single point mutation recombinant bacteria

[0071] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR original enzyme 0.03 CbAR mutant-E225Q 0.05 CbAR mutant-E225N 0.1 CbAR mutant-E225D 0.08 CbAR mutant-E225R 0.13

[0072] The CbAR mutant E225R with the greatest increase in enzyme activity was named CbAR-1, and the recombinant bacterium E. coli BL21 (DE3) / pET28a-CbAR-1 was obtained.

[0073] Example 3

[0074] This example is the construction and screening of CbAR double-site mutants, as follows:

[0075] According to the sequence of the single mutant CbAR-1 constructed in Example 2, site-directed mutagenesis primers were designed. Rapid PCR technology was used to introduce a single mutation at position 81 using recombinant pET28a-CbAR-1 as a template. The primers were:

[0076] Forward primer 81W: CCAAACTG NNNAACAACTTCCATCATCCAGATAGCG(SEQ ID No.13);

[0077] Reverse primer 81W: GTTGTT NNN CAGTTTGGATACGATAAACAGTCCC (SEQ ID No. 14).

[0078] PCR reaction system: 2×FastPfu Fly Reaction Mix 25μL, forward primer 81W (10μM) 2μL, reverse primer 81W (10μM) 2μL, template DNA 1μL, FastPfu Fly DNA Polymerase 1μL, add ddH2O to 50μL.

[0079] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0080] The PCR results were verified by agarose gel electrophoresis. The PCR products were digested with DpnI enzyme templates at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of PCR products were added to the competent cells of E. coli BL21 (DE3), and heat-shocked for transformation. The cells were cultured at 37°C and 200 rpm for 1 hour. The bacterial solution was plated and cultured at 37°C for 12 hours. The mutants were preliminarily screened (the operation was the same as that of "high-throughput screening of positive transformants" in Example 2).

[0081] The wet bacteria were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of recombinant bacterial enzyme activity" in Example 1).

[0082] The results of this example are as follows: 625 recombinant transformed bacteria were initially screened, and 5 mutants with improved enzyme activity were screened out, and then the enzyme activity was accurately measured, and the specific results are shown in Table 3. After analysis, it was determined that the reason why the enzyme activity of the remaining 620 recombinant bacteria remained unchanged or decreased was that the 81st tryptophan (W) mutated to other amino acids except F, Y, P, H and M.

[0083] Table 3 Enzyme activity determination of double-point mutation recombinant bacteria

[0084] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR mutant-E225R 0.13 CbAR mutant-E225R-W81F 0.35 CbAR mutant-E225R-W81Y 0.76 CbAR mutant-E225R-W81P 0.52 CbAR mutant-E225R-W81H 0.43 CbAR mutant-E225R-W81M 0.28

[0085] The CbAR mutant E225R-W81Y with the greatest enzyme activity improvement was named CbAR-2, and the recombinant bacterium E. coli BL21 (DE3) / pET28a-CbAR-2 was obtained.

[0086] Example 4

[0087] This example is the construction and screening of three-point mutants of CbAR, as follows:

[0088] According to the sequence of the single mutant CbAR-2 constructed in Example 3, site-directed mutagenesis primers were designed. Rapid PCR technology was used to introduce a single mutation at position 24 using recombinant pET28a-CbAR-2 as a template. The primers were:

[0089] Forward Primer 24V:

[0090] CGGCTGTTGGAAA NNN GACAACGCAACTTGTGCTGAGA(SEQ IDNo.15);

[0091] Reverse primer 24V:C NNN TTTCCAACAGCCGAAACCGATCTGAGGC (SEQ ID No. 16).

[0092] PCR reaction system: 2×FastPfu Fly Reaction Mix 25μL, forward primer 24V (10μM) 2μL, reverse primer 24V (10μM) 2μL, template DNA 1μL, FastPfu Fly DNA Polymerase 1μL, add ddH2O to 50μL.

[0093] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0094] The PCR results were verified by agarose gel electrophoresis. The PCR products were digested with DpnI enzyme templates at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of PCR products were added to the competent cells of E. coli BL21 (DE3), and heat-shocked for transformation. The cells were cultured at 37°C and 200 rpm for 1 hour. The bacterial solution was plated and cultured at 37°C for 12 hours. The mutants were preliminarily screened (the operation was the same as that of "high-throughput screening of positive transformants" in Example 2).

[0095] The wet bacteria were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of recombinant bacterial enzyme activity" in Example 1).

[0096] The results of this example are as follows: 471 recombinant transformed bacteria were initially screened, 3 mutants with improved enzyme activity were screened out, and then the enzyme activity was accurately measured, and the specific results are shown in Table 4. After analysis, it was determined that the reason why the enzyme activity of the remaining 468 recombinant bacteria remained unchanged or decreased was that the 24th valine (V) mutated to other amino acids except A, S and T.

[0097] Table 4 Enzyme activity determination of triple-point mutation recombinant bacteria

[0098] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR mutant-E225R-W81Y 0.76 CbAR mutant-E225R-W81Y-V24A 1.2 CbAR mutant-E225R-W81Y-V24S 5.4 CbAR mutant-E225R-W81Y-V24T 3.5

[0099] The CbAR mutant E225R-W81Y-V24S with the greatest increase in enzyme activity was named CbAR-3, and the recombinant bacterium E. coli BL21 (DE3) / pET28a-CbAR-3 was obtained.

[0100] Example 5

[0101] This example is the construction and screening of CbAR four-site mutants, as follows:

[0102] According to the sequence of the single mutant CbAR-3 constructed in Example 4, site-directed mutagenesis primers were designed. Rapid PCR technology was used to introduce a single mutation at position 50 using recombinant pET28a-CbAR-3 as a template. The primers were:

[0103] Forward primer 50Y: TGGAC NNN GGTAACGAGAAGGAAGTTGGTGAA (SEQ ID No. 17);

[0104] Reverse primer 50Y: CTCGTTACC NNN GTCCATTGCGCCGTCGAACA (SEQ ID No. 18).

[0105] PCR reaction system: 2×FastPfu Fly Reaction Mix 25μL, forward primer 50Y (10μM) 2μL, reverse primer 50Y (10μM) 2μL, template DNA 1μL, FastPfu Fly DNA Polymerase 1μL, add ddH2O to 50μL.

[0106] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0107] The PCR results were verified by agarose gel electrophoresis. The PCR products were digested with DpnI enzyme templates at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of PCR products were added to the competent cells of E. coli BL21 (DE3), and heat-shocked for transformation. The cells were cultured at 37°C and 200 rpm for 1 hour. The bacterial solution was plated and cultured at 37°C for 12 hours. The mutants were preliminarily screened (the operation was the same as that of "high-throughput screening of positive transformants" in Example 2).

[0108] The wet bacteria were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of recombinant bacterial enzyme activity" in Example 1).

[0109] The results of this example are as follows: 588 recombinant transformed bacteria were initially screened, 4 mutants with improved enzyme activity were screened out, and then the enzyme activity was accurately measured, and the specific results are shown in Table 5. After analysis, it was determined that the reason why the enzyme activity of the remaining 584 recombinant bacteria remained unchanged or decreased was that the 50th tyrosine (Y) mutated to other amino acids except F, L, I and H.

[0110] Table 5 Enzyme activity determination of four-point mutation recombinant bacteria

[0111] Original enzyme or mutant Enzyme activity (U / mL) E. coli BL21(DE3) without CbAR 0 CbAR mutant-E225R-W81Y-V24S 5.4 CbAR mutant-E225R-W81Y-V24S-Y50F 8.9 CbAR mutant-E225R-W81Y-V24S-Y50L 21.3 CbAR mutant-E225R-W81Y-V24S-Y50I 18.5 CbAR mutant-E225R-W81Y-V24S-Y50H 12.3

[0112] The CbAR mutant E225R-W81Y-V24S-Y50L with the greatest enzyme activity improvement was named CbAR-4, and the recombinant bacterium E. coli BL21 (DE3) / pET28a-CbAR-4 was obtained.

[0113] Example 6

[0114] This example is the construction and screening of CbAR five-site mutants, as follows:

[0115] According to the sequence of the single mutant CbAR-4 constructed in Example 5, site-directed mutagenesis primers were designed. Rapid PCR technology was used to introduce a single mutation at position 130 using recombinant pET28a-CbAR-4 as a template. The primers were:

[0116] Forward primer 130F: GCCGAAT NNN TACTGCGGGTGACGGTGACAAAT (SEQ ID No. 19);

[0117] Reverse primer 130F: CGCAGTA NNN ATTCGGCGGATACTTTTTTTCG (SEQ ID No. 20).

[0118] PCR reaction system: 2×FastPfu Fly Reaction Mix 25μL, forward primer 130F (10μM) 2μL, reverse primer 130F (10μM) 2μL, template DNA 1μL, FastPfu Fly DNA Polymerase 1μL, add ddH2O to 50μL.

[0119] PCR amplification conditions: 95°C for 5 min; 30 cycles of (95°C for 20 s, 60°C for 15 s, 72°C for 1.5 min); 72°C for 10 min.

[0120] The PCR results were verified by agarose gel electrophoresis. The PCR products were digested with DpnI enzyme templates at 37°C for 1 hour and inactivated at 65°C for 1 minute. 10 μL of PCR products were added to the competent cells of E. coli BL21 (DE3), and heat-shocked for transformation. The cells were cultured at 37°C and 200 rpm for 1 hour. The bacterial solution was plated and cultured at 37°C for 12 hours. The mutants were preliminarily screened (the operation was the same as that of "high-throughput screening of positive transformants" in Example 2).

[0121] The wet bacteria were ultrasonically disrupted and the enzyme activity was accurately determined (the operation was the same as the "Comparison of recombinant bacterial enzyme activity" in Example 1).

[0122] The results of this example are as follows: 350 recombinant transformed bacteria were initially screened, 3 mutants with improved enzyme activity were screened out, and then the enzyme activity was accurately measured, and the specific results are shown in Table 6. After analysis, it was determined that the reason why the enzyme activity of the remaining 347 recombinant bacteria remained unchanged or decreased was that the 130th phenylalanine (F) mutated to other amino acids except H, K and Q.

[0123] Table 6 Enzyme activity determination of five-point mutation recombinant bacteria

[0124]

[0125]

[0126] The CbAR mutant E225R-W81Y-V24S-Y50L-F130K with the greatest enzyme activity improvement was named CbAR-5, and the recombinant bacteria E. coli BL21 (DE3) / pET28a-CbAR-5 were obtained.

[0127] Example 6

[0128] This example is a dual enzyme coupling of aldose reductase CbAR and galactitol 2-dehydrogenase GDH to convert galactose to prepare D-tagatose

[0129] According to the induction expression method described in Example 1, after the induction expression of E. coli BL21 (DE3) / pET28a-CbAR and E. coli BL21 (DE3) / pET28a-GDH was completed, the bacteria were collected, and according to the ultrasonic fragmentation method described in Example 1, the two bacteria were ultrasonically fragmented to obtain CbAR supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature 30°C, shaking speed 200 rpm, and conversion time 5 h.

[0130] The results of HPLC determination showed that the residual amount of galactose was 99.5 g / L, the accumulated amount of galactitol was 0.5 g / L, the output of D-tagatose was 0.1 g / L, and the yield of D-tagatose was 0.1%.

[0131] Example 7

[0132] This example is a dual enzyme coupling of aldose reductase CbAR-1 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0133] According to the induction expression method described in Example 1, after the induction expression of E. coli BL21 (DE3) / pET28a-CbAR-1 and E. coli BL21 (DE3) / pET28a-GDH was completed, the bacteria were collected, and according to the ultrasonic fragmentation method described in Example 1, the two bacteria were ultrasonically fragmented to obtain CbAR-1 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-1 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH was 8.0, the temperature was 30°C, the shaking speed was 200 rpm, and the conversion time was 5 h.

[0134] The results of HPLC determination showed that the residual amount of galactose was 98.7 g / L, the accumulated amount of galactitol was 1.1 g / L, the output of D-tagatose was 0.39 g / L, and the yield of D-tagatose was 0.39%.

[0135] Example 8

[0136] This example is a dual enzyme coupling of aldose reductase CbAR-2 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0137] According to the induction expression method described in Example 1, after the induction expression of E. coli BL21 (DE3) / pET28a-CbAR-1 and E. coli BL21 (DE3) / pET28a-GDH was completed, the bacteria were collected, and according to the ultrasonic fragmentation method described in Example 1, the two bacteria were ultrasonically fragmented to obtain CbAR-2 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-2 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature 30°C, shaking speed 200 rpm, and conversion time 5 h.

[0138] The results of HPLC determination showed that the residual amount of galactose was 94.7 g / L, the accumulated amount of galactitol was 3.3 g / L, the output of D-tagatose was 2.2 g / L, and the yield of D-tagatose was 2.2%.

[0139] Example 9

[0140] This example is a dual enzyme coupling of aldose reductase CbAR-3 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0141] According to the induction expression method described in Example 1, after the induction expression of E. coli BL21 (DE3) / pET28a-CbAR-3 and E. coli BL21 (DE3) / pET28a-GDH was completed, the bacteria were collected, and according to the ultrasonic fragmentation method described in Example 1, the two bacteria were ultrasonically fragmented to obtain CbAR-3 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-3 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH was 8.0, the temperature was 30°C, the shaking speed was 200 rpm, and the conversion time was 5 h.

[0142] The results of HPLC determination showed that the residual amount of galactose was 66.4 g / L, the accumulated amount of galactitol was 19.7 g / L, the output of D-tagatose was 15.5 g / L, and the yield of D-tagatose was 15.5%.

[0143] Example 10

[0144] This example is a dual enzyme coupling of aldose reductase CbAR-4 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0145] According to the induction expression method described in Example 1, after the induction expression of E. coli BL21 (DE3) / pET28a-CbAR-4 and E. coli BL21 (DE3) / pET28a-GDH was completed, the bacteria were collected, and according to the ultrasonic fragmentation method described in Example 1, the two bacteria were ultrasonically fragmented to obtain CbAR-4 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-4 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH was 8.0, the temperature was 30°C, the shaking speed was 200 rpm, and the conversion time was 5 h.

[0146] The results of HPLC determination showed that the residual amount of galactose was 15.3 g / L, the accumulated amount of galactitol was 21.2 g / L, the output of D-tagatose was 65.3 g / L, and the yield of D-tagatose was 65.3%.

[0147] Embodiment 11

[0148] This example is a dual enzyme coupling of aldose reductase CbAR-5 and galactitol 2-dehydrogenase GDH to convert galactose to produce D-tagatose

[0149] According to the induction expression method described in Example 1, after the induction expression of E. coli BL21 (DE3) / pET28a-CbAR-5 and E. coli BL21 (DE3) / pET28a-GDH was completed, the bacteria were collected, and according to the ultrasonic fragmentation method described in Example 1, the two bacteria were ultrasonically fragmented to obtain CbAR-5 supernatant and GDH supernatant. In a 50 mL system, the wet weight of bacterial CbAR-5 (added in the form of the supernatant) was 10 g / L, the wet weight of bacterial GDH (added in the form of the supernatant) was 10 g / L, galactose was 100 g / L, pH 8.0, temperature 30°C, shaking speed 200 rpm, and conversion time 5 h.

[0150] The results of HPLC determination showed that the residual amount of galactose was 0.7 g / L, the accumulated amount of galactitol was 1.12 g / L, the output of D-tagatose was 98.2 g / L, and the yield of D-tagatose was 98.2%.

[0151] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An aldose reductase mutant, characterized in that The aldose reductase mutant undergoes an amino acid mutation in the amino acid sequence shown in SEQ ID NO.1, and the site of the amino acid mutation is at least one of the 24th, 50th, 81st, 130th and 225th positions.

2. The aldose reductase mutant according to claim 1, characterized in that The aldose reductase mutant is any one or more combinations of the following (1)-(5): (1) mutating the valine at position 24 in the amino acid sequence shown in SEQ ID NO.1 to any one of alanine, serine or threonine; (2) mutating the tyrosine at position 50 in the amino acid sequence shown in SEQ ID NO.1 to any one of phenylalanine, leucine, isoleucine or histidine; (3) mutating the tryptophan at position 81 in the amino acid sequence shown in SEQ ID NO.1 to any one of phenylalanine, tyrosine, proline, histidine or methionine; (4) mutating the phenylalanine at position 130 in the amino acid sequence shown in SEQ ID NO.1 to any one of histidine, lysine or glutamine; (5) The glutamic acid at position 225 in the amino acid sequence shown in SEQ ID NO. 1 is mutated to any one of glutamine, asparagine, aspartic acid or arginine.

3. The aldose reductase mutant according to claim 2, characterized in that The mutation mode of the aldose reductase mutant is any one or more combinations of the following (1)-(6): (1) mutating the valine at position 24 in the amino acid sequence shown in SEQ ID NO.1 to serine; (2) mutating the tyrosine at position 50 in the amino acid sequence shown in SEQ ID NO.1 to leucine; (3) mutating the tryptophan at position 81 in the amino acid sequence shown in SEQ ID NO.1 to tyrosine; (4) mutating the phenylalanine at position 130 in the amino acid sequence shown in SEQ ID NO.1 to lysine; (5) The glutamic acid at position 225 in the amino acid sequence shown in SEQ ID NO. 1 is mutated to arginine.

4. The aldose reductase mutant according to claim 3, characterized in that The amino acid sequence of the aldose reductase mutant is shown in SEQ ID NO.

7.

5. A biological material related to the aldose reductase mutant according to any one of claims 1 to 4, characterized in that: Any one of the following (1)-(4): (1) A nucleic acid molecule encoding the aldose reductase mutant according to any one of claims 1 to 4; (2) an expression cassette containing the nucleic acid molecule described in (1); (3) a recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2); (4) A recombinant bacterium containing the nucleic acid molecule described in (1), the expression cassette described in (2), or the recombinant vector described in (3).

6. A whole cell catalyst, characterized in that The whole cell catalyst includes the recombinant bacteria described in claim 5.

7. Use of the aldose reductase mutant according to any one of claims 1 to 4 or the biomaterial according to claim 5 in the synthesis of D-tagatose and its downstream products.

8. A method for synthesizing D-tagatose, characterized in that: include: The recombinant bacteria expressing the aldose reductase mutant according to any one of claims 1 to 4 and the recombinant bacteria expressing galactitol 2-dehydrogenase are disrupted, and then the supernatants thereof are added to the conversion system for reaction to obtain D-tagatose.

9. The method according to claim 8, characterized in that The amino acid sequence of the galactitol 2-dehydrogenase is shown in SEQ ID NO.

9.

10. The method according to claim 8, characterized in that The transformation system comprises: galactose, NADH, K2HPO4-KH2PO4 buffer (pH=8.0) and recombinant bacteria; Preferably, the transformation system comprises: 50-200 mM K2HPO4-KH2PO4 buffer (pH=8.0), 1-20 g / L galactose, 1-5 mM NADH, 2-20 g / L of recombinant bacteria expressing aldose reductase mutant, and 2-20 g / L of recombinant bacteria expressing galactitol 2-dehydrogenase; Preferably, the reaction conditions are: pH 6.5-8.5, temperature 20-40° C., shaker speed 150-250 rpm, and reaction time 1-10 h.

Images