Beta-1, 4-endo-xylanase derived from metagenome of faeces of Asian elephant as well as coding gene and application of beta-1, 4-endo-xylanase

Abstract

The invention discloses beta-1, 4-endo-xylanase derived from an Asian elephant feces metagenome as well as a coding gene and application thereof, and relates to the technical field of gene engineering. A genome of a Prevotella bacterium with the integrity of 97.47% and the contamination rate of 0 is assembled by using a metagenome binning technology, a beta-1, 4-endo-xylanase (EC 3.2. 1.8) gene is obtained through annotation of a KEGG Enzyme database, the nucleotide sequence of the beta-1, 4-endo-xylanase coding gene is shown as SEQ ID NO.3, and the amino acid sequence of the beta-1, 4-endo-xylanase coding gene is shown as SEQ ID NO.4. The invention further discloses a preparation method of the beta-1, 4-endo-xylanase coding gene. Compared with beta-1, 4-endo-xylanase derived from fungi, the beta-1, 4-endo-xylanase has good thermal stability and pH stability, can significantly improve the in-vitro enzymolysis reducing sugar growth rate of soybean meal, is beneficial to pretreatment of soybean meal raw materials, and has application value in preparation of feed from soybean meal.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a beta-1,4-endo-xylanase derived from Asian elephant feces metagenome, a coding gene and an application thereof. Background Art

[0002] Xylan is the main component of hemicellulose, the second largest renewable resource on earth, and is also the most abundant polysaccharide besides cellulose. In today's world of energy shortage and serious pollution, the rational use of renewable resources is urgent. Therefore, the full utilization of xylan has attracted much attention. However, the chemical structure of xylan is complex, and the degradation of xylan requires the help of a complex set of hydrolytic enzymes, the most important of which is β-1,4-endo-xylanase (β-1,4-D-xylanohydrolase: EC3.1.2.8).

[0003] β-1,4-endo-xylanase is the most important enzyme in the hydrolysis process of xylan. It mainly acts on the glycosidic bond of β-1,4-D-xylosidic bond. The hydrolysis products are xylose, xylobiose and above xylo-oligosaccharides. The molecular weight of existing xylanases is about 8-145kD, the optimum pH is 4.0-6.5, and the optimum temperature is 40-60℃. Most of the β-1,4-endo-xylanases from fungi such as wild strains of Trichoderma and Aspergillus have low enzyme activity, and the protein subunits of fungal xylanases are more complex than those from bacteria, and the thermal stability is poorer than that of bacterial xylanases. Therefore, most of the existing industrial xylanases are derived from bacteria. At present, the exploration of bacterial β-1,4-endo-xylanase gene resources is limited, and further exploration of highly active and stable β-1,4-endo-xylanase is needed.

[0004] With the development of sequencing technology, combined with metagenomic analysis methods, in terms of mining microbial functional enzyme genes, it is possible to successfully avoid the difficulties of traditional microbial pure culture technology, and quickly discover a large number of functional enzyme genes in a short period of time, thereby improving the breadth and effectiveness of functional enzyme gene screening, greatly promoting the improvement of functional enzyme gene cloning efficiency, and providing a new research strategy for finding and discovering new β-1,4-endo-xylanase genes. Summary of the invention

[0005] The purpose of the present invention is to provide a beta-1,4-endo-xylanase with better pH stability and temperature stability, so as to fill the deficiency of the existing beta-1,4-endo-xylanase in industrial production.

[0006] In order to achieve the above object, the present invention provides a β-1,4-endo-xylanase derived from the Asian elephant feces metagenome, the amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO.4.

[0007] The β-1,4-endo-xylanase provided by the present invention can be used in any of the following items, including increasing the growth rate of in vitro enzymatically hydrolyzed reducing sugar in soybean meal, and using the enzymatically hydrolyzed soybean meal for preparing soybean meal feed.

[0008] The present invention also provides a gene encoding the above-mentioned β-1,4-endo-xylanase, and the nucleotide sequence of the gene encoding is shown in SEQ ID NO.3.

[0009] The present invention also provides a primer for identifying the above coding gene, the nucleotide sequence of the primer is shown in SEQ ID NO.1 and SEQ ID NO.2

[0010] The present invention also provides a recombinant plasmid comprising the above coding gene, wherein the recombinant plasmid is selected from a prokaryotic plasmid.

[0011] Preferably, the above-mentioned prokaryotic plasmid is selected from pBE-S plasmid.

[0012] The invention also provides a recombinant bacterium capable of expressing the beta-1,4-endo-xylanase.

[0013] Preferably, the above-mentioned recombinant bacteria is selected from Bacillus subtilis WB600.

[0014] The present invention also provides a method for preparing the above-mentioned β-1,4-endo-xylanase, comprising:

[0015] The above recombinant bacteria are fermented and cultured, and the supernatant is collected after centrifugation to obtain β-1,4-endo-xylanase.

[0016] The present invention has the following advantages:

[0017] The present invention obtains a Prevotella bacterial genome by assembling the metagenomic binning technology, the genome integrity is 97.47%, the contamination rate is 0, a new β-1,4-endo-xylanase gene is annotated by the KEGG Enzyme database, and the bacterial β-1,4-endo-xylanase Xyneleph is prepared by genetic engineering technology. Compared with the xylanase from fungi, the β-1,4-endo-xylanase Xyneleph has good stability at 50-80°C and pH in the range of 5.0-9.0, and has better pH stability and temperature stability.

[0018] The β-1,4-endo-xylanase derived from the Asian elephant feces metagenome provided by the present invention can effectively make up for the problems of the physicochemical properties of the existing β-1,4-endo-xylanase, especially the poor tolerance to conditions such as pH and temperature, and has a good degradation effect on soybean meal, and has practical value in the preparation of feed, especially the pretreatment of feed raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis result of PCR amplification verification of the β-1,4-endo-xylanase encoding gene in the present invention.

[0020] Figure 2 This is the protein SDS-PAGE gel electrophoresis result of the β-1,4-endo-xylanase in the present invention.

[0021] Figure 3 This is the curve showing that the activity of β-1,4-endo-xylanase in the present invention is affected by pH.

[0022] Figure 4 The curve showing the effect of temperature on the activity of β-1,4-endo-xylanase in the present invention. DETAILED DESCRIPTION

[0023] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Note: The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0025] The original data of Asian elephant intestinal metagenomic sequencing used in the present invention has been deposited in the genome sequence archive of the Big Data Center of the Chinese Academy of Sciences with the accession number of CRA003369.

[0026] Example 1 Acquisition of β-1,4-endo-xylanase encoding genes from Asian elephant feces metagenome

[0027] 1. Based on the fresh feces samples of Asian elephants stored in this laboratory, the metagenomic DNA was extracted using a kit (QIAamp DNA StoolMini Kit). The steps for extracting the metagenomic DNA of fresh feces of Asian elephants are as follows:

[0028] 1) Weigh about 0.2 g of Asian elephant feces into a sterile centrifuge tube;

[0029] 2) Add 1.4 mL of buffer ASL, vortex continuously for several minutes to mix thoroughly, incubate at 70°C for 5 minutes, and then vortex for 15 seconds;

[0030] 3) Centrifuge at 20,000 g for 1 min to remove fecal impurities and transfer the supernatant to a new centrifuge tube;

[0031] 4) After adding one inhibitEX Tablet, mix immediately for about 1 minute, then leave at room temperature for 1 minute to allow the inhibitor to adsorb to the inhibitEX matrix, and centrifuge at 20,000g for 3 minutes;

[0032] 5) Take the supernatant and transfer it to a new centrifuge tube, and centrifuge it again as in 4);

[0033] 6) Pipette the supernatant into a new centrifuge tube with 15 μL proteinase K added, add 200 μL buffer AL, mix thoroughly and incubate at 70°C for 10 min;

[0034] 7) Add 200 μL of anhydrous ethanol, mix thoroughly, transfer to a QIAamp adsorption column, and centrifuge at 20,000 g for 1 min (if the liquid does not pass through the column completely, repeat the centrifugation once more);

[0035] 8) Wash the column with 500 μL of buffer AW1 and AW2 respectively, centrifuge for 3 min as in 7), and transfer the column to a new collection tube;

[0036] 9) Add an appropriate amount of buffer AE to the center of the adsorption column, place it at room temperature for 1 minute, and then centrifuge it for 1 minute to elute. The resulting metagenomic DNA can be used for downstream molecular biology experiments or stored at -20°C for future use.

[0037] 2. The genome of a strain of Prevotella bacteria (completeness of 97.47%, contamination rate of 0) was obtained by binning assembly technology of metagenomic analysis. It was annotated with a β-1,4-endo-xylanase gene (EC 3.2.1.8) by KEGG Enzyme database. The blast results of NR database showed that the highest amino acid identity with the β-1,4-endo-xylanase in NR database was about 69.01%. The conserved sequence of the β-1,4-endo-xylanase was analyzed, and the amplification primers of the β-1,4-endo-xylanase encoding gene were designed. The specific sequence is as follows:

[0038] Upstream primer P1 (SEQ ID NO.1):

[0039] CAATTCATGCTAAATTATATCCTTTGG,

[0040] Downstream primer P2 (SEQ ID NO.2):

[0041] TCTAGATTATTGCTTGTATTTCTTCAC.

[0042] The upstream and downstream primers P1 and P2 are used to amplify the β-1,4-endo-xylanase gene, and the restriction enzyme sites EcoRI and XbaI are introduced into the upstream and downstream primers respectively.

[0043] The amplification template was Asian elephant intestinal metagenomic DNA, and the PCR amplification reaction system was: EX Taq 1.25 μL, 10X Buffer 10 μL, dNTP mix 5 μL, P1 and P2 2.5 μL each, DNA 5 μL, ddH2O 73.75 μL, and the total volume was 100 μL.

[0044] The amplification reaction conditions were as follows: 94°C, 5 min; 94°C, 30 s; 55-61°C, 30 s; 72°C, 1 min (30 cycles); 72°C, 10 min; 4°C, 10 min.

[0045] The PCR product was verified by 0.8% agarose gel electrophoresis, and a band of 1659 bp was obtained. Figure 1 As shown, lane 1 is a DNA marker and lane 2 is a PCR amplification product. After gel recovery, the PCR product is double-digested and purified to obtain the β-1,4-endo-xylanase encoding gene Xyneleph from the Asian elephant intestinal metagenome Prevotella genus of the present invention, the nucleotide sequence of which is shown in SEQ ID NO.3, and the amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO.4.

[0046] Example 2 Preparation of β-1,4-endo-xylanase

[0047] 1. Construction of recombinant plasmid of β-1,4-endo-xylanase

[0048] 1) The expression plasmid pBE-S was double-digested with restriction endonucleases EcoRI and XbaI, and then the purified product of pBE-S plasmid digestion was ligated with the purified product of target gene digestion by T4 ligase at 16°C overnight. The ligation product was chemically transformed into E. coli DH5α.

[0049] 2) After colony PCR identification, double enzyme digestion identification and sequencing, the recombinant plasmid pBE-S-Xyneleph was obtained;

[0050] 3) The cloned strain E. coli DH5α / pBE-S-Xyneleph of the verified correct recombinant plasmid pBE-S-Xyneleph was stored at -80°C with 15% glycerol.

[0051] 2. Construction of recombinant β-1,4-endo-xylanase bacteria

[0052] 1) Add 1 μL (50 ng / μL) of pBE-S-Xyneleph recombinant plasmid to Bacillus subtilis WB600 competent cells and mix gently;

[0053] 2) After mixing, transfer to a pre-cooled electroporation cup, place on ice for 1-1.5 min, and then shock once (3.0 kV, 3.0-4.5 ms). After the shock, immediately add 1 mL of recovery medium (LB + 0.5 mol / L sorbitol + 0.38 mol / L mannitol);

[0054] 3) After shaking culture at 37°C for 3 hours, spread the bacterial solution on an LB plate containing Kan resistance and culture at 37°C for about 16 hours;

[0055] 4) Positive transformants were selected and double enzyme digestion was performed to verify that the recombinant Bacillus subtilis strain WB600 / pBE-S-Xyneleph expressing Xyneleph was obtained.

[0056] 3. Expression and preparation of β-1,4-endo-xylanase

[0057] 1) Pick a single colony of the recombinant Bacillus subtilis strain WB600 / pBE-S-Xyneleph and inoculate it into LB liquid medium containing kanamycin, and culture it at 37°C with shaking overnight;

[0058] 2) inoculating 2% of the seeds obtained in step 1) into 50 mL of LB liquid culture medium, and culturing at 37° C. with shaking for about 48 h;

[0059] 3) The fermentation liquid obtained in step 2) was centrifuged and the supernatant was collected to obtain a crude enzyme solution of high-stability β-1,4-endo-xylanase. The crude enzyme solution was subjected to SDS-PAGE electrophoresis. The results are shown in Figure 2 As shown, Figure 2 Lane 1 is a protein ladder, lane 2 is a fermentation broth sample after fermentation, lane 3 is a fermentation broth precipitate sample after centrifugation, and lane 4 is a fermentation broth supernatant sample after centrifugation;

[0060] 4) The activity of the crude β-1,4-endo-xylanase solution was determined using beech wood xylan as a substrate (under conditions of pH = 6.5 and 60°C). After fermentation with a recombinant strain of β-1,4-endo-xylanase expressed by Bacillus subtilis, the activity of the β-1,4-endo-xylanase could reach 200 U / mL. The β-1,4-endo-xylanase was precipitated by a graded salting-out method, and the protein precipitate was collected, dissolved, dialyzed for desalination, and then subjected to ion exchange chromatography and gel chromatography, and then freeze-dried to obtain pure β-1,4-endo-xylanase powder.

[0061] Example 3 Determination of β-1,4-endo-xylanase activity

[0062] The method for determining enzyme activity was the DNS reagent method. The enzyme activity was determined in three parallel experiments, and the results were averaged.

[0063] Enzyme activity unit (U): the amount of enzyme required to release 1 μmol of reducing sugar per minute.

[0064] Optimal pH of enzyme: At 50℃, place the reaction system at different pH (2.5~10.5, measured every 0.5℃, see Figure 3 ) buffer, the enzyme activity was determined, and the highest enzyme activity was taken as 100% to draw a pH-relative enzyme activity curve.

[0065] Optimum temperature: Under the optimal reaction pH conditions, take an appropriately diluted enzyme solution and place it in a 30-100℃ water bath for enzymatic hydrolysis. Measure the enzyme activity every 10℃, and take the highest enzyme activity as 100% to draw a temperature-relative enzyme activity curve.

[0066] pH stability: The enzyme solution was placed in buffer solutions of different pH values, incubated at 50°C for 5 h, and the residual enzyme activity was determined with the highest enzyme activity being 100%.

[0067] Thermal stability determination: Under the optimal reaction pH condition, the enzyme solution was placed in different temperature gradient conditions (30-100°C) and incubated for 2 hours. The highest enzyme activity was taken as 100%, and the residual enzyme activity of Xyneleph was determined.

[0068] The enzymatic properties of β-1,4-endo-xylanase were determined by the above method. When beechwood xylan was used as substrate to determine the enzymatic properties of β-1,4-endo-xylanase, the optimum pH of the enzyme was 6.5. Figure 3 , the optimum temperature is 60℃, see Figure 4 .

[0069] The pH stability and thermal stability of the β-1,4-endo-xylanase were determined using beechwood xylan as a substrate. The results showed that the bacterial β-1,4-endo-xylanase had good stability at 50-80°C and in the range of pH=5-9. Taking the enzyme activity at 60°C as the standard, the relative enzyme activity was higher than 90% in the range of 50-80°C. As the temperature increased, the enzyme activity gradually decreased. When the temperature was 100°C, the relative enzyme activity was only about 25%. The relative enzyme activity of the enzyme was relatively stable at pH=5-9, maintaining above 95%. When pH>9, the enzyme activity decreased rapidly. When the pH reached 10, the relative enzyme activity dropped to 20%.

[0070] Application Example 1 Degradation of soybean meal as feed raw material by β-1,4-endo-xylanase Xyneleph

[0071] This application example aims to determine the degradation effect of the enzyme on soybean meal, as follows:

[0072] The experimental feed raw material substrate is soybean meal, which is dried and crushed and passed through a 24-mesh sieve. The experiment was designed with two treatments: a control group (without enzyme) and an enzyme-added group.

[0073] Control group: Weigh 10g substrate feed, mix with enzyme at a feed-water ratio of 1:10 (water is 0.1mol / L acetic acid-sodium acetate buffer with pH=6.5), and shake once every 1h at 120r / min after the start of enzymolysis. After the enzymolysis is completed, add 5mL 10% trichloroacetic acid solution, take out an appropriate amount of enzymolysis sample, centrifuge at 4000r / min for 10min, collect the supernatant, and test.

[0074] Enzyme group: Weigh 10g substrate feed, and finally add β-1,4-endo-xylanase Xyneleph: 10U / g raw material; according to the material-water ratio of 1:10 (water is 0.1mol / L acetic acid-sodium acetate buffer with pH=6.5). The enzymolysis temperature is 60℃, and the enzymolysis is 5h. After the enzymolysis starts, oscillate once every 1h, at a speed of 120r / min, for 10min each time. After the enzymolysis is completed, add 5mL of 10% trichloroacetic acid solution, take out an appropriate amount of enzymolysis sample, centrifuge at 4000r / min for 10min, collect the supernatant, and test it.

[0075] The soluble reducing sugar content of the sample after enzymatic hydrolysis was determined by DNS method. An appropriate amount of sample solution was taken and placed in a 25 mL volumetric flask, and water was added to 2 mL. Then 1.5 mL of 3,5-dinitrosalicylic acid solution was added, and color was developed in boiling water for 5 min, and then quickly cooled with running water, and the volume was made up to 20 mL with water, and shaken. Zero was adjusted with distilled water, and the color was compared at 540 nm. The reducing sugar content was calculated by referring to the glucose standard curve.

[0076] Among them, reducing sugar growth rate (%) = (enzyme group - control group) / control group × 100%

[0077] The in vitro enzymatic hydrolysis of soybean meal by the β-1,4-endo-xylanase Xyneleph resulted in a reducing sugar increase rate of 54.5%.

[0078] In summary, the present invention provides a β-1,4-endo-xylanase derived from the Asian elephant feces metagenome, and provides the amino acid sequence and encoding gene sequence of the enzyme. At the same time, it also provides an efficient preparation method of the enzyme. The prepared β-1,4-endo-xylanase has a highly efficient enzymatic hydrolysis effect on soybean meal, can significantly improve the in vitro enzymatic hydrolysis reducing sugar growth rate of soybean meal, is beneficial to the pretreatment of soybean meal raw materials, and has application value for preparing feed using soybean meal.

[0079] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A β-1,4-endo-xylanase derived from the Asian elephant feces metagenome, characterized in that: The amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO.

4.

2. The use of the β-1,4-endo-xylanase according to claim 1 in any of the following items, comprising increasing the growth rate of reducing sugars in soybean meal by enzymatic hydrolysis in vitro; Enzymatic hydrolysis of soybean meal is used to prepare soybean meal feed.

3. The gene encoding β-1,4-endo-xylanase according to claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. A primer for identifying a gene encoding a gene as claimed in claim 3, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. A recombinant plasmid comprising the coding gene as claimed in claim 3.

6. The recombinant plasmid according to claim 5, characterized in that The recombinant plasmid is selected from prokaryotic plasmids.

7. The recombinant plasmid according to claim 6, characterized in that The prokaryotic plasmid is selected from pBE-S plasmid.

8. A recombinant bacterium capable of expressing the β-1,4-endo-xylanase according to claim 1.

9. The recombinant bacterium according to claim 8, characterized in that The recombinant bacteria is selected from Bacillus subtilis WB600.

10. The method for preparing β-1,4-endo-xylanase according to claim 1, characterized in that: Include: The recombinant bacteria in claim 8 or 9 are fermented and cultured, and the supernatant is collected after centrifugation to obtain the β-1,4-endo-xylanase.

Images