Method for targeted knockout of pig TXLNB gene locus and application

Abstract

The invention discloses a method for targeted knockout of a pig TXLNB gene locus and application, and belongs to the technical field of gene editing engineering. The invention designs a TXLNB gene knockout method based on a CRISPR / Cas9 system, and particularly, by screening a gRNA target and a gRNA combination, it is found that efficient TXLNB gene deletion can be realized by adopting a specific gRNA combination when two ends of a TXLNB exon 3 are targeted. The animal model formed by deleting related gene segments in the porcine fibroblasts and then transplanting the knocked-out cells into miniature pig bodies has obvious phenotypes and has huge potential in related research of pig breeding.

Description

Technical Field

[0001] The present invention relates to a method and application for targeted knockout of pig TXLNB locus, belonging to the technical field of gene editing. Background Art

[0002] The TXLNB gene is a member of the TXLN gene family (including TXLNA, TXLNB and TXLNG) and encodes the β-taxilin protein. The common feature of the proteins encoded by the TXLN gene family (including α-taxilin, β-taxilin and γ-taxilin) ​​is that they have a very long coiled-coil domain at their C-terminus, namely the taxilin domain. All members of this family interact with members of the syntaxin protein family and may be related to the intracellular vesicle transport process. In 2002, Japanese researchers Kazuhiro et al. first cloned the TXLNB gene (also known as MDP77) from the cDNA library of chicken muscle tissue. The TXLNA and TLXNG genes in the TXLN family are both ubiquitously expressed in multiple tissues, while the TXLNB gene is only expressed in heart and muscle tissues. This unique expression pattern suggests that the TXLNB gene may have a special role related to muscle cells. By immunohistochemical analysis of chicken embryos and primary chicken myoblasts cultured in vitro, it was further found that the TXLNB gene was only expressed in differentiated and mature myotubes, but not in unfused myoblasts. Subsequently, Hiroshi et al. further explored the role of the TXLNB gene in muscle development in a mouse model. In mice, the TXLNB gene is also only expressed in cardiac and skeletal muscle tissues. By detecting the expression level of the TXLNB gene in the mouse myoblast cell line C2C12 at different stages of differentiation, it was found that TXLNB was not expressed in undifferentiated myoblasts, and then the expression level gradually increased from the second day of differentiation. These results are consistent with the data in chickens above. Subsequently, a TXLNB knockdown C2C12 cell line was constructed by siRNA technology, and it was found that the fusion of muscle cells and the differentiation of myotubes were inhibited after knocking down TXLNB, and the formed myotubes were reduced and the diameter became thinner. This result indicates that the TXLNB gene plays a certain role in the differentiation and maturation of myoblasts.

[0003] The above research results indicate that the TXLNB gene is involved in regulating the biological process of myogenic differentiation and is a potential target gene for regulating animal skeletal muscle development.

[0004] Skeletal muscle is the largest organ in the human body and plays a vital role in supporting and protecting the body. It is a key tissue for movement, gesture assistance, metabolic homeostasis and heat production. It accounts for about 40% of total body weight and 50% of total protein. Skeletal muscle atrophy is characterized by weakening, shrinking and reducing muscle mass and fiber cross-sectional area at the histological level. At present, clinical treatment mainly focuses on physical therapy (exercise training, electrical stimulation therapy), drug therapy (nutritional nerve drugs, microcirculation improvement drugs, hormone drugs), surgical treatment, etc. Studies have found that in terms of transcriptional expression profiles, the similarity between pig skeletal muscle and the expression profiles of human pseudohypertrophic muscular dystrophy (DMD) and progressive spinal muscular atrophy (SMA) susceptibility genes reaches the human / mouse similarity level, and the pig skeletal muscle proteomics is also very similar to that of humans (Xu, et al. 2013, Advanced Science).

[0005] However, there are no TXLNB knockout experiments in pigs, and the efficiency and accuracy of gene editing in pigs are far less than those of commonly used gene-edited animals such as mice and rats, which also makes it difficult to target and knock out the pig TXLNB gene. To this end, we conducted TXLNB knockout experiments in miniature pigs, established a method that can efficiently, accurately and effectively delete TXLNB, and obtained pig fibroblasts with the TXLNB gene deleted, in order to obtain a miniature pig model of muscular atrophy and provide a new animal model for the mechanism research and treatment of muscular atrophy. Summary of the invention

[0006] To solve the above problems, the present invention provides a method for efficiently knocking out the TXLNB gene in pigs by screening sgRNA target sites. This method can efficiently and conveniently achieve the deletion of specific genes while reducing damage to transfected cells. Moreover, the present invention is expected to obtain a miniature pig model of muscular atrophy by constructing pig fibroblasts with TXLNB gene knockout, providing a new animal model for the mechanism research and treatment of muscular atrophy.

[0007] The first object of the present invention is to provide an sgRNA for knocking out the TXLNB gene in pigs, wherein the sgRNA comprises the sequence shown in SEQ ID NO.1-2, wherein:

[0008] SEQ ID NO.1: 5'-ATATAGTATGCCTTCCGATA-3',

[0009] SEQ ID NO. 2: 5'-ATAGAGCGTCTCACCTGCAT-3'.

[0010] The second object of the present invention is to provide a recombinant expression vector containing the sgRNA.

[0011] The third object of the present invention is to provide a gene editing system for TXLNB gene knockout in pigs, wherein the gene editing system comprises an expression frame of the sgRNA and a Cas9 nuclease expression frame.

[0012] The fourth object of the present invention is to provide a recombinant porcine fibroblast (cell model) treated with the gene editing system.

[0013] Furthermore, the gene editing system is used to knock out the gene TXLNB in ​​fibroblasts.

[0014] Furthermore, the TXLNB genotype of the gene-edited recombinant porcine fibroblasts was 5'-GACAATGATAAA ATATAGTATGCCTTCC GCATGGGCCCCTCTGAGG-3'.

[0015] The fifth object of the present invention is to provide a method for knocking out the gene TXLNB in ​​pig fibroblasts, using the gene editing system for knocking out.

[0016] Furthermore, it can be used for gene knockout in vivo or in vitro.

[0017] The sixth object of the present invention is to provide the use of the sgRNA, recombinant expression vector, gene editing system or recombinant porcine fibroblasts in the preparation of porcine breeding products or animal models.

[0018] Furthermore, the gene-edited recombinant porcine fibroblasts were transplanted into miniature pigs for preparation.

[0019] Beneficial effects of the present invention:

[0020] The present invention screened the gRNA target and found that compared with other targets, efficient TXLNB gene deletion can be achieved when targeting both ends of TXLNB exon 3. At the same time, after successfully deleting the TXLNB gene in pig fibroblasts, the obtained cell model can not only be used for related research, but also the animal model formed after transplanting it into miniature pigs also has obvious phenotypes, which is helpful for the research on the mechanism of muscle atrophy, such as breeding pigs with gene mutation and muscle atrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Differentiation status of C2C12 cells for wild type and long fragment deletion.

[0022] Figure 2 This is a diagram showing the knockout efficiency identification results of different gRNA combinations.

[0023] Figure 3 Schematic diagram of the TXLNB gene and the positions of the F1 / R1 and F2 / R2 primers.

[0024] Figure 4 Schematic diagram of long fragment deletion for cloning point.

[0025] Figure 5 This is the cell confluence status before freezing. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0027] Example 1: gRNA screening

[0028] Based on the structure of TXLNB, we used C2C12 cells to construct a C2C12 cell model with exon 3 of the TXLNB gene knocked out. The differentiation results of wild-type C2C12 cells are shown in the schematic diagram. Figure 1 A, The differentiation results of C2C12 cells with long fragment deletion are shown in the schematic diagram Figure 1 B, it can be seen that the deletion of this long fragment leads to the inhibition of muscle cell fusion and myotube differentiation, and the number of formed myotubes is reduced and the diameter is thinner.

[0029] Therefore, we designed gRNAs targeting both ends of exon 3 of the porcine TXLNB gene, where gRNA1: 5'-ATATAGTATGCCTTCCGATA-3' targets the 5'-ATATAGTATGCCTTCCGATA-3' sequence on intron 2 of TXLNB; gRNA2: 5'-ATAGAGCGTCTCACCTGCAT-3' targets the sequence 5'-ATAGAGCGTCTCACCTGCAT-3' on intron 3 of TXLNB; gRNA3: 5'-TTACATGGTATTACTGCGCA-3' targets the 5'-TTACATGGTA on intron 2 of TXLNB TTACTGCGCA-3' sequence; gRNA4: 5'-GTGAGACGCTCTATCTTTAG-3' targeting 5'-GTGAGACGCTCTATCTTTAG-3' sequence on TXLNB intron 3; gRNA5: 5'-CCTATTCTGATTAGACAGGG-3' targeting 5'-CCTATTCTGATTAGACAGGG-3' sequence on TXLNB intron 2; gRNA6: 5'-TGGCGTGGAAAATGAAGTCG-3' targeting 5'-TGGCGTGGAAAATGAAGTCG-3' sequence on TXLNB intron 3. Nine different knockout schemes can be obtained by combining gRNAs on introns 2 and 3 in pairs.

[0030] By comparing the knockout efficiency of TXLNB gene exon 3 after transfection with 9 gRNA combinations, we found that gRNA1: 5'-ATATAGTATGCCTTCCGATA-3' and gRNA2: 5'-ATAGAGCGTCTCACCTGCAT-3' had the highest knockout efficiency. The results are shown in the schematic diagram. Figure 2 .

[0031] Example 2: Construction of gene deletion vector

[0032] Based on the results of Example 1, the vector we used was the U6 promoter-driven gRNA cloning vector pX459. The gRNAs used targeted both ends of exon 3 of the pig TXLNB gene, wherein gRNA1: 5'-ATATAGTATGCCTTCCGATA-3' targeted the 5'-ATATAGTATGCCTTCCGATA-3' sequence on TXLNB intron 2; gRNA2: 5'-ATAGAGCGTCTCACCTGCAT-3' targeted the sequence 5'-ATAGAGCGTCTCACCTGCAT-3' on TXLNB intron 3. When these two gRNA sites were cut at the same time, the third exon (92bp) of the TXLNB gene was excised, resulting in a frameshift mutation, and a stop codon was formed in advance at the beginning of the subsequent fourth exon, so that the gene expressed a non-functional truncated mutant protein.

[0033] First, the pX459 vector was linearized using BbsI restriction endonuclease, and then the primers gDNA-TXLNB-F1: 5'-caccgATATAGTATGCCTTCCGATA-3' and gDNA-TXLNB-R1: 5'-aaacTATCGGAAGGCATACTATAT-3' were annealed to construct the pX459-gRNA-1 vector; the primers gDNA-TXLNB-F2: 5'-caccgATATAGTATGCCTTCCGATA-3' and gDNA-TXLNB-R2: 5'-aaacTATCGGAAGGCATACTATAT-3' were annealed to construct the pX459-gRNA-2 vector.

[0034] Example 3: Culture, transfection and screening of porcine fetal fibroblasts

[0035] Porcine fetal fibroblasts (PFFs) were isolated from 32-day-old male Chinese laboratory miniature pig embryos. These primary cells were cultured in high glucose Dulbecco's Medium Eagle (Gibco, Gaithersburg, DE, USA) containing 20% ​​fetal bovine serum (FBS, Gibco).

[0036] All animal experiments were performed according to the guidelines established by the Chinese Animal Care and Protocol Committee and approved by the Experimental Animal Welfare Committee of Zhejiang University (Zhejiang Province, China).

[0037] The Lonza 4D-Nucleofector was used to transfect PFFs with 3 μg pX459-gRNA-1 and 3 μg pX459-gRNA-2. The PFFs were thawed and cultured one day before transfection. Then, the electroporation reagent 82 μL PS solution and 18 μL supplement were used for transfection at parameter DO-113, and approximately 1×10 6 PFFs cells. Since both pX459-gRNA-1 and pX459-gRNA-2 vectors carry Puro R Resistance, so puromycin antibiotics were used for subsequent screening. 24 hours after transfection, the monoclonal limiting dilution method was used for cell screening: the cells were plated in a 96-well plate at 50 cells / well. After 24 hours, the cells were cultured in DEME containing 3μg / mL puromycin and 20% FBS for 3 days, and then replaced with DEME medium containing 20% ​​FBS without puromycin until a single cell clone point grew. Then a single cell clone point was selected and cultured in a 24-well plate. When a clone point appeared in the 24-well plate, it was digested and transferred to a 6-well plate for continued culture. The remaining small amount of cells continued to grow in the 24-well plate, and the genome was subsequently extracted to identify mutations. When the cells transferred to the 6-well plate reached confluence, they were frozen and stored for subsequent somatic cell nuclear transplantation operations.

[0038] Example 4: Detection of gene modification and exogenous gene integration

[0039] Genomic DNA was extracted using a Genomic DNA Purification Kit (EZBioscoence), and then PCR was performed using a high-fidelity polymerase (Thermo Fisher Scientific). The primers for detecting long fragment gene deletion were F1: 5'-TGTGCTGTATATCCTCCCACAATCA-3' and R1: 5'-ATTATGCAGACTGTTGCCTTTGGA-3'; the primers for detecting long fragment gene non-deletion were F2: 5'-GCTAATCCTCACTTATTCTGCAAGG-3 and R2: 5'-ACGTAATTGAAGGTAGAGTGGACTC-3.

[0040] F1 / R1 is located on both sides of the designed gRNA1 and gRNA2 sites, with the gene fragment from intron 2 to intron 3 of the long fragment TXLNB in ​​the middle; and F2 / R2 is a primer designed based on a fragment of about 540bp on exon 3 of the TXLNB gene. If exon 3 of the long fragment TXLNB gene is not deleted, the amplification span of the F1 / R1 primer is too large to fully amplify the template, resulting in no specific band, while the F2 / R2 primer can amplify a specific band of about 540bp; if exon 3 of the long fragment TXLNB gene is deleted, the F1 / R1 primer can amplify a specific band of about 527bp, while the F2 / R2 primer will not have a specific band. See the schematic diagram of the TXLNB gene and the schematic diagram of the positions of the F1 / R1 and F2 / R2 primers. Figure 3 .

[0041] Pure water was used as a negative control. If the positive cell clone point is homozygous, there will be a 527bp band when F1 / R1 is used for PCR amplification, but no band when primers F2 / R2 are used for PCR amplification; if the positive cell clone point is heterozygous, 527bp and 540bp bands will appear when primers F1 / R1 and F2 / R2 are used for PCR amplification, respectively.

[0042] After about 3 days of screening, it was identified that there was at least one correct long fragment deletion clone among the 14 clones, and the genotype was TXLNB - / - The deletion rate was 7.14%. The positive clones were cryopreserved and used as donor cells for somatic cell nuclear transplantation. The wild-type TXLNB locus sequence is 5'-TGACAATGATAAA ATATAGTATGCCTTCCGATA TGG— / / —ATAGAGC GTCTCACCTGCATGGGCCCCTCTGAGGCCCTGG-3'. After sequencing, the sequence of the site after deleting one cloning site was: 5'-GACAATGATAAA ATATAGTATGCCTTCC GCATGGGCCCCTCTGAGG-3', the schematic diagram of the long fragment deletion of this positive cloning point is shown in Figure 4 .

[0043] The cell confluence status before freezing of positive clones is shown in Figure 5 .

[0044] Obviously, the above embodiments are only examples for clear explanation and are not intended to limit the implementation methods. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from this are still within the protection scope of the invention.

Claims

1. A sgRNA for knocking out the TXLNB gene in pigs, characterized in that: The sgRNA comprises the sequence shown in SEQ ID NO.1-2.

2. A recombinant expression vector containing the sgRNA according to claim 1.

3. A gene editing system for TXLNB gene knockout in pigs, characterized in that: The gene editing system comprises the sgRNA expression frame and the Cas9 nuclease expression frame of claim 1.

4. A recombinant cell treated with the gene editing system according to claim 3.

5. The recombinant cell according to claim 4, characterized in that The recombinant cells include recombinant porcine fibroblasts.

6. The recombinant cell according to claim 5, characterized in that The TXLNB genotype of the gene-edited recombinant porcine fibroblasts was 5'-GACAATGATAAAATATAGTATGCCTTCCGCATGGGCCCCTCTGAGG-3'.

7. A method for knocking out the gene TXLNB in ​​pig fibroblasts, characterized in that: The knockout is performed using the gene editing system described in claim 3.

8. The method according to claim 7, characterized in that The gene editing system is used to perform gene knockout in vivo or in vitro.

9. Use of the sgRNA according to claim 1, the recombinant expression vector according to claim 2, the gene editing system according to claim 3, or the recombinant cell according to any one of claims 4 to 6 in preparing pig breeding products or preparing animal models.

10. The use according to claim 9, characterized in that: The animal model includes a muscular atrophy animal model.

Images