Method for synthesizing D-tagatose through multi-enzyme cascade catalysis

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for synthesizing D-tagatose through multi-enzyme cascade catalysis, lactose is used as a substrate, and the D-tagatose is synthesized through synchronous cascade catalysis of beta-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1, 6-diphosphate aldolase, polyphosphate kinase and phosphatase. According to the invention, the intermediate product D-glucose is continuously converted into D-tagatose, so that the conversion rate of D-tagatose is increased, a new method is provided for synthesizing D-tagatose from lactose, and certain theoretical basis and technical support are provided for realizing industrial production of D-tagatose with high added value.

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology, and specifically relates to a method for synthesizing D-tagatose by multi-enzyme cascade catalysis. Background Art

[0002] D-tagatose is a rare ketohexose found in nature. Its sweetness is 92% of sucrose, but its calories are only 38% of sucrose, so it is called a low-calorie sweetener. It has many physiological effects such as improving intestinal flora, lowering blood sugar, preventing oral diseases, and preventing obesity. It can be safely used in food, medicine, cosmetics and other fields. At present, the market share of D-tagatose is increasing year by year, and it has great application value.

[0003] The content of D-tagatose in nature is very low, and it mainly exists in some lower plants, such as lichens, mosses, etc. The natural extraction method requires a lot of raw materials to obtain D-tagatose, which is costly and difficult to meet market demand. The chemical synthesis method has extremely high requirements for reaction conditions, and there will be more by-products produced during the reaction process, which leads to problems such as difficulty in subsequent separation and purification and low yield. The biosynthesis method has the advantages of mild reaction conditions, few by-products, high product purity, and low cost, and has become the preferred method for industrial production of D-tagatose.

[0004] The production of D-tagatose by biosynthesis mainly uses lactose as raw material, which is completed by β-galactosidase and L-arabinose isomerase. However, this method has a low conversion rate, and the excessive content of intermediates will inhibit the hydrolysis of β-galactosidase. Therefore, it is urgent to develop a new low-cost, low-pollution, and high-yield D-tagatose preparation method. Summary of the invention

[0005] The purpose of the present invention is to provide a method for synthesizing D-tagatose by multi-enzyme cascade catalysis, thereby overcoming the shortcomings of the prior art, using lactose as the initial raw material, designing a novel multi-enzyme cascade catalytic reaction system based on double enzyme conversion, thereby further improving the yield of tagatose, and providing a new idea for the production of tagatose.

[0006] In order to achieve the above object, the technical solution of the present invention is:

[0007] In a first aspect, the present invention provides a composite enzyme for synthesizing D-tagatose by multi-enzyme cascade catalysis, which is composed of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase.

[0008] In some embodiments, the β-galactosidase is β-Gal derived from Bacillus stearothermophilus, and the NCBI accession number of its encoding gene sequence is PQ460712;

[0009] The L-arabinose isomerase is L-AI from Thermotoganeapolitana, and the NCBI accession number of its encoding gene sequence is AY225311.1;

[0010] The glucose isomerase is derived from GI of Acidothermus cellulolyticus, and the NCBI accession number of its coding gene sequence is PQ790157;

[0011] The fructokinase is FK derived from Escherichia coli K12, and the NCBI accession number of its encoding gene sequence is PQ790158;

[0012] The tagatose-1,6-bisphosphate aldolase is GatZ from the thermostable bacterium Thermoanaerobacterindiensis, and the NCBI accession number of its encoding gene sequence is PQ801086;

[0013] The polyphosphate kinase is PPK derived from Archaeoglobus profundus, and the NCBI accession number of its coding gene sequence is PQ790159;

[0014] The phosphatase is PGP derived from Sinorhizobium meliloti, and the NCBI accession number of the coding gene sequence is PQ809484.

[0015] In some embodiments, the concentration of β-galactosidase is 0.5-1.0 U / mL;

[0016] The concentration of the L-arabinose isomerase is 1-2 U / mL;

[0017] The concentration of the glucose isomerase is 0.5-1.5 U / mL;

[0018] The concentration of the fructokinase is 1-3U / mL;

[0019] The concentration of the polyphosphate kinase is 1-3U / mL;

[0020] The concentration of tagatose-1,6-bisphosphate aldolase is 0.5-1.5 U / mL;

[0021] The concentration of the phosphatase is 0.5-1.5 U / mL.

[0022] In a second aspect, the present invention provides a method for synthesizing D-tagatose by multi-enzyme cascade catalysis, using the composite enzyme described in the first aspect, comprising the following steps:

[0023] adding metal ions, β-galactosidase and L-arabinose isomerase into a buffer solution of a lactose substrate to carry out a double enzyme catalytic reaction to obtain a double enzyme catalytic reaction product;

[0024] Polyphosphate, glucose isomerase, fructose kinase, polyphosphate kinase, tagatose-1,6-bisphosphate aldolase and phosphatase are added to the product of the double enzyme catalytic reaction to carry out a five-enzyme catalytic reaction to obtain D-tagatose.

[0025] In some embodiments, the metal ion is Mn 2+ Mg 2+ 、Co 2+ and Ni 2+ One of;

[0026] The concentration of the metal ion is 1-10 mM;

[0027] The buffer solution is a sodium phosphate buffer with a pH of 6.5-7.0;

[0028] The temperature of the dual enzyme catalytic reaction is 55-60°C and the time is 24-26h.

[0029] In some embodiments, the concentration of the lactose substrate is 50-150 g / L;

[0030] The products of the double enzyme catalytic reaction are D-tagatose and D-glucose.

[0031] In some embodiments, the polyphosphate is one of sodium hexametaphosphate and sodium tripolyphosphate;

[0032] The concentration of the polyphosphate is 20-50 mM;

[0033] The concentration of D-glucose is 50-100 g / L;

[0034] The temperature of the five-enzyme catalytic reaction is 45-55° C. and the time is 20-50 hours.

[0035] In a third aspect, the present invention provides an engineered bacterium comprising an enzyme encoding gene of the complex enzyme described in the first aspect;

[0036] The enzyme encoding gene is one or more of the β-galactosidase gene BgaB, the L-arabinose isomerase gene araA, the glucose isomerase gene GI, the fructokinase gene FK, the polyphosphate kinase gene PPK, the tagatose-1,6-bisphosphate aldolase gene GatZ and the phosphatase gene PGP;

[0037] The engineered bacteria is Escherichia coli.

[0038] In some embodiments, the engineered bacteria is Escherichia coli BL21 (DE3).

[0039] In a fourth aspect, the present invention provides a method for constructing the engineered bacteria described in the third aspect, comprising transferring the enzyme encoding gene into a host cell.

[0040] Beneficial effects of the present invention:

[0041] (1) During the conversion of D-tagatose by the dual enzyme method of the present invention, an intermediate product D-glucose is generated. If the content of the intermediate product is too high, it will inhibit the hydrolysis of β-galactosidase.

[0042] (2) The present invention provides a method for improving the synthesis of D-tagatose based on a multi-enzyme cascade reaction. Lactose is used as the initial raw material, and a new multi-enzyme cascade catalytic reaction system is designed based on double enzyme conversion to improve the conversion rate of D-tagatose.

[0043] (3) The present invention provides a new method for synthesizing D-tagatose from lactose, and also provides a certain theoretical basis and technical support for the industrial production of high value-added D-tagatose. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0045] Figure 1 is the plasmid map of the recombinant vector;

[0046] Figure 2 It is the identification diagram of the engineering strain, where (A) is the resistance plate identification of the engineering strain, and (B) is the molecular identification of the engineering strain;

[0047] Figure 3 is the expression and purification diagram of the recombinant enzyme;

[0048] Figure 4 It is a schematic diagram of the catalytic pathway of the biosynthesis of D-tagatose via a multi-enzyme cascade reaction;

[0049] Figure 5It is an optimization diagram of the inducible expression conditions of the recombinase;

[0050] Figure 6 The reaction time, temperature, and Mn of the double enzyme conversion of D-tagatose 2+ Optimization diagram of concentration;

[0051] Figure 7 The figures are high performance liquid chromatograms of D-tagatose, wherein (A) is the liquid chromatogram of D-tagatose synthesized by two enzymes, and (B) is the liquid chromatogram of D-tagatose synthesized by five enzymes. DETAILED DESCRIPTION

[0052] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in combination with specific embodiments and comparative examples. The experimental methods used in the following embodiments are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial sources.

[0053] The sources of biological materials used in the present invention are as follows:

[0054] Protein molecular weight standards were purchased from Shanghai Bio-Tech Biotechnology Co., Ltd.;

[0055] Bacterial genomic DNA extraction kit, DNA purification and recovery kit, endotoxin-free plasmid extraction kit, and DNA molecular weight standard were purchased from Beijing Tiangen Biochemical Technology Co., Ltd.;

[0056] High-fidelity DNA polymerase, recombinant cloning kit, Escherichia coli BL21 (DE3), and expression vector pET28a (+) were purchased from Nanjing Novozymes Biotech Co., Ltd.;

[0057] Lactose, D-galactose, D-glucose, and D-tagatose standards were purchased from Sigma-Aldrich;

[0058] Restriction endonucleases BamHI and XhoⅠ were purchased from NEB;

[0059] Other analytically pure reagents were purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd.;

[0060] The β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase in the catalytic system involved in the embodiment of the present invention can be obtained by prokaryotic expression according to genetic engineering methods.

[0061] Example 1

[0062] Construction of recombinant expression vector and acquisition of engineered bacteria

[0063] 1.1 Construction of recombinant expression vector

[0064] According to the bacterial genomic DNA extraction kit, genomic DNA of Bacillus stearothermophilus, Thermotoganeapolitana, Acidothermus cellulolyticus, Escherichia coli K12, Thermoanaerobacterindiensis and Archaeoglobus profundus were extracted respectively; full-length primers were designed for amplification, and the primer sequences were SEQ ID NO.1-SEQ ID NO.14, and the specific sequences were: ATGAATGTGTTATCCTCAATTTGTTAC (SEQ ID NO.1), CTAAACCTTCCCGGCTTCATC (SEQ ID NO.2), ATGCTGTCATTACGTCCTTATGAAT (SEQ ID NO.3), TTACCGTCCCCGCCAGAATAC (SEQ ID NO.4), ATGTCACTCACCACTGCATCG (SEQ ID NO.5), TCAGCCGCGTGCGCCGA (SEQ ID NO.6),

[0065] ATGCGTATAGGTATCGATTTAGGC(SEQ ID NO.7),

[0066] TTACTCTTGGTGGCCATAACCAC(SEQ ID NO.8),

[0067] ATGAACACCGAACATCCGCTG(SEQ ID NO.9),

[0068] TTAAATCAGTTTAAATTCGCCGCTG (SEQ ID NO. 10),

[0069] ATGGCATTGGATGAAGCCCCG (SEQ ID NO.11),

[0070] TTAACGAAGAAATCCCGGTCCG (SEQ ID NO. 12),

[0071] ATGTTTAAAGCTCTAGTAGTTGATATA (SEQ ID NO. 13), TTAGATAAGGCCAGGAACTCCA (SEQ ID NO. 14).

[0072] Using genomic DNA as a template, PCR amplification was performed using a high-fidelity PCR polymerase to obtain a gene expression cassette; a DNA recovery kit was used to recover and purify the amplified product; the recovered product was connected to a T vector and transformed into Escherichia coli DH5a to obtain a positive clone single colony for sequencing; the above correctly sequenced genes were connected to the expression vector pET28a(+) using restriction endonucleases BamHⅠ and XhoⅠ using homologous recombination, while retaining the 6×His tag of pET28a(+) itself to obtain a recombinant expression vector.

[0073] Figure 1 It is the plasmid map of the recombinant vector, and the results show that the β-galactosidase gene BgaB was isolated, with the NCBI accession number PQ460712 and a sequence length of 2019bp; the L-arabinose isomerase gene araA was isolated, with the NCBI accession number AY225311.1 and a sequence length of 1491bp; the glucose isomerase gene GI was isolated, with the NCBI accession number PQ790157; the fructose kinase gene FK was isolated, with the NCBI accession number PQ790158 and a sequence length of 909bp; the tagatose-1,6-bisphosphate aldolase gene GatZ was isolated, with the NCBI accession number PQ801086 and a sequence length of 1341bp; the polyphosphate kinase gene PPK was isolated, with the NCBI accession number PQ790159 and a sequence length of 903bp; and the phosphatase gene PGP was isolated, with the NCBI accession number PQ809484. The obtained recombinant vector contains the strong promoter T7, the N-terminal tag His6 tag-T7 tag, the C-terminal tag His6tag, the protease cleavage site Thrombin, the resistance screening gene Kana and the complete sequence of each gene expression cassette.

[0074] 1.2 Obtaining engineered bacteria

[0075] The recombinant vector plasmids constructed in 1.1 were extracted according to the plasmid extraction kit; the recombinant vector plasmids were transformed into competent cells with reference to the instruction manual of Escherichia coli BL21 (DE3) competent cells; 100 μL of the transformation solution was evenly spread on an LB plate containing Kana resistance to observe the appearance of transformants; the transformants were picked and continuously transferred on the LB plate containing Kana resistance for three generations to obtain stable genetic positive transformants; single colonies were picked for isolation and culture, and further molecular identification was performed using vector primers TAATACGACTCACTATAGGG (SEQ ID NO.15) and GCTAGTTATTGCTCAGCGG (SEQ ID NO.16).

[0076] Figure 2The results of the engineering strain identification show that: Figure 2 A) and molecular identification ( Figure 2 B) The engineered bacteria BL2-pET28a-BgaB, BL2-pET28a-araA, BL2-pET28a-GI, BL2-pET28a-FK, BL2-pET28a-PPK, BL2-pET28a-GatZ and BL2-pET28a-PGP were successfully obtained.

[0077] Example 2

[0078] Preparation of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase

[0079] At an inoculum size of 1%, the engineered bacteria in 1.2 (BL2-pET28a-BgaB, BL2-pET28a-araA, BL2-pET28a-GI, BL2-pET28a-FK, BL2-pET28a-PPK, BL2-pET28a-GatZ and BL2-pET28a-PGP) were inoculated into LB liquid medium containing Kana resistance, and cultured at 37°C and 180rpm until OD600 was about 0.6; IPTG was added at a final concentration of 0.5mM, and induced at 15°C and 150rpm for 16h; the cells were collected by centrifugation at 4°C and 10000rpm for 10min, and 0.2mol / L, pH The bacteria were washed twice with 6.5 Na2HPO4-NaH2PO4 buffer, and finally resuspended in a buffer with 10 times the wet weight volume (m / V) of the bacteria to obtain a bacterial suspension; the bacterial suspension was crushed using a SCIENTZ-ⅡD ultrasonic cell crusher, and the bacterial suspension was placed on ice and ultrasonicated at 225W for 10 min (on 3s, off 3s); the cell fragments were centrifuged at 10000rpm and 4°C for 10 min, and the supernatant was filtered through a 0.22μm filter; the supernatant was loaded onto 2mL nickel-triscarboxymethylethylenediamine agarose (Ni-TED) resin at 4°C and eluted with 50mM imidazole; the purified enzyme protein was subjected to SDS-PAGE electrophoresis to verify the size of the target protein.

[0080] Figure 3The expression and purification diagram of the recombinant enzymes. The SDS-PAGE results show that the protein molecular weights of β-galactosidase (β-Gal), L-arabinose isomerase (L-AI), glucose isomerase (GI), fructokinase (FK), polyphosphate kinase (PPK), tagatose-1,6-bisphosphate aldolase (GatZ), and phosphatase (PGP) are 78kDa, 56kDa, 44.7kDa, 35kDa, 34.8kDa, 51.7kDa, and 25.4kDa, respectively. The above enzymes were successfully expressed in Escherichia coli after IPTG induction, and the purity after purification was high, which can be used for subsequent in vitro catalytic reactions.

[0081] Wherein, the β-galactosidase is β-Gal derived from Bacillus stearothermophilus, and the NCBI accession number of its encoding gene sequence is PQ460712;

[0082] The L-arabinose isomerase is L-AI from Thermotoganeapolitana, and the NCBI accession number of its encoding gene sequence is AY225311.1;

[0083] The glucose isomerase is derived from GI of Acidothermus cellulolyticus, and the NCBI accession number of its coding gene sequence is PQ790157;

[0084] The fructokinase is FK derived from Escherichia coli K12, and the NCBI accession number of its encoding gene sequence is PQ790158;

[0085] The tagatose-1,6-bisphosphate aldolase is GatZ from the thermostable bacterium Thermoanaerobacterindiensis, and the NCBI accession number of its encoding gene sequence is PQ801086;

[0086] The polyphosphate kinase is PPK derived from Archaeoglobus profundus, and the NCBI accession number of its coding gene sequence is PQ790159;

[0087] The phosphatase is PGP derived from Sinorhizobium meliloti, and the NCBI accession number of the coding gene sequence is PQ809484.

[0088] Example 3

[0089] Biosynthesis of D-tagatose by Multienzyme Cascade in Vitro

[0090] 3.1 Catalytic pathway for the synthesis of D-tagatose via multi-enzyme cascade reaction

[0091] The invention designs an in vitro multi-enzyme cascade reaction on the basis of synthesizing D-tagatose by two enzymes (β-galactosidase (β-Gal) and L-arabinose isomerase (L-AI)), and converts D-glucose, a byproduct of the two-enzyme conversion, into D-tagatose by five enzymes (glucose isomerase (GI), fructokinase (FK), polyphosphate kinase (PPK), tagatose-1,6-bisphosphate aldolase (GatZ) and phosphatase (PGP)). Figure 4 This is a schematic diagram of the catalytic pathway for the biosynthesis of D-tagatose via a multi-enzyme cascade reaction.

[0092] The functions of key enzymes in the catalytic process of D-tagatose synthesis by multi-enzyme cascade reaction are as follows:

[0093] (1) β-galactosidase (β-Gal), which catalyzes lactose to produce D-galactose and D-glucose;

[0094] (2) L-arabinose isomerase (L-AI), catalyzing the conversion of D-galactose to D-tagatose;

[0095] (3) Glucose isomerase (GI), catalyzes D-glucose to produce D-fructose;

[0096] (4) Fructose kinase (FK), catalyzes the conversion of D-fructose to fructose 6-phosphate;

[0097] (5) Polyphosphate kinase (PPK), which can use polyphosphate (PolyP) as a phosphate group donor to achieve efficient and directional transfer of phosphate groups between AMP, ADP, ATP, and PolyP;

[0098] (6) tagatose-1,6-bisphosphate aldolase (GatZ), catalyzes fructose-6-phosphate to generate tagatose-6-phosphate;

[0099] (7) Phosphatase (PGP), catalyzes tagatose 6-phosphate to produce D-tagatose.

[0100] 3.2 Specific steps (1) Double enzyme catalysis to convert lactose into D-tagatose and D-glucose

[0101] Synthesis of D-tagatose by Double Enzyme Method

[0102] Optimization of recombinase inducible expression conditions

[0103] The BL2-pET28a-BgaB and BL2-pET28a-araA engineering bacteria were selected and inoculated into LB liquid culture medium containing Kana resistance at an inoculum size of 1%, respectively, and cultured at 37°C and 180rpm; different induction temperatures (12°C, 15°C, 20°C, 25°C), different induction times (4h, 8h, 12h, 16h, 20h, 24h, 28h), different OD values ​​(0.2, 0.4, 0.6, 0.8, 1.0), different IPTG concentrations (0mM, 0.5mM, 1.0mM, 1.5mM, 2.0mM) and different culture medium volumes (25mL, 50mL, 100mL, 150mL) were set to optimize the induction expression conditions of the recombinase β-Gal and L-AI; the enzyme activity of each group was measured to determine the optimal recombinase induction expression conditions. The results are shown in FIG. Figure 5 shown.

[0104] from Figure 5 It can be seen that the optimum temperature for inducing expression of the recombinase β-Gal is 20°C, the optimal reaction time is 16h, and the optimal IPTG concentration is 1mM; the optimum temperature for inducing expression of the recombinase L-AI is 15°C, the optimal reaction time is 16h, and the optimal IPTG concentration is 0.5mM; the amount of liquid in the shake flask determines the oxygen content in the bottle, affects the bacterial density, and then affects protein expression. The optimal reaction volume of β-Gal and L-AI is 100mL of culture medium in a 250mL conical flask.

[0105] 3.2 Optimization of the conditions for the dual-enzyme synthesis of D-tagatose

[0106] The crude enzyme solutions of β-galactosidase (β-Gal) and L-arabinose isomerase (L-AI) were taken and diluted to 40 mL with 0.2 mol / L, pH 6.5 Na2HPO4-NaH2PO4 buffer to make the lactose concentration 100 g / L. Based on this reaction system, the reaction time (12 h, 24 h, 36 h, 48 h, 60 h, 72 h), the catalytic reaction temperature (40 ° C, 45 ° C, 50 ° C, 55 ° C, 60 ° C), Mn 2+ The concentration (0mM, 5mM, 10mM, 15mM, 20mM) and the number of enzyme activity units (20U:20U, 20U:40U, 20U:60U, 20U:80U) were optimized; the sugars in the reaction solution were detected and quantified using high performance liquid chromatography (HPLC). The specific conditions were Ultimate XB-NH2-3 (4.6×250mm, 5μm), 77:23v / v acetonitrile, water as the mobile phase, a flow rate of 1mL / min, a RID-20A differential refractometer, and an LC-20A pump. The optimization results are shown in Figure 2. Figure 6 shown.

[0107] from Figure 6 It can be seen that under the condition of controlling the substrate concentration to 100 g / L, the dual enzyme reaction was added at an enzyme activity unit ratio of 20U:80U, and the conversion rate of lactose to D-tagatose reached 12.91% after 36 hours, which is 3.11 times that of the enzyme activity unit ratio of 20U:20U; when the reaction temperature was 60℃, the dual enzyme conversion of lactose to D-tagatose had the highest conversion rate of 19.26%, which was 3.09 times that of the reaction temperature of 40℃; the optimal Mn2+ concentration for the dual enzyme synthesis of D-tagatose was 10mM, at which time the conversion rate of lactose to D-tagatose was 21.35%, which was 1.21 times that of not adding Mn2+. Therefore, the optimal reaction time for the synthesis of D-tagatose by using β-galactosidase (β-Gal) and L-arabinose isomerase (L-AI) was 36 h, the optimal reaction temperature was 60 °C, the optimal enzyme activity units were 20 U:80 U, and Mn 2+ The optimum concentration is 10 mM.

[0108] (2) Five enzymes catalyze the conversion of D-glucose into D-tagatose

[0109] In order to further increase the content of D-tagatose, a five-enzyme reaction was introduced to generate D-tagatose. Using D-glucose generated by the double enzyme reaction as the substrate, a five-enzyme cascade reaction was carried out as follows:

[0110] According to 100 g / L D-glucose, 50 mM polyphosphate poly(n) was added; 1 U / mL glucose isomerase (GI), 2 U / mL fructose kinase (FK), 2 U / mL polyphosphate kinase (PPK), 1 U / mL tagatose-1,6-bisphosphate aldolase (GatZ), and 1 U / mL phosphatase (PGP) were added respectively, and the reaction was carried out at 50°C for 48 hours.

[0111] (3) Detection and quantification of reaction products

[0112] The reaction products in (1) and (2) were detected and quantified by high performance liquid chromatography (HPLC), respectively. The specific conditions were Ultimate XB-NH2-3 (4.6×250mm, 5μm), 77:23v / v acetonitrile, water as mobile phase, flow rate 1mL / min, RID-20A differential refractometer, LC-20A pump. The results are shown in Figure 2. Figure 7 shown.

[0113] Lactose was used as substrate and converted by β-galactosidase and L-arabinose isomerase under optimal conditions. The product was analyzed by HPLC. Figure 7A, the conversion rate of lactose to D-tagatose by the double enzyme method is 23.73%. Using D-glucose in the double enzyme reaction as the substrate, the five-enzyme cascade reaction is continued, and the conversion rate of D-tagatose is more than 27.58%, which is at least 3.84% higher than that of the double enzyme conversion.

[0114] Therefore, the present invention is based on a multi-enzyme catalytic system, and constructs a multi-enzyme catalytic synthesis pathway consisting of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase. This pathway can convert D-glucose, a byproduct of the double enzyme conversion, into D-tagatose through multi-enzyme conversion, further improving the yield of tagatose, and providing a new idea for the production of tagatose.

[0115] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A complex enzyme for synthesizing D-tagatose by multi-enzyme cascade catalysis, characterized in that: It is composed of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase.

2. The complex enzyme according to claim 1, characterized in that The β-galactosidase is β-Gal derived from Bacillus stearothermophilus, and the NCBI accession number of its encoding gene sequence is PQ460712; The L-arabinose isomerase is L-AI from Thermotoganeapolitana, and the NCBI accession number of its encoding gene sequence is AY225311.1; The glucose isomerase is derived from GI of Acidothermus cellulolyticus, and the NCBI accession number of its coding gene sequence is PQ790157; The fructokinase is FK derived from Escherichia coli K12, and the NCBI accession number of its encoding gene sequence is PQ790158; The tagatose-1,6-bisphosphate aldolase is GatZ from the thermostable bacterium Thermoanaerobacterindiensis, and the NCBI accession number of its encoding gene sequence is PQ801086; The polyphosphate kinase is PPK derived from Archaeoglobus profundus, and the NCBI accession number of its coding gene sequence is PQ790159; The phosphatase is PGP derived from Sinorhizobium meliloti, and the NCBI accession number of the coding gene sequence is PQ809484.

3. The complex enzyme according to claim 1, characterized in that The concentration of the β-galactosidase is 0.5-1.0 U / mL; The concentration of the L-arabinose isomerase is 1-2 U / mL; The concentration of the glucose isomerase is 0.5-1.5 U / mL; The concentration of the fructokinase is 1-3U / mL; The concentration of the polyphosphate kinase is 1-3U / mL; The concentration of tagatose-1,6-bisphosphate aldolase is 0.5-1.5 U / mL; The concentration of the phosphatase is 0.5-1.5 U / mL.

4. A method for synthesizing D-tagatose by multi-enzyme cascade catalysis, characterized in that: Using the composite enzyme according to any one of claims 1 to 3, comprising the following steps: adding metal ions, β-galactosidase and L-arabinose isomerase into a buffer solution of a lactose substrate to carry out a double enzyme catalytic reaction to obtain a double enzyme catalytic reaction product; Polyphosphate, glucose isomerase, fructose kinase, polyphosphate kinase, tagatose-1,6-bisphosphate aldolase and phosphatase are added to the product of the double enzyme catalytic reaction to carry out a five-enzyme catalytic reaction to obtain D-tagatose.

5. The method for synthesizing D-tagatose by multi-enzyme cascade catalysis according to claim 4, characterized in that: The metal ion is Mn 2+ Mg 2+ 、Co 2+ and Ni 2+ One of; The concentration of the metal ion is 1-10 mM; The buffer solution is a sodium phosphate buffer with a pH of 6.5-7.0; The temperature of the dual enzyme catalytic reaction is 55-60°C and the time is 24-26h.

6. The method for synthesizing D-tagatose by multi-enzyme cascade catalysis according to claim 4, characterized in that: The concentration of the lactose substrate is 50-150 g / L; The products of the double enzyme catalytic reaction are D-tagatose and D-glucose.

7. The method for synthesizing D-tagatose by multi-enzyme cascade catalysis according to claim 4, characterized in that: The polyphosphate is one of sodium hexametaphosphate and sodium tripolyphosphate; The concentration of the polyphosphate is 20-50 mM; The concentration of D-glucose is 50-100 g / L; The temperature of the five-enzyme catalytic reaction is 45-55° C. and the time is 20-50 hours.

8. An engineered bacterium, characterized in that: An enzyme encoding gene containing the complex enzyme according to claim 2; The enzyme encoding gene is one or more of the β-galactosidase gene BgaB, the L-arabinose isomerase gene araA, the glucose isomerase gene GI, the fructokinase gene FK, the polyphosphate kinase gene PPK, the tagatose-1,6-bisphosphate aldolase gene GatZ and the phosphatase gene PGP; The engineered bacteria is Escherichia coli.

9. The engineered bacteria according to claim 1, characterized in that The engineered bacteria is Escherichia coli BL21 (DE3).

10. A method for constructing the engineered bacteria according to claim 8 or 9, characterized in that: This involves transferring enzyme encoding genes into host cells.

Images