A β-1,4-endo-xylanase and its encoding gene and application

Abstract

The present invention discloses a β-1,4-endo-xylanase and its encoding gene and application, relating to the field of genetic engineering technology. The genome of a Lachnospiraceae fungus family NK4A136 bacterium with a completeness of 96.44% and a contamination rate of 0 was assembled using metagenomic binning technology, and the β-1,4-endo-xylanase gene was obtained through annotation in the KEGG Enzyme database. The nucleotide sequence of the β-1,4-endo-xylanase encoding gene is shown in SEQ ID NO.3, and its amino acid sequence is shown in SEQ ID NO.4. Compared with fungal-derived xylanases, the enzyme has good thermal stability and pH stability, can significantly improve the in vitro enzymatic hydrolysis reducing sugar growth rate of bran, is beneficial to the pretreatment of bran raw materials, and has application value to the preparation of feed using bran.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a beta-1,4-endo-xylanase, a coding gene thereof and an application thereof. Background Art

[0002] Xylan is the main component of hemicellulose, the second largest renewable resource on Earth, and the most abundant polysaccharide besides cellulose. In today's world of energy scarcity and severe pollution, the rational utilization of renewable resources is urgent. Therefore, the full utilization of xylan has attracted much attention. However, xylan has a complex chemical structure, and its degradation requires the help of a complex set of hydrolytic enzymes, the most important of which is β-1,4-endo-xylanase (β-1,4-D-xylanohydrolase: EC 3.1.2.8).

[0003] β-1,4-endo-xylanase is the most important enzyme in the xylan hydrolysis process, primarily acting on the glycosidic bonds of β-1,4-D-xylosidic bonds. The hydrolysis products are xylose, xylobiose, and higher xylo-oligosaccharides. β-1,4-endo-xylanases derived from wild fungi such as Trichoderma and Aspergillus generally have low enzymatic activity. Furthermore, the protein subunits of fungal xylanases are more complex than those from bacteria, and their thermal stability is inferior to that of bacterial xylanases. Therefore, the majority of xylanases currently used in industrial applications are derived from bacteria. Currently, the exploration of bacterial β-1,4-endo-xylanase gene resources is limited, and further research is needed to discover highly active and stable bacterial β-1,4-endo-xylanases.

[0004] With the development of sequencing technology, combined with metagenomic analysis methods, in terms of mining microbial functional enzyme genes, it is possible to successfully avoid the difficulties of traditional microbial pure culture technology, and quickly discover a large number of functional enzyme genes in a short period of time, thereby improving the breadth and effectiveness of functional enzyme gene screening, greatly promoting the improvement of functional enzyme gene cloning efficiency, and providing a new research strategy for searching and discovering bacterial β-1,4-endoxylanase genes. Summary of the Invention

[0005] The purpose of the present invention is to provide a β-1,4-endo xylanase with better pH stability and temperature stability. The enzyme is obtained by annotating the Asian elephant feces metagenome, filling the shortcomings of the existing β-1,4-endo xylanase in industrial production.

[0006] In order to achieve the above object, the present invention provides a β-1,4-endo-xylanase, the amino acid sequence of which is shown in SEQ ID NO. 4. The β-1,4-endo-xylanase can be used to increase the growth rate of reducing sugars in bran by enzymatic hydrolysis in vitro or / and to prepare bran feed by enzymatically hydrolyzing bran.

[0007] The present invention also provides a gene encoding the above-mentioned β-1,4-endo-xylanase, and the nucleotide sequence of the gene encoding the β-1,4-endo-xylanase is shown in SEQ ID NO.3.

[0008] The present invention also provides a primer for identifying the above-mentioned coding gene, and the nucleotide sequence of the primer is shown as SEQ ID NO.1 and SEQ ID NO.2.

[0009] The present invention also provides a recombinant plasmid comprising the above encoding gene, wherein the recombinant plasmid is selected from a prokaryotic plasmid.

[0010] Preferably, the above-mentioned prokaryotic plasmid is selected from pET28a(+).

[0011] The present invention also provides a recombinant bacterium capable of expressing the above-mentioned β-1,4-endo-xylanase. The recombinant bacterium is preferably selected from Escherichia coli BL21 (DE3).

[0012] The present invention also provides a method for preparing the above-mentioned β-1,4-endo-xylanase, comprising:

[0013] The above recombinant bacteria were fermented and cultured, induced by IPTG, and then the supernatant was collected by centrifugation to obtain β-1,4-endo-xylanase.

[0014] The present invention has the following advantages:

[0015] The present invention uses metagenomic binning technology to assemble a genome of a bacterium from the genus NK4A136 of the Lachnospiraceae family, with a completeness of 96.44% and a contamination rate of 0. The β-1,4-endo-xylanase encoding gene was annotated using the KEGG Enzyme database, and the β-1,4-endo-xylanase Xylanmeta was prepared using genetic engineering techniques. Compared to fungal xylanases, the bacterial β-1,4-endo-xylanase Xylanmeta exhibits excellent stability at temperatures between 60 and 80°C and within the pH range of 5 to 8, with improved pH and temperature stability.

[0016] The β-1,4-endo-xylanase provided by the present invention can effectively fill the problems of the physicochemical properties of existing β-1,4-endo-xylanase, especially the poor tolerance to conditions such as pH and temperature, and has a good effect on the degradation of bran, can increase the growth rate of reducing sugars in bran by enzymatic hydrolysis in vitro, and has practical value in the preparation of feed, especially in the pretreatment of bran raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the electrophoresis result of PCR amplification verification of the β-1,4-endoxylanase encoding gene in the present invention.

[0018] Figure 2 This is the protein SDS-PAGE gel electrophoresis result of the β-1,4-endo-xylanase in the present invention.

[0019] Figure 3 The curve showing the effect of temperature on the activity of β-1,4-endoxylanase in the present invention.

[0020] Figure 4 This is the curve showing that the activity of β-1,4-endoxylanase in the present invention is affected by pH. DETAILED DESCRIPTION

[0021] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0022] Note: Unless otherwise noted, the experimental methods in the following examples are conventional methods, performed according to the techniques and conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples, unless otherwise noted, are commercially available.

[0023] The original data of Asian elephant intestinal metagenomic sequencing used in the present invention have been deposited in the genome sequence archive of the Big Data Center of the Chinese Academy of Sciences with the accession number CRA003369.

[0024] Example 1 Acquisition of β-1,4-endoxylanase Encoding Gene

[0025] 1. Metagenomic DNA was extracted from fresh fecal samples of Asian elephants stored in our laboratory using the QIAamp DNA Stool Mini Kit. The steps for extracting metagenomic DNA from fresh fecal samples of Asian elephants are as follows:

[0026] 1) Weigh approximately 0.2 g of Asian elephant feces into a sterile centrifuge tube;

[0027] 2) Add 1.4 mL of buffer ASL, vortex continuously for several minutes to mix thoroughly, incubate at 70°C for 5 minutes, and then vortex again for 15 seconds;

[0028] 3) Centrifuge at 20,000 g for 1 min to remove fecal impurities and transfer the supernatant to a new centrifuge tube;

[0029] 4) Add one inhibitorEX Tablet and mix immediately for about 1 minute. Then, let the tube stand at room temperature for 1 minute to allow the inhibitor to adsorb to the inhibitorEX matrix. Centrifuge at 20,000 g for 3 minutes.

[0030] 5) Transfer the supernatant to a new centrifuge tube and centrifuge once more as in 4);

[0031] 6) Pipette the supernatant into a new centrifuge tube with 15 μL of proteinase K added, add 200 μL of buffer AL, mix thoroughly, and incubate at 70°C for 10 min.

[0032] 7) Add 200 μL of anhydrous ethanol, mix thoroughly, transfer to a QIAamp column, and centrifuge at 20,000 g for 1 min (if the liquid does not pass through the column completely, repeat the centrifugation once more);

[0033] 8) Wash the column with 500 μL of buffer AW1 and AW2, respectively. Centrifuge for 3 minutes as in 7) and transfer the column to a new collection tube.

[0034] 9) Add an appropriate amount of buffer AE to the center of the adsorption column, let it stand at room temperature for 1 minute, and then centrifuge for 1 minute to elute. The resulting metagenomic DNA can be used for downstream molecular biology experiments or stored at -20°C for future use.

[0035] 2. By means of metagenomic sequencing and binning technology, a genome of a bacterium of the genus NK4A136 of the Lachnospiraceae family with a completeness of 96.44% and a contamination rate of 0 was assembled. The KEGG Enzyme database was annotated to contain a β-1,4-endoxylanase gene (EC 3.2.1.8). The amino acid sequence of the β-1,4-endoxylanase was blasted to the NR database. The result showed that the highest amino acid identity with the β-1,4-endoxylanase in the NR database was 89.6%. The conserved sequence of the β-1,4-endoxylanase gene was analyzed, and the amplification primers of the β-1,4-endoxylanase encoding gene of the present invention were designed. The specific sequence is as follows:

[0036] Upstream primer P1 (SEQ ID NO.1):

[0037] CATATGATGAATATTAGCACAACACCTAAG,

[0038] Downstream primer P2 (SEQ ID NO.2):

[0039] TCTAGATTATAATTCGATATGGATATTCTTC.

[0040] The upstream and downstream primers P1 and P2 are used to amplify the β-1,4-endo-xylanase target gene, and the upstream and downstream primers introduce restriction enzyme cutting sites NdeI and XbaI respectively.

[0041] The amplification template was Asian elephant intestinal metagenomic DNA, and the PCR amplification reaction system was: EX Taq 1.25 μL, 10X Buffer 10 μL, dNTP mix 5 μL, P1 and P2 2.5 μL each, DNA 5 μL, ddH2O 73.75 μL, total volume 100 μL.

[0042] The amplification reaction conditions were as follows: 94°C, 5 min; 94°C, 30 s; 55-61°C, 30 s; 72°C, 1 min (30 cycles); 72°C, 10 min; 4°C, 10 min.

[0043] The PCR product was verified by 1% agarose gel electrophoresis, and a 1272 bp band was obtained. Figure 1 As shown, lane 1 is a DNA marker and lane 2 is a PCR amplification product. The PCR product was recovered from the gel, then subjected to double enzyme digestion and purification and recovery to obtain the β-1,4-endo-xylanase encoding gene Xylanmeta derived from the metagenome assembly genome of the present invention, the nucleotide sequence of which is shown in SEQ ID NO. 3, and the amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO. 4.

[0044] Example 2 Preparation of β-1,4-endoxylanase

[0045] 1. Construction of β-1,4-endo-xylanase recombinant plasmid

[0046] 1) Plasmid pET28a(+) was double-digested with restriction endonucleases NdeI and XbaI. The purified product was then ligated with the purified product of target gene digestion using T4 ligase at 16°C overnight. The ligation product was then chemically transformed into E. coli DH5α.

[0047] 2) After colony PCR identification, double enzyme digestion identification, and sequencing, the recombinant plasmid pET28a-Xylanmeta was obtained;

[0048] 3) The cloned strain E. coli DH5α / pET28a-Xylanmeta containing the correct recombinant plasmid pET28a-Xylanmeta was stored at -80°C with 20% glycerol.

[0049] 2. Construction of recombinant β-1,4-endo-xylanase bacteria

[0050] 1) Add 10 μL of the successfully constructed recombinant plasmid pET28a-Xylanmeta to E. coli BL21 (DE3) competent cells, mix gently, and incubate on ice for 30 minutes;

[0051] 2) Place the mixture after ice bath in a 42°C water bath for heat shock for 1.5 minutes, and then ice bath for 5-10 minutes;

[0052] 3) Add 500 μL of LB liquid medium (without antibiotics) to a sterile workbench, incubate in a constant temperature high-speed incubator at 37°C and 180 rpm for 1 hour, and centrifuge at 7000 rpm for 3 minutes;

[0053] 4) Transfer the suspension to a sterile workbench and collect 100-200 μL of the bacterial suspension. Pipette all the bacterial suspension onto a LB solid culture dish containing Kan antibiotics and incubate in a 37°C constant temperature incubator for 16 h.

[0054] 5) After colony PCR identification and correct sequencing, it was determined that the recombinant E. coli strain E. coli BL21(DE3) / pET28a-Xylanmeta expressing Xylanmeta was obtained.

[0055] 3. Expression and preparation of β-1,4-endo-xylanase

[0056] 1) Pick a single colony of E. coli BL21(DE3) / pET28a-Xylanmeta and inoculate it into LB liquid medium. Cultivate with shaking at 37°C.

[0057] 2) The seeds obtained in step 1) were inoculated into LB liquid medium at a rate of 0.1%, and cultured at 37°C and 180 rpm for about 3-4 hours until the OD 600 Reach 0.6~1.0;

[0058] 3) Add IPTG (final concentration 0.7 mmol / L) to the culture medium from step 2) and induce expression for 15 h at 28°C and 160 rpm.

[0059] 4) After induction, centrifuge at 8000 rpm for 6 minutes, collect the cells, resuspend them in Tris-HCl (pH 7.0) buffer, and disrupt the cells by ultrasound in an ice-water bath (300 W, ultrasound on for 5 seconds, ultrasound off for 7 seconds). Centrifuge the ultrasonically disrupted cell liquid in a refrigerated centrifuge at 4°C and 12000 rpm for 10 minutes. Repeat 2 to 3 times (no miscellaneous cell debris) and collect the supernatant to obtain a highly stable β-1,4-endo-xylanase enzyme solution.

[0060] 5) The activity of crude β-1,4-endo-xylanase solution was determined using beechwood xylan as a substrate (under conditions of pH = 6 and 70°C). After fermentation with a recombinant strain expressing β-1,4-endo-xylanase in Escherichia coli, the activity of β-1,4-endo-xylanase reached 290 U / mL. β-1,4-endo-xylanase was then precipitated by a graded salting-out method. The protein precipitate was collected, dissolved, dialyzed for desalination, and subjected to ion exchange chromatography and gel chromatography before freeze-drying to obtain pure β-1,4-endo-xylanase powder. The obtained enzyme powder was subjected to SDS-PAGE electrophoresis. The results are shown in the figure. Figure 2 As shown, Figure 2 Lane 1 is the protein ladder, and lane 2 is the obtained enzyme powder sample.

[0061] Example 3 Determination of β-1,4-endo-xylanase activity

[0062] The enzyme activity was determined using the DNS reagent method. The enzyme activity was determined in triplicate and the results were averaged.

[0063] Enzyme activity unit (U): the amount of enzyme required to release 1 μmol of reducing sugar per minute.

[0064] Optimum pH: At 50°C, the reaction system was placed in different pH (4-9, see Figure 3 The enzyme activity was measured in a buffer solution (as shown), and the highest enzyme activity was taken as 100% to draw a pH-relative enzyme activity curve.

[0065] Optimum temperature: Under the optimal reaction pH conditions, take an appropriately diluted enzyme solution and place it in a 55-90℃ water bath for enzymatic hydrolysis reaction. Measure the enzyme activity every 5℃, and take the highest enzyme activity as 100% to draw a temperature-relative enzyme activity curve.

[0066] pH stability: The enzyme solution was placed in buffer solutions of different pH values ​​and incubated at 70°C for 5 h. The residual enzyme activity was determined with the highest enzyme activity being 100%.

[0067] Thermal stability determination: Under the optimal reaction pH conditions, the enzyme solution was placed in different temperature gradient conditions (55-90°C) and incubated for 2 hours. The highest enzyme activity was taken as 100%, and the residual enzyme activity of Xylanmeta xylanase was determined.

[0068] The enzymatic properties of the β-1,4-endoxylanase were determined by the above method. The enzymatic properties of the β-1,4-endoxylanase are as follows:

[0069] When beechwood xylan was used as substrate to determine the enzymatic properties of β-1,4-endo-xylanase, the optimum temperature was 70°C. Figure 3 , the optimum pH is 6, see Figure 4 ;

[0070] The pH and thermostability of the β-1,4-endo-xylanase were determined using beechwood xylan as a substrate. The results showed good stability within the pH range of 5 to 8 at temperatures between 60 and 80°C. Using the enzyme activity at 70°C as a standard, the relative enzyme activity remained above 88% within the 60-80°C range. The enzyme activity gradually decreased with increasing temperature, reaching only around 20% at 90°C. Using the enzyme activity at pH 6 as a standard, the enzyme's relative activity remained relatively stable within the pH range of 5 to 8, maintaining above 90%. Above pH 9, the relative enzyme activity dropped to 25%.

[0071] Application Example 1 Degradation of Feed Raw Material Bran by β-1,4-endo-xylanase Xylanmeta

[0072] This application example aims to determine the effect of the enzyme on the degradation of bran, as follows:

[0073] The experimental feed raw material substrate is bran, which is dried and crushed and passed through a 24-mesh sieve. The experiment was designed with two treatments: a control group (no enzyme) and an enzyme-added group.

[0074] Control group: Weigh 10g of substrate feed and mix with enzyme at a 1:10 feed-water ratio (water is 0.1mol / L acetic acid-sodium acetate buffer at pH 6.5). Perform enzymatic hydrolysis. After the start of enzymatic hydrolysis, shake once every 1 hour at 120 rpm. After the enzymatic hydrolysis is complete, add 5mL of 10% trichloroacetic acid solution. Remove an appropriate amount of enzymatic hydrolysis sample and centrifuge at 4000 rpm for 10 minutes. Collect the supernatant and measure its reducing sugar content.

[0075] Enzyme-added group: 10 g of substrate feed was weighed and supplemented with 10 U / g of β-1,4-endo-xylanase Xylanmeta at a 1:10 feed-to-water ratio (water was in 0.1 mol / L acetic acid-sodium acetate buffer at pH 6.5). The enzymatic hydrolysis temperature was 60°C for 5 hours. After the start of the hydrolysis, the mixture was shaken once every hour at 120 rpm for 10 minutes. After the hydrolysis was complete, 5 mL of 10% trichloroacetic acid solution was added. An appropriate amount of the hydrolyzed sample was removed and centrifuged at 4000 rpm for 10 minutes. The supernatant was collected and the reducing sugar content was measured.

[0076] The soluble reducing sugar content of the enzymatically hydrolyzed sample was determined using the DNS method. An appropriate amount of sample solution was placed in a 25 mL volumetric flask, and the volume was made up to 2 mL with water. 1.5 mL of 3,5-dinitrosalicylic acid solution was then added. The solution was developed in boiling water for 5 minutes. The solution was then rapidly cooled with running water, diluted to 20 mL with water, and shaken to mix. The solution was zeroed with distilled water, and the colorimetric reading was compared at 540 nm. The reducing sugar content was determined by reference to a glucose standard curve.

[0077] Among them, reducing sugar growth rate (%) = (reducing sugar content of enzyme-added group - reducing sugar content of control group) / reducing sugar content of control group × 100%

[0078] The increasing rate of reducing sugar in bran enzymatically hydrolyzed by β-1,4-endo-xylanase Xylanmeta was 84.2%.

[0079] In summary, the present invention provides a β-1,4-endo-xylanase, and provides the amino acid sequence and encoding gene sequence of the enzyme. At the same time, it also provides an efficient preparation method of the enzyme. The prepared β-1,4-endo-xylanase has a highly efficient enzymatic hydrolysis effect on bran, can significantly increase the growth rate of reducing sugars in the in vitro enzymatic hydrolysis of bran, is beneficial to the pretreatment of bran raw materials, and has application value in preparing feed using bran.

[0080] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A β-1,4-endoxylanase, characterized in that The amino acid sequence of the β-1,4-endoxylanase is shown in SEQ ID NO.

4.

2. The use of the β-1,4-endo-xylanase according to claim 1 in any one of the following methods, comprising increasing the growth rate of reducing sugars produced by enzymatic hydrolysis in bran in vitro; Enzymatically hydrolyzed bran is used to prepare bran feed.

3. The gene encoding β-1,4-endoxylanase according to claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.

3.

4. A primer for identifying a gene encoding a gene according to claim 3, wherein: The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.

2.

5. A recombinant plasmid comprising the coding gene according to claim 3.

6. The recombinant plasmid according to claim 5, characterized in that The recombinant plasmid is selected from prokaryotic plasmids.

7. The recombinant plasmid according to claim 6, characterized in that The prokaryotic plasmid is selected from pET28a(+). A recombinant bacterium capable of expressing the β-1,4-endoxylanase according to claim 1 .

9. The recombinant bacterium according to claim 8, characterized in that The recombinant bacteria is selected from Escherichia coli BL21 (DE3).

10. The method for preparing β-1,4-endoxylanase according to claim 1, wherein Include: The recombinant bacteria according to claim 8 or 9 are fermented and cultured, induced by IPTG, and then centrifuged and the supernatant is collected to obtain the β-1,4-endo-xylanase.

Images