A method for synthesizing D-tagatose by multi-enzyme cascade catalysis

The method of synthesizing D-tagatose by multi-enzyme cascade catalysis utilizes a complex enzyme system to improve the conversion rate of D-tagatose, solving the problems of high production cost and low yield in existing technologies, and providing a new method for the industrial production of D-tagatose.

CN119752854BActive Publication Date: 2025-11-21BIOLOGY INST OF SHANDONG ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510042462.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-10
Publication Date
2025-11-21
Estimated Expiration
2045-01-10

AI Technical Summary

Technical Problem

Existing technologies for producing D-tagatose have high production costs and low yields, and the conversion rate of biosynthesis is low. Intermediate products inhibit the hydrolytic action of enzymes, making it difficult to meet market demand.

Method used

A multi-enzyme cascade catalytic synthesis method for D-tagatose was adopted, utilizing a complex enzyme system composed of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructose kinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase to improve the conversion rate through multi-step enzymatic reactions.

Benefits of technology

This improved the conversion rate of D-tagatose, reduced production costs, and provided a new approach for the industrial production of D-tagatose.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752854B_ABST
    Figure CN119752854B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biology and specifically relates to a method for synthesizing D-tagatose through multi-enzyme cascade catalysis, which uses lactose as a substrate and utilizes beta-galactoside enzyme, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1,6-diphosphate aldolase, polyphosphate kinase and phosphatase for synchronous cascade catalysis to synthesize D-tagatose. The method improves the conversion rate of D-tagatose by continuously converting the intermediate product D-glucose into D-tagatose, provides a new method for synthesizing D-tagatose from lactose, and provides certain theoretical basis and technical support for realizing the industrialized production of high-value-added D-tagatose.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biological technology, and particularly relates to a method for synthesizing D-tagatose through multi-enzyme cascade catalysis. BACKGROUND

[0002] D-tagatose is a rare ketohexose found in nature, and has a sweetness of 92% of sucrose but a heat of only 38% of sucrose, so it is called a low-calorie sweetener, and has physiological effects such as improving intestinal flora, reducing blood sugar, preventing oral diseases, preventing obesity, and the like, and can be safely applied to the fields of food, medicine, cosmetics and the like. At present, the market share of D-tagatose is increasing year by year, and has great application value.

[0003] D-tagatose has a very low content in nature, and mainly exists in some lower plants such as lichens, mosses and the like. It is difficult to meet the market demand by using natural extraction method to obtain D-tagatose due to high cost of raw materials. The chemical synthesis method has a very high requirement for reaction conditions, and a large amount of by-products are generated in the reaction process, which leads to problems such as difficulty in subsequent separation and purification, low yield and the like. The biological synthesis method has advantages such as mild reaction conditions, less by-products, high product purity and low cost, and has become the preferred method for industrial production of D-tagatose.

[0004] The biological synthesis method mainly uses lactose as a raw material, and is catalyzed by β-galactosidase and L-arabinose isomerase. However, this method has a low conversion rate, and the content of intermediate products is too high to inhibit the hydrolysis of β-galactosidase. Therefore, it is urgent to develop a new D-tagatose preparation method with low cost, low pollution and high yield. SUMMARY

[0005] The purpose of the present application is to provide a method for synthesizing D-tagatose through multi-enzyme cascade catalysis, so as to overcome the shortcomings of the prior art, and to design a new multi-enzyme cascade catalytic reaction system on the basis of double enzyme conversion, so as to further improve the yield of tagatose, and to provide a new idea for the production of tagatose.

[0006] In order to achieve the above-mentioned purpose, the technical scheme of the present application is as follows:

[0007] In a first aspect, the present application provides a complex enzyme for synthesizing D-tagatose through multi-enzyme cascade catalysis, which is composed of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1, 6-diphosphate aldolase, polyphosphate kinase and phosphatase.

[0008] In some embodiments, the beta-galactosidase is beta-Gal derived from Bacillus stearothermophilus, and the NCBI accession number of the coding gene sequence is PQ460712;

[0009] The L-arabinose isomerase is L-AI derived from Thermotoga neapolitana, and the NCBI accession number of the coding gene sequence is AY225311.1;

[0010] The glucose isomerase is GI derived from Acidothermus cellulolyticus, and the NCBI accession number of the coding gene sequence is PQ790157;

[0011] The fructokinase is FK derived from Escherichia coli K12, and the NCBI accession number of the coding gene sequence is PQ790158;

[0012] The tagatose-1,6-bisphosphate aldolase is GatZ derived from Thermoanaerobacter indiensis, and the NCBI accession number of the coding gene sequence is PQ801086;

[0013] The polyphosphate kinase is PPK derived from Archaeoglobus profundus, and the NCBI accession number of the coding gene sequence is PQ790159;

[0014] The phosphatase is PGP derived from Sinorhizobium meliloti, and the NCBI accession number of the coding gene sequence is PQ809484.

[0015] In some embodiments, the concentration of the beta-galactosidase is 0.5-1.0 U / mL;

[0016] The concentration of the L-arabinose isomerase is 1-2 U / mL;

[0017] The concentration of the glucose isomerase is 0.5-1.5 U / mL;

[0018] The concentration of the fructokinase is 1-3 U / mL;

[0019] The concentration of the polyphosphate kinase is 1-3 U / mL;

[0020] The concentration of the tagatose-1,6-bisphosphate aldolase is 0.5-1.5 U / mL;

[0021] The concentration of the phosphatase is 0.5-1.5 U / mL.

[0022] In a second aspect, the present application provides a method for synthesizing D-tagatose by a multi-enzyme cascade catalysis, which comprises the following steps:

[0023] The metal ion, the β-galactosidase and the L-arabinose isomerase are added into a buffer solution of the lactose substrate to perform a double-enzyme catalytic reaction, so as to obtain a double-enzyme catalytic reaction product;

[0024] The polyphosphate, the glucose isomerase, the fructokinase, the polyphosphate kinase, the tagatose-1, 6-bisphosphate aldolase and the phosphatase are added into the double-enzyme catalytic reaction product to perform a five-enzyme catalytic reaction, so as to obtain the D-tagatose.

[0025] In some embodiments, the metal ion is one of Mn 2+ , Mg 2+ , Co 2+ and Ni 2+ .

[0026] The concentration of the metal ion is 1-10 mM.

[0027] The buffer solution is a sodium phosphate buffer solution, and the pH is 6.5-7.0.

[0028] The temperature of the double-enzyme catalytic reaction is 55-60℃, and the time is 24-26 h.

[0029] In some embodiments, the concentration of the lactose substrate is 50-150 g / L.

[0030] The double-enzyme catalytic reaction product is D-tagatose and D-glucose.

[0031] In some embodiments, the polyphosphate is one of sodium hexametaphosphate and sodium tripolyphosphate.

[0032] The concentration of the polyphosphate is 20-50 mM.

[0033] The concentration of the D-glucose is 50-100 g / L.

[0034] The temperature of the five-enzyme catalytic reaction is 45-55℃, and the time is 20-50 h.

[0035] In a third aspect, the present application provides an engineered bacterium comprising the enzyme coding gene of the complex enzyme of the first aspect.

[0036] The enzyme-encoding genes are one or more of the following: a beta-galactosidase gene BgaB, an L-arabinose isomerase gene araA, a glucose isomerase gene GI, a fructokinase gene FK, a polyphosphate kinase gene PPK, a tagatose-1,6-bisphosphate aldolase gene GatZ, and a phosphatase gene PGP.

[0037] The engineered bacteria are Escherichia coli.

[0038] In some embodiments, the engineered bacteria are Escherichia coli BL21 (DE3).

[0039] In the fourth aspect, the present application provides a method for constructing the engineered bacteria of the third aspect, comprising transferring enzyme-encoding genes into host cells.

[0040] The present application has the following beneficial effects:

[0041] (1) In the process of the present application for converting D-tagatose by double-enzyme method, an intermediate product D-glucose is generated, and a high content of the intermediate product will inhibit the hydrolysis of beta-galactosidase.

[0042] (2) The present application provides a method for improving the synthesis of D-tagatose based on multi-enzyme cascade reaction, which uses lactose as the initial raw material and designs a novel multi-enzyme cascade catalytic reaction system on the basis of double-enzyme conversion, thereby improving the conversion rate of D-tagatose.

[0043] (3) The present application provides a novel method for synthesizing D-tagatose from lactose, and also provides certain theoretical basis and technical support for realizing the industrialized production of high-value D-tagatose. BRIEF DESCRIPTION OF DRAWINGS

[0044] The drawings constituting a part of the specification of the present application are used to provide further understanding of the present application, and the schematic embodiments of the present application and the description thereof are used to explain the present application, and do not constitute an improper limitation on the present application.

[0045] Figure 1 is a plasmid map of a recombinant vector;

[0046] Figure 2 is an identification map of an engineered strain, wherein (A) is an identification of an engineered strain resistance plate, and (B) is a molecular identification of an engineered strain;

[0047] Figure 3 is an expression and purification map of a recombinant enzyme;

[0048] Figure 4 is a schematic diagram of a catalytic pathway for biosynthesis of D-tagatose by multi-enzyme cascade reaction;

[0049] Figure 5is an optimization chart of the induced expression conditions of the recombinase;

[0050] Figure 6 is an optimization chart of the reaction time, temperature, Mn 2+ concentration for the double-enzyme conversion of D-tagatose;

[0051] Figure 7 is a high-performance liquid chromatogram of D-tagatose, wherein (A) is a liquid chromatogram of D-tagatose synthesized by a double enzyme, and (B) is a liquid chromatogram of D-tagatose synthesized by a five-enzyme. DETAILED DESCRIPTION

[0052] In order for those skilled in the art to more clearly understand the technical solutions of the present disclosure, the technical solutions of the present disclosure will be described in detail below in combination with specific examples and comparative examples. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial channels.

[0053] The sources of the biological materials used in the present disclosure are as follows:

[0054] The protein molecular weight marker was purchased from Shanghai Biyun Tian Biotechnology Co., Ltd.;

[0055] The bacterial genomic DNA extraction kit, DNA purification and recovery kit, endotoxin-free plasmid large extraction kit, and DNA molecular weight marker were purchased from Beijing Tiangen Biotech Co., Ltd.;

[0056] High-fidelity DNA polymerase, recombinant cloning kit, E. coli BL21 (DE3), and expression vector pET28a (+) were purchased from Nanjing Novozyme Biotech Co., Ltd.;

[0057] Lactose, D-galactose, D-glucose, and D-tagatose standards were purchased from Sigma-Aldrich Company;

[0058] Restriction endonucleases BamH I and Xho I were purchased from NEB Company;

[0059] Other analytical pure reagents were purchased from Shanghai National Pharmaceutical Group Chemical Reagent Co., Ltd.;

[0060] The β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1, 6-diphosphate aldolase, polyphosphate kinase, and phosphatase in the catalytic system involved in the embodiments of the present disclosure can be obtained by prokaryotic expression according to a genetic engineering method.

[0061] Example 1

[0062] Construction of a recombinant expression vector and obtaining of an engineered bacterium

[0063] 1.1 Construction of recombinant expression vectors

[0064] Genomic DNA was extracted from *Bacillus stearothermophilus*, *Thermotoganea politana*, *Acidothermus cellulolyticus*, *Escherichia coli K12*, *Thermoanaerobacter indiensis*, and *Archaeoglobus profundus* using a bacterial genomic DNA extraction kit. Full-length primers were designed for amplification, with sequences SEQ ID NO.1-SEQ ID NO.14, specifically: ATGAATGTGTTATCCTCAATTTGTTAC (SEQ ID NO.1), CTAAACCTTCCCGGCTTCATC (SEQ ID NO.2), ATGCTGTCATTACGTCCTTATGAAT (SEQ ID NO.3), TTACCGTCCCCGCCAGAATAC (SEQ ID NO.4), ATGTCACTCACCACTGCATCG (SEQ ID NO.5), and TCAGCCGCGTGCGCCGA (SEQ ID NO.6).

[0065] ATGCGTATAGGTATCGATTTAGGC(SEQ ID NO.7),

[0066] TTACTCTTGGTGGCCATAACCAC(SEQ ID NO.8),

[0067] ATGAACACCGAACATCCGCTG(SEQ ID NO.9),

[0068] TTAAATCAGTTTAAATTCGCCGCTG (SEQ ID NO. 10),

[0069] ATGGCATTGGATGAAGCCCCG (SEQ ID NO.11),

[0070] TTAACGAAGAAATCCCGGTCCG (SEQ ID NO. 12),

[0071] ATGTTTAAAGCTCTAGTAGTTGATATA (SEQ ID NO. 13), TTAGATAAGGCCAGGAACTCCA (SEQ ID NO. 14).

[0072] The gene expression cassette is obtained by PCR amplification using high-fidelity PCR polymerase as a template of genomic DNA; the amplification product is recovered and purified by using a DNA recovery kit; the recovered product is connected with a T vector, and transformed into E. coli DH5a to obtain a positive clone single colony for sequencing; the above sequenced correct genes are connected to the expression vector pET28a(+) by restriction endonuclease BamH I and Xho I, respectively, by homologous recombination, while retaining the 6xHis tag of pET28a(+) itself, to obtain a recombinant expression vector.

[0073] Figure 1 The plasmid map of the recombinant vector is shown in the figure, and the results show that: the β-galactosidase gene BgaB is isolated, with NCBI accession number PQ460712 and a sequence length of 2019 bp; the L-arabinose isomerase gene araA is isolated, with NCBI accession number AY225311.1 and a sequence length of 1491 bp; the glucose isomerase gene GI is isolated, with NCBI accession number PQ790157; the fructokinase gene FK is isolated, with NCBI accession number PQ790158 and a sequence length of 909 bp; the tagose-1,6-bisphosphate aldolase gene GatZ is isolated, with NCBI accession number PQ801086 and a sequence length of 1341 bp; the polyphosphate kinase gene PPK is isolated, with NCBI accession number PQ790159 and a sequence length of 903 bp; and the phosphatase gene PGP is isolated, with NCBI accession number PQ809484. The obtained recombinant vector contains a strong promoter T7, an N-terminal tag His6 tag-T7 tag, a C-terminal tag His6 tag, a protease cleavage site Thrombin, a resistance screening gene Kana, and the complete sequence of each gene expression cassette.

[0074] 1.2 Obtaining of the engineering bacteria

[0075] The recombinant vector plasmid constructed in 1.1 is extracted according to the plasmid extraction kit; the recombinant vector plasmid is transformed into competent cells according to the instruction manual of E. coli BL21(DE3) competent cells; 100 μL of the transformation liquid is uniformly coated on an LB plate containing Kana resistance, and the appearance of the transformants is observed; the transformants are picked and subcultured on an LB plate containing Kana resistance for three generations to obtain stable genetic positive transformants; the single colonies are separated and cultured, and further molecular identification is performed by using vector primers TAATACGACTCACTATAGGG (SEQ ID NO. 15) and GCTAGTTATTGCTCAGCGG (SEQ ID NO. 16).

[0076] Figure 2This is an identification diagram of the engineered strain. The results show that, based on Kana resistance plate identification ( Figure 2 A) and molecular identification ( Figure 2 B) Successfully obtained engineered bacteria BL2-pET28a-BgaB, BL2-pET28a-araA, BL2-pET28a-GI, BL2-pET28a-FK, BL2-pET28a-PPK, BL2-pET28a-GatZ and BL2-pET28a-PGP.

[0077] Example 2

[0078] Preparation of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructose kinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase.

[0079] At an inoculum size of 1%, the engineered bacteria (BL2-pET28a-BgaB, BL2-pET28a-araA, BL2-pET28a-GI, BL2-pET28a-FK, BL2-pET28a-PPK, BL2-pET28a-GatZ, and BL2-pET28a-PGP) from section 1.2 were inoculated into LB liquid medium containing Kana resistance and cultured at 37°C and 180 rpm until the OD600 reached approximately 0.6. IPTG was added to a final concentration of 0.5 mM, and the culture was induced at 15°C and 150 rpm for 16 h. The cells were collected by centrifugation at 4°C and 10,000 rpm for 10 min, and analyzed using 0.2 mol / L pH... The bacterial cells were washed twice with 6.5% Na2HPO4-NaH2PO4 buffer, and then resuspended in 10 times the wet weight volume (m / V) of the bacterial cells to obtain a bacterial suspension. The cells were disrupted using a SCIENTZ-IID ultrasonic cell disruptor, and the bacterial suspension was placed on ice and sonicated at 225W for 10 min (on for 3 seconds, off for 3 seconds). The cell debris was centrifuged at 10,000 rpm and 4°C for 10 min, and the supernatant was filtered through a 0.22 μm filter. The supernatant was loaded onto 2 mL of Ni-T-T resin at 4°C and eluted with 50 mM imidazole. The purified enzyme protein was subjected to SDS-PAGE electrophoresis to verify the size of the target protein.

[0080] Figure 3For the expression and purification of the recombinant enzymes, SDS-PAGE results showed that the protein molecular weights of β-galactosidase (β-Gal), L-arabinose isomerase (L-AI), glucose isomerase (GI), fructokinase (FK), polyphosphate kinase (PPK), tagatose-1,6-bisphosphate aldolase (GatZ), and phosphatase (PGP) were 78 kDa, 56 kDa, 44.7 kDa, 35 kDa, 34.8 kDa, 51.7 kDa, and 25.4 kDa, respectively. The above enzymes were successfully expressed in E. coli after IPTG induction, and had high purity after purification, and could be used for subsequent in vitro catalytic reactions.

[0081] The β-galactosidase is β-Gal derived from Bacillus stearothermophilus, and the NCBI accession number of the coding gene sequence thereof is PQ460712;

[0082] The L-arabinose isomerase is L-AI derived from Thermotoga neapolitana, and the NCBI accession number of the coding gene sequence thereof is AY225311.1;

[0083] The glucose isomerase is GI derived from Acidothermus cellulolyticus, and the NCBI accession number of the coding gene sequence thereof is PQ790157;

[0084] The fructokinase is FK derived from Escherichia coli K12, and the NCBI accession number of the coding gene sequence thereof is PQ790158;

[0085] The tagatose-1,6-bisphosphate aldolase is GatZ derived from Thermoanaerobacter indiensis, and the NCBI accession number of the coding gene sequence thereof is PQ801086;

[0086] The polyphosphate kinase is PPK derived from Archaeoglobus profundus, and the NCBI accession number of the coding gene sequence thereof is PQ790159;

[0087] The phosphatase is PGP derived from Sinorhizobium meliloti, and the NCBI accession number of the coding gene sequence thereof is PQ809484.

[0088] Example 3

[0089] In vitro multi-enzyme cascade reaction biosynthesis of D-tagatose

[0090] 3.1 The catalytic pathway of the multi-enzyme cascade reaction for synthesizing D-tagatose

[0091] Based on the synthesis of D-tagatose by double enzymes (β-galactosidase (β-Gal), L-arabinose isomerase (L-AI)), the present application designs a multi-enzyme cascade reaction in vitro to convert the byproduct D-glucose in the double enzyme conversion into D-tagatose through five enzymes (glucose isomerase (GI), fructokinase (FK), polyphosphate kinase (PPK), tagatose-1, 6-bisphosphate aldolase (GatZ), and phosphatase (PGP)). Figure 4 is a schematic diagram of the catalytic pathway of the multi-enzyme cascade reaction for biosynthesizing D-tagatose.

[0092] The roles of the key enzymes in the catalytic process of the multi-enzyme cascade reaction for synthesizing D-tagatose are as follows:

[0093] (1) β-galactosidase (β-Gal), which catalyzes the conversion of lactose into D-galactose and D-glucose;

[0094] (2) L-arabinose isomerase (L-AI), which catalyzes the conversion of D-galactose into D-tagatose;

[0095] (3) Glucose isomerase (GI), which catalyzes the conversion of D-glucose into D-fructose;

[0096] (4) Fructokinase (FK), which catalyzes the conversion of D-fructose into fructose 6-phosphate;

[0097] (5) Polyphosphate kinase (PPK), which can use polyphosphate (PolyP) as a phosphate group donor to realize the efficient directional transfer of phosphate groups between AMP, ADP, ATP, and PolyP;

[0098] (6) Tagatose-1, 6-bisphosphate aldolase (GatZ), which catalyzes the conversion of fructose 6-phosphate into tagatose 6-phosphate;

[0099] (7) Phosphatase (PGP), which catalyzes the conversion of tagatose 6-phosphate into D-tagatose.

[0100] 3.2 Specific step (1) Double enzyme catalysis for converting lactose into D-tagatose and D-glucose

[0101] Double enzyme method for synthesizing D-tagatose

[0102] Optimization of recombinant enzyme induction expression conditions

[0103] Engineered strains of BL2-pET28a-BgaB and BL2-pET28a-araA were selected and inoculated at a rate of 1% into LB broth containing Kana resistance, and cultured at 37℃ and 180 rpm. The induction expression conditions for recombinant enzymes β-Gal and L-AI were optimized by setting different induction temperatures (12℃, 15℃, 20℃, 25℃), different induction times (4h, 8h, 12h, 16h, 20h, 24h, 28h), different OD values ​​(0.2, 0.4, 0.6, 0.8, 1.0), different IPTG concentrations (0mM, 0.5mM, 1.0mM, 1.5mM, 2.0mM), and different culture medium volumes (25mL, 50mL, 100mL, 150mL). Enzyme activity was measured in each group to determine the optimal recombinant enzyme induction expression conditions. The results are shown below. Figure 5 As shown.

[0104] from Figure 5 It can be seen that the optimal temperature for inducing recombinase β-Gal expression is 20℃, the optimal reaction time is 16h, and the optimal IPTG concentration is 1mM; the optimal temperature for inducing recombinase L-AI expression is 15℃, the optimal reaction time is 16h, and the optimal IPTG concentration is 0.5mM. The volume of liquid in the shake flask determines the oxygen content in the flask, which affects the bacterial community density and thus affects protein expression. The optimal reaction volume for both β-Gal and L-AI is 250mL conical flasks filled with 100mL of culture medium.

[0105] 3.2 Optimization of conditions for the synthesis of D-tagatose using the two-enzyme method

[0106] Pit the crude enzyme solutions of β-galactosidase (β-Gal) and L-arabinose isomerase (L-AI), and bring the volume to 40 mL with 0.2 mol / L, pH 6.5 Na₂HPO₄-NaH₂PO₄ buffer to achieve a lactose concentration of 100 g / L. Based on this reaction system, the reaction time (12 h, 24 h, 36 h, 48 h, 60 h, 72 h), the catalytic reaction temperature (40 °C, 45 °C, 50 °C, 55 °C, 60 °C), and Mn were measured. 2+ The concentrations (0 mM, 5 mM, 10 mM, 15 mM, 20 mM) and enzyme activity units (20 U:20 U, 20 U:40 U, ​​20 U:60 U, 20 U:80 U) were optimized. High-performance liquid chromatography (HPLC) was used to detect and quantify the sugars in the reaction solution. Specific conditions were: Ultimate XB-NH2-3 (4.6 × 250 mm, 5 μm), acetonitrile (77:23 v / v), water as the mobile phase, flow rate 1 mL / min, RID-20A differential refractive index detector, and LC-20A pump. The optimization results are as follows: Figure 6 As shown.

[0107] fromFigure 6 It can be seen that, under the condition of controlling the substrate concentration to be 100 g / L, the conversion rate of lactose to D-tagatose reached 12.91% after 36 h when the ratio of enzyme activity units of the two enzymes was 20U:80U, which was 3.11 times of that when the ratio of enzyme activity units was 20U:20U; when the reaction temperature was 60℃, the conversion rate of lactose to D-tagatose was the highest, which was 19.26%, which was 3.09 times of that when the reaction temperature was 40℃; the optimal Mn2+ concentration for the reaction of synthesizing D-tagatose by the double-enzyme method was 10 mM, and the conversion rate of lactose to D-tagatose was 21.35% at this time, which was 1.21 times of that without Mn2+. Therefore, the optimal reaction time for synthesizing D-tagatose by the double-enzyme method was 36 h, the optimal reaction temperature was 60℃, the optimal ratio of enzyme activity units was 20U:80U, and the optimal Mn2+ concentration was 10 mM. 2+ The optimal concentration was 10 mM.

[0108] (2) Five-enzyme catalyzed conversion of D-glucose to D-tagatose

[0109] In order to further improve the content of D-tagatose, a five-enzyme reaction was introduced to generate D-tagatose. The D-glucose generated by the double-enzyme reaction was used as the substrate for the five-enzyme cascade reaction, which was as follows:

[0110] According to 100 g / L of D-glucose, 50 mM of polyphosphate poly(n) was added; 1 U / mL of glucose isomerase (GI), 2 U / mL of fructokinase (FK), 2 U / mL of polyphosphate kinase (PPK), 1 U / mL of tagatose-1, 6-diphosphate aldolase (GatZ), and 1 U / mL of phosphatase (PGP) were added, and the reaction was carried out at 50℃ for 48 h.

[0111] (3) Detection and quantification of reaction products

[0112] The reaction products in (1) and (2) were detected and quantified by high performance liquid chromatography (HPLC), and the specific conditions were as follows: Ultimate XB-NH2-3 (4.6 x 250 mm, 5 μm), 77:23 v / v of acetonitrile and water as the mobile phase, a flow rate of 1 mL / min, RID-20A differential refractive index detector, and LC-20A pump. The results are shown in Figure 7 .

[0113] Lactose was used as the substrate, and the product was analyzed by HPLC after the conversion by β-galactosidase and L-arabinose isomerase under the optimal conditions, as shown in Figure 7A, the conversion rate of D-tagatose generated by the double-enzyme method is 23.73%. Using D-glucose in the double-enzyme reaction as the substrate, the five-enzyme cascade reaction is continued, and the conversion rate of D-tagatose is more than 27.58%, which is at least 3.84% higher than that of the double-enzyme conversion.

[0114] Therefore, based on the multi-enzyme catalytic system, the present application constructs a multi-enzyme catalytic synthesis pathway composed of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructokinase, tagatose-1, 6-diphosphate aldolase, polyphosphate kinase and phosphatase. The pathway can generate D-tagatose from the by-product D-glucose in the double-enzyme conversion through multi-enzyme conversion, further improving the yield of tagatose and providing a new idea for the production of tagatose.

[0115] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A complex enzyme for the synthesis of D-tagatose via a multi-enzyme cascade catalysis, characterized in that, It consists of β-galactosidase, L-arabinose isomerase, glucose isomerase, fructose kinase, tagatose-1,6-bisphosphate aldolase, polyphosphate kinase, and phosphatase. The β-galactosidase is derived from Bacillus stearothermophilus. Bacillus stearothermophilus of β- Gal The NCBI accession number for its encoding gene sequence is PQ460712; The L-arabinose isomerase is derived from Thermophyton floccosum. Thermotoga neapolitana of L-AI The NCBI accession number for its encoding gene sequence is AY225311.1; The glucose isomerase is derived from cellulolytic thermophilic bacteria. Acidothermus cellulolyticus of GI The NCBI accession number for its encoding gene sequence is PQ790157; The fructokinase is derived from Escherichia coli. Escherichia coli K12 FK The NCBI accession number for its encoding gene sequence is PQ790158; The tagatose-1,6-bisphosphate aldolase is derived from thermostable bacteria. Thermoanaerobacter indiensis of GatZ Its encoding gene sequence has the NCBI accession number PQ801086; The polyphosphate kinase is derived from deep-sea archaea. Archaeoglobus profundus of PPK The NCBI accession number for its encoding gene sequence is PQ790159; The phosphatase is derived from *Rhizobium sinense*, alfalfa rhizobia. Sinorhizobium meliloti of PGP The NCBI accession number for its encoding gene sequence is PQ809484.

2. The complex enzyme according to claim 1, characterized in that, The concentration of the β-galactosidase is 0.5-1.0 U / mL; The concentration of the L-arabinose isomerase is 1-2 U / mL; The concentration of the glucose isomerase is 0.5-1.5 U / mL; The concentration of the fructokinase is 1-3 U / mL; The concentration of the polyphosphate kinase is 1-3 U / mL; The concentration of the tagatose-1,6-bisphosphate aldolase is 0.5-1.5 U / mL; The concentration of the phosphatase is 0.5-1.5 U / mL.

3. A method for the synthesis of D-tagatose via a multi-enzyme cascade catalysis, characterized in that, The method of using the complex enzyme according to claim 1 or 2 includes the following steps: Metal ions, β-galactosidase, and L-arabinose isomerase were added to a buffer solution of lactose substrate to carry out a two-enzyme catalytic reaction, yielding the two-enzyme catalytic reaction product. Polyphosphate, glucose isomerase, fructose kinase, polyphosphate kinase, tagatose-1,6-bisphosphate aldolase and phosphatase were added to the product of the two-enzyme catalytic reaction to carry out a five-enzyme catalytic reaction to obtain D-tagatose.

4. The method for synthesizing D-tagatose via multi-enzyme cascade catalysis according to claim 3, characterized in that, The metal ion is Mn. 2+ Mg 2+ Co 2+ and Ni 2+ One of them; The concentration of the metal ions is 1-10 mM; The buffer solution is a sodium phosphate buffer solution with a pH of 6.5-7.0; The temperature of the dual-enzyme catalytic reaction is 55-60℃, and the time is 24-26h.

5. The method for synthesizing D-tagatose via a multi-enzyme cascade catalysis according to claim 3, characterized in that, The concentration of the lactose substrate is 50-150 g / L; The products of the dual-enzyme catalytic reaction are D-tagatose and D-glucose.

6. The method for synthesizing D-tagatose via a multi-enzyme cascade catalysis according to claim 3, characterized in that, The polyphosphate is one of sodium hexametaphosphate and sodium tripolyphosphate; The concentration of the polyphosphate is 20-50 mM; The concentration of the D-glucose is 50-100 g / L; The five-enzyme catalytic reaction is carried out at a temperature of 45-55℃ for 20-50 h.

7. An engineered bacterium, characterized in that, Contains the enzyme-encoding gene of the complex enzyme according to claim 1; The enzyme encoding gene is the β-galactosidase gene. BgaB L-arabinose isomerase gene araA Glucose isomerase gene GI fructokinase gene FK Polyphosphate kinase gene PPK tagatose-1,6-bisphosphate aldolase gene GatZ and phosphatase gene PGP One or more of the following; The engineered bacteria is Escherichia coli.

8. The engineered bacteria according to claim 7, characterized in that, The engineered bacteria is Escherichia coli BL21(DE3).

9. A method for constructing engineered bacteria as described in claim 7 or 8, characterized in that, This includes transferring enzyme-encoded genes into host cells.

Citation Information

Patent Citations

  • Tagatose preparation method

    CN106399427A

  • Immobilized enzyme and application thereof in preparation of D-tagatose

    CN118773180A