Rat model suitable for bone injury repair mechanism and effect research and construction method thereof

Abstract

The invention discloses a rat model suitable for bone injury repair mechanism and effect research and a construction method thereof. The invention provides sgRNA (small guide ribonucleic acid) for knocking in Ires-Cre in a targeted manner at an Osx gene locus of a rat animal model. According to the sgRNA, an Ires-Cre gene can be knocked into an Osterix gene of a rat model by adopting a CRISPR / Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated protein 9) gene editing system, so that the Osx-Cre rat model is obtained. After an Osx-Cre rat model is mated with a rat with an loxP site, a rat animal model suitable for bone injury repair mechanism and effect research is obtained, specific fluorescent labeling on Osx expressed cells can be realized, the fate of the cell lineage is further researched, and the method has very important practical application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a rat model suitable for studying the mechanism and effect of bone injury repair and a construction method thereof. Background Art

[0002] As the challenges of an aging population intensify, new strategies for bone regeneration have been proposed over the past two decades. Bone implant materials and devices, tissue engineering scaffolds, physical therapy, etc. have gradually become common means of clinical treatment of diseases, but research in the above fields is mainly focused on the development of new materials and the development of external physical equipment, while the basic biological mechanisms of their treatment and application are still not clear enough. The main reason includes the lack of animal models suitable for the study of bone implant materials and physical therapy mechanisms.

[0003] Animal models such as mice and rats are commonly used in life science research. Mice are small in size, grow rapidly, are easy to raise and manage, and their genome sequences have been fully sequenced. They also have strong genetic variability. Therefore, in traditional bone biology, molecular mechanism research is mostly carried out in mouse models, and a rich variety of genetically modified animal models have been established. However, the skull and tibia of mice are small and slender, making bone defect modeling and repair material implantation surgery difficult. On the other hand, existing electrotherapy, thermal therapy or ultrasound probes are large and do not match the injured part of mice, which can easily cause damage to other tissues.

[0004] Rats have the following advantages as a commonly used model organism for basic scientific research: ① Rats have a larger brain capacity, three times that of mice, and have more neurons with more complex distribution, so they can better simulate the human nervous system. ② Rats are larger in size and have complex sensory and motor systems, which can perform more complex surgical operations and physiological measurements. ③ The physiological structure and genetic information of rats are more similar to those of humans, and can more accurately simulate the actual scenes in the human body environment. This makes rats have greater advantages than mice in surgical intervention, blood drawing, organ or tissue sampling and transplantation research, as well as physiological, toxicological and pharmacological evaluation, and can better serve in vivo basic and applied research. ④ In terms of energy metabolism, rats have a faster basal metabolic rate and lower energy consumption, and the side effects associated with drug self-administration (such as anorexia, sedation, anxiety) may have a greater impact on mice than rats. ⑤ The rat model is particularly widely used and is an ideal model for systems biology and translational research, such as cardiovascular disease, neurodegenerative disease, immune disease, bone disease, etc. It can not only explain the pathogenesis of the disease, but also provide new targets for the treatment of the disease. In summary, the rat model has its irreplaceable advantages in life science research.

[0005] Genetically modified animals have become an important tool for biomedical research. Through gene editing technology, target genes are knocked in or deleted in individual animals or specific tissues to simulate specific physiological, pathological, and cellular characteristics of humans. On this basis, the occurrence, development, and treatment strategies of human diseases are explored, which has played a huge role in promoting the development of clinical medicine. In traditional bone biology, basic molecular biological mechanism research is mostly carried out in mouse models, and a rich variety of genetically modified mouse animal models have been established. With the introduction of zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALEN) methods, especially the introduction of clustered regularly interspaced short palindromic repeats (CRISPR)-related systems, gene targeting is no longer limited to mice. The programmability of the CRISPR-Cas9 system enables it to produce site-specific DNA double-strand breaks, allowing it to quickly adapt to genome editing technology.

[0006] Although rat models have many advantages, there is still a lack of rat models suitable for studying the mechanisms and effects of bone injury repair, especially transgenic rats related to the key osteoblast lineage transcription factor Osterix (Osx gene) have not yet been developed. Osterix can drive osteoblast precursor cells to develop into mature osteoblasts that express type I collagen and osteocalcin, which is also crucial for bone injury repair. However, the migration of osteoblast lineage stem cells expressing Osterix during injury repair and the molecular mechanisms involved in injury repair are still not clear enough. Summary of the invention

[0007] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. To this end, the present invention proposes a sgRNA for targeted knock-in of Ires-Cre at the Osx gene locus in a rat animal model.

[0008] The present invention also provides a nucleic acid molecule encoding the above sgRNA.

[0009] The present invention also provides an expression cassette, a recombinant vector or a transgenic cell line comprising the above nucleic acid molecule.

[0010] The invention also provides a targeting vector.

[0011] The present invention also provides a kit.

[0012] The present invention also provides the use of the above-mentioned sgRNA, nucleic acid molecule, expression cassette, recombinant vector or transgenic cell line, targeting vector or kit.

[0013] The present invention also provides a method for constructing an Osx-Ires-Cre rat model.

[0014] The present invention also provides an Osx-Ires-Cre rat model constructed by the above construction method.

[0015] The present invention also proposes the application of the above Osx-Ires-Cre rat animal model.

[0016] The invention also provides a method for preparing a rat model containing a reporter gene.

[0017] The present invention also provides a rat model containing a reporter gene constructed by the above preparation method.

[0018] The present invention also provides the application of the rat model containing the reporter gene.

[0019] According to one aspect of the present invention, a sgRNA for targeted knock-in of Ires-Cre at the Osx gene locus in a rat animal model is proposed, wherein the sgRNA comprises sgRNA1 and sgRNA2, and the sequences of the sgRNA1 and sgRNA2 are as follows:

[0020] sgRNA1: CCAATCAGCCGCCCCGATCTTCC;

[0021] sgRNA2: GGATCTCTCTCTGATCCCTTAGG.

[0022] In some embodiments of the present invention, the site recognized by the sgRNA is in the domain downstream of exon2 of the Osx gene.

[0023] In some embodiments of the present invention, the site recognized by the sgRNA is at the end of the Osx gene.

[0024] According to the second aspect of the present invention, a nucleic acid molecule encoding the above-mentioned sgRNA is provided.

[0025] According to the third aspect of the present invention, an expression cassette, a recombinant vector or a transgenic cell comprising the above nucleic acid molecule is provided.

[0026] In some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the sgRNA in a host cell, and the DNA may include not only a promoter for initiating transcription of the gene encoding the sgRNA, but also a terminator for terminating transcription of the gene encoding the sgRNA.

[0027] In some embodiments of the present invention, the expression cassette may further include an enhancer sequence.

[0028] According to a fourth aspect of the present invention, a targeting vector is provided, wherein the targeting vector is used to target and knock in the Ires-Cre encoding gene at the rat Osx gene locus through CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the targeting vector is shown in SEQ ID NO:17.

[0029] According to a fifth aspect of the present invention, a kit is provided, comprising the above-mentioned sgRNA, the above-mentioned targeting vector and Cas9 mRNA.

[0030] According to the sixth aspect of the present invention, the use of the above-mentioned sgRNA, nucleic acid molecule, expression cassette, recombinant vector or transgenic cell line, targeting vector or kit in any of the following is proposed:

[0031] (a1) Construction of Osx-Ires-Cre rat model;

[0032] (a2) Preparation of products for constructing an Osx-Ires-Cre rat model.

[0033] In some embodiments of the present invention, the Osx-Ires-Cre rat model is a rat with Ires-Cre knocked into the Osx gene locus.

[0034] In some embodiments of the present invention, the application is for purposes other than disease diagnosis and treatment.

[0035] According to the seventh aspect of the present invention, a method for constructing an Osx-Ires-Cre rat model is proposed, and the construction method comprises the following steps: transferring sgRNA1, sgRNA2, Cas9 mRNA and a targeting vector into rat fertilized eggs, cultivating the fertilized eggs, and constructing an Osx-Ires-Cre rat model.

[0036] In some embodiments of the present invention, sgRNA1, sgRNA2, and Cas9 mRNA are active sgRNA1, sgRNA2, and Cas9 mRNA obtained by in vitro transcription of the sgRNA1, the sgRNA2, and the Cas9 plasmid into mRNA.

[0037] In some embodiments of the present invention, in the mixed system of sgRNA1, sgRNA2, Cas9 mRNA and targeting vector, the final concentration of sgRNA1 is 8-12 ng / mL, the final concentration of sgRNA2 is 8-12 ng / mL, the final concentration of Cas9 RNA is 20-30 ng / mL, and the final concentration of the targeting vector is 2-6 ng / mL.

[0038] In some embodiments of the present invention, in the mixed system of sgRNA1, sgRNA2, Cas9 mRNA and targeting vector, the final concentration of sgRNA1 is 10 ng / mL, the final concentration of sgRNA2 is 10 ng / mL, the final concentration of Cas9 RNA is 25 ng / mL, and the final concentration of the targeting vector is 4 ng / mL.

[0039] In some embodiments of the present invention, the rat fertilized eggs are obtained by inducing ovulation in rats and undergoing in vitro fertilization.

[0040] In some embodiments of the present invention, the method further includes extracting Osx-Ires-Cre rat model DNA, amplifying by PCR, and sequencing and identifying the product to confirm that a positive Osx-Ires-Cre rat model is obtained.

[0041] In some embodiments of the present invention, the primer sequences used in the PCR amplification include:

[0042] R-OSX-CRE-UPF1: CCTTTGTTTCAGCTCTCCTG (SEQ ID NO: 3);

[0043] R-CRE-A: CTGTTTCACTATCCAGGTTACG (SEQ ID NO: 4);

[0044] R-CRE-S: TACTGACGGTGGGAGAATG (SEQ ID NO: 5);

[0045] R-OSX-CRE-DOR1: CTGCAAGCTCTCCATAACCAT (SEQ ID NO: 6).

[0046] In some embodiments of the invention, the method of transferring comprises injection.

[0047] According to the eighth aspect of the present invention, an Osx-Ires-Cre rat model is proposed, which is constructed by the above method. The Osx-Cre transgenic tool rat model constructed by the scheme of the present invention has a high research value. When it is hybridized with rats carrying loxP genes and reporter genes, the endogenous promoter of Osx can be used to drive the expression of Ires-Cre, and the DNA sequence between the loxP sites before the reporter gene can be cut to achieve the purpose of fluorescently labeling specific cells, and further study the reproduction, migration and cell fate of cells in vivo.

[0048] According to the ninth aspect of the present invention, the use of the above Osx-Ires-Cre rat model in any of the following is proposed:

[0049] (b1) preparing a rat model suitable for studying the mechanism and effect of bone injury repair;

[0050] (b2) preparing a product for constructing a rat model suitable for studying the mechanism and effect of bone injury repair;

[0051] (b3) preparing a rat model containing a reporter gene;

[0052] (b4) Preparing a product for constructing a rat model containing a reporter gene.

[0053] In some embodiments of the present invention, the reporter gene includes at least one of LacZ, YFP, mCherry and EGFP genes.

[0054] According to the tenth aspect of the present invention, a method for constructing a rat model containing a reporter gene is proposed, comprising the following steps: hybridizing the above-mentioned Osx-Ires-Cre rat model with rats carrying the loxP gene and the reporter gene.

[0055] In some embodiments of the present invention, the rat carrying the loxP gene contains 2 loxP genes.

[0056] In some embodiments of the present invention, the rats carrying loxP sites include Rosa26-CAG-Loxp-tdTomato-3xpolyA-Loxp-EGFP-WPRE-polyA reporter rats. When the rats carrying loxP sites of the present invention use Rosa26-CAG-Loxp-tdTomato-3xpolyA-Loxp-EGFP-WPRE-polyA reporter mice, Osx-cre rats are hybridized with Rosa26-CAG-Loxp-tdTomato-3xpolyA-Loxp-EGFP-WPRE-polyA reporter mice, and tdTomato is knocked out in cells expressing osx, so that the gene is not expressed, and the green color of the EGFP gene is displayed, and cells without osx expression are red because tdTomato cannot be knocked out.

[0057] In some embodiments of the present invention, cells expressing the Osx gene in the rat model containing the reporter gene are all fluorescently labeled.

[0058] According to the twelfth aspect of the present invention, the use of the above-mentioned rat model containing a reporter gene in any of the following items is proposed:

[0059] (c1) As an animal model for studying the mechanisms and effects of bone damage and repair;

[0060] (c2) Tracking of osteoblastic lineage cells expressing Osx;

[0061] (c3) Screening of drugs, materials and physical therapy methods for repairing bone damage.

[0062] In some embodiments of the present invention, the use is not for the purpose of diagnosis or treatment of a disease.

[0063] According to some embodiments of the present invention, there are at least the following beneficial effects:

[0064] The present invention provides an sgRNA for targeted knock-in of Ires-Cre at the Osx gene site in a rat animal model, which is a specific targeting site designed for the Osx gene for the first time and can be used to construct a rat model for targeted knock-in of Ires-Cre; the sgRNA provided by the present invention can be used to targeted knock-in of Ires-Cre at the Osx gene target site in a rat animal model, with high knock-in efficiency, and a 100% Ires-Cre knock-in rat animal model can be constructed.

[0065] The present invention uses the CRISPR / Cas9 gene editing system for the first time in a rat model to knock in the Ires-Cre gene on the Osterix gene, and obtains an Osx-Cre rat model. The endogenous promoter of Osx can be used to drive the expression of Ires-Cre without destroying the intrinsic gene expression. After mating the Osx-Cre rat model with Reporter rats with two loxP sites, a rat animal model suitable for the study of bone injury repair mechanism and effect is obtained. It can achieve specific fluorescent labeling on Osx-expressing cells, and further study the fate of the cell lineage, which has very important practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0067] Figure 1 This is a schematic diagram of the construction of Osx-Cre rats in Example 2 of the present invention;

[0068] Figure 2 This is a diagram showing the PCR identification results of Osx-Cre rats in Example 2 of the present invention, wherein M2 is a marker;

[0069] Figure 3 Schematic diagram of the construction strategy of the target rat in Example 3 of the present invention;

[0070] Figure 4 This is a comparison diagram of different strains of rats in Example 3 of the present invention, wherein A is a reporter rat carrying two reporter genes, tdTomato and EGFP, B is a target rat, and C is an Osx-cre rat;

[0071] Figure 5 This is a graph showing the target rat PCR identification result in Example 3 of the present invention, wherein M3 and M4 are markers;

[0072] Figure 6 This is a fluorescence image of frozen sections of skull and tibia of a 5-week-old rat in Example 4 of the present invention;

[0073] Figure 7 This is a bone defect surgery diagram of an 8-week-old rat in Example 4 of the present invention;

[0074] Figure 8 This is a diagram showing the involvement of cells expressing the Osx gene in bone damage repair in Example 4 of the present invention. DETAILED DESCRIPTION

[0075] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0076] Example 1 A sgRNA for constructing an Ires-Cre knock-in rat animal model

[0077] In this example, a targeting sgRNA sequence was designed for Osx, a key gene that regulates osteogenesis and bone damage repair in rats. The design process is as follows: Figure 1 As shown, the specific design process is as follows: Osx gene is a key gene controlling rat osteogenesis and regeneration. Through a large amount of data analysis and preliminary research, this example conducts an in-depth analysis of the domain of Osx gene, and selects the domain downstream of exon2 of rat Osx gene as the target region for sgRNA design, with an upstream homology arm length of 1356 bp and a downstream homology arm length of 887 bp. The rat Osx gene DNA sequence was found in the ncbi database, and then the online design software CRISPOR (http: / / crispor.gi.ucsc.edu / ) was used to determine the domain site downstream of exon2 of rat Osx gene. After a large amount of screening, two specific sites were finally selected as the target sequences of sgRNA. The two target sequences are:

[0078] Osx-sgRNA1: 5'-CCAATCAGCCGCCCCGATCTTCC-3' (SEQ ID NO: 1);

[0079] Osx-sgRNA2: 5'-GGATCTCTCTCTGATCCCTTAGG-3' (SEQ ID NO: 2).

[0080] Example 2 A Rat Model of Ires-Cre Targeted Knock-in Osx-Cre

[0081] This example provides a rat model suitable for studying the mechanism and effect of bone injury repair. This example injects the targeting sgRNA and Cas9mRNA designed for the key gene Osx controlling rat osteogenesis obtained in Example 1 into rat fertilized oocytes through a microinjection system, and transplants the surviving fertilized oocytes into the oviducts of pseudo-pregnant female rats to construct a rat model, which specifically includes the following steps:

[0082] 1. Biosynthesis of sgRNA, Cas9 RNA and targeting vector

[0083] (1) Biosynthesis of sgRNA and Cas9 RNA

[0084] The biosynthesis of sgRNA1 and sgRNA2 in Example 1 was provided by Shanghai Invitrogen. The forward single strand and complementary strand of the synthesized sgRNA were combined into double-stranded sgRNA fragments by annealing (annealing conditions: 97°C, 6min, natural cooling for 1h), and then inserted into the PUC57 vector linearized by BsaI. The name of the Cas9 vector used is pST1374-NLS-flag-linker-Cas9, and the addgene ID is 44758. The constructed sgRNA vector and Cas9 vector are transcribed in vitro into injectable sgRNA and Cas9 RNA, and the in vitro transcription kit is Ambiton Am1354.

[0085] (2) Obtaining targeting vectors

[0086] The sequence of the R-donor-Osx-ires-cre targeting vector is as follows (including two mutations):

[0087] TTGTAGGTCTCAGACTCATAGCTAGCCCTTCCCTCTATCCTCTTCCTCCCTCCTA

[0088] AGCGGTGCCTCTCTCTCTCTCCAGGAAGAAGCTCACTATGGCTCCAGTCCCCTG

[0089] GCCATGCTGACAGCAGCCTGCAGCAAGTTTGGTGGCTCCAGCCCTCTGCGAGACT

[0090] CAACAGCCCTGGGAAAAGGAGGCACAAAGAAGCCATACACTGACCTTTCAGCCC

[0091] CCAAAACCATGGGGGACGCCTACCCAGCTCCCTTCTCAAGCACCAATGGACTCCT

[0092] CTCCCCTGCAGGCAGTCCCCCGGCCCCGGCCTCTGGCTATGCCAATGACTACCCAC

[0093] CCTTTCCCCACTCATTTCCTGGGCCCACTGGTGCCCAAGACCCGGGGCTGCTGGTG

[0094] CCGAAGGGGCACAGCTCTTCTGACTGCCTGCCTAGTGTCTACACGTCCTTGGATAT

[0095] GTCCCATCCCTACGGCTCCTGGTACAAGGCGGGCATCCATGCAGGCATCTCACCAG

[0096] GTCCTGGCAACACTCCTACCCCTTGGTGGGACATGCACCCTGGGGGCAATTGGTTA

[0097] GGTGGTGGGCAGGGCCAGGGTGATGGGCTGCAAGGGACACTGTCCACAGGCCCT

[0098] GCCCAGCCTCCACTGAACCCCCAGCTGCCTACTTACCCGTCTGACTTTGCCCCCCT

[0099] TAACCCAGCTCCCTATCCAGCACCCCACCTCTTGCAACCAGGTCCCCAGCATGTCC

[0100] TACCCCAAGATGTCTATAAGCCCAAGGCAGTTGGCAATAGTGGGCAACTGGAGGG

[0101] GAGTGGTGCAGGCAAACCTCCCCGGGGTGCAGGCACAGGGGGCAGTGGTGGATA

[0102] TGCAGGCAGTGGGGCAGGGCGTTCTACCTGCGACTGCCCCAACTGTCAGGAGCTA

[0103] GAGCGGCTGGGGGCAGCAGCGGCTGGGCTGAGGAAGAAGCCCATTCACAGCTGC

[0104] CACATCCCCGGCTGCGGCAAGGTGTACGGCAAGGCTTCGCATCTGAAAGCCCACT

[0105] TGGCCTGGCACATGGCGGAGAGGCCTTTCGTCTGCCAACTGGCTTTTCTGTGGCAA

[0106] GAGGTTCACCCGCTCTGACGAGCTGGAGCGCCACGTGCGCACTCACACCGGGA

[0107] GAAGAAGTTCACCTGTCTGCTCTGCTCCAAGCGCTTTACCCGAAGCGACCACTTG

[0108] AGCAAACATCAGCGCACCCACGGGGAGCCAGGTCCCGGGCCGCCCCCAAGTGGC

[0109] CCTAAGGAGCTGGGGAGGGTCGCAGCGTCGGGGAAGAAGAAGCC(A)AAT(C)CA

[0110] GCCGCCCCGATCTTCCACCTCGCCTGCACCCCCAGAAAAGCCCCTGGAGGCAGC

[0111] CCAGAGCAGAGCAACCTGCTAGAGATCTGAGTGGGCCTGAATTAAGAATTCCG

[0112] CCCCCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTG

[0113] CGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCG

[0114] GAAACCTGGCCCTGTCTTCTTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCA

[0115] AAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCGGAAGCTTC

[0116] TTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCT

[0117] GGCGACAGGTGCCTCTGCGGCCAAAGCCACGTGTATAAGATACACCTGCAAAGG

[0118] CGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATG

[0119] GCTCTCCTAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATT

[0120] GTATGGGATCTGATCTGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGT

[0121] TAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAAC

[0122] ACGATGATAATATGGCCACAACCATGGCGCGCCTGACCATGTCCAATTACTGACC

[0123] GTACACCAAATTTGCCTGCATTACCGGTCGATGCAACGAGTGATGAGGTTCGCAA

[0124] GAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTGGAAAAA

[0125] TGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAA

[0126] TGGTTTCCCGCAGAACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGC

[0127] GGTCTGGCAGTAAAAACTATCCAGCAACATTTGGGCCAGCTAAACATGCTTCATCG

[0128] TCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTATGCGG

[0129] CGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGT

[0130] TCGAACGCACTGATTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGC

[0131] CAGGATATACGTAATCTGGCATTTCTGGGGATTGCTTATAACACCCTGTTACGTATAG

[0132] CCGAAATTGCCAGGATCAGGGTTAAAGATATCTCACGTACTGACGGTGGGAGAATG

[0133] TTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGG

[0134] CACTTAGCCTGGGGGTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTA

[0135] GCTGATGATCCGAATAACTACCTGTTTTGCCGGGTCAGAAAAAATGGTGTTGCCGC

[0136] GCCATCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTTTGAAGCA

[0137] ACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCTG

[0138] GTCTGGACACAGTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTT

[0139] TCAATACCGGAGATCATGCAAGCTGGTGGCTGGACCAATGTAAATATTGTCATGAA

[0140] CTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCTGGAAGATG

[0141] GCGATTAGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTG

[0142] CCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTG

[0143] GAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTG

[0144] TCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGG

[0145] GAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGGCT

[0146] GGGCAGAGGAAGATCTCCAGCTCCAGGGTCCTCTTGTCCCTCGCTCTCTCCTATGC

[0147] ATGCCATGCCATACTCTGGGGGATCTCTCTCTGATCCCTTAGG(CC)CTTTCTCTTTG

[0148] CATGTCTCCTCACTCTTCTGTCTTAGCCAAATTCCTCTCAGGCCTTTGCCCGTGCCT

[0149] AGTTCCCATGCTCTGACCTCCTGAACTCTTTCTTCGCTGCCCCTGTTCTTCACAGCT

[0150] TCCATCTGGCCGCACATCATTTTCTCATTAATTCTTTGCCATTCAATCTTTCTGCTTC

[0151] CCAACCCTATTTGCCACTTTCCCGGAAGCTTCCAGGCTGTCGCCCCGATTCCCCCC

[0152] CCCCCGCTTTCCATTCTCTTGAGCTTTTTTAAAACAAACACGATGATGATGATGATG

[0153] ATGATGATGATGATGATGATAATTTATTGCCCCCTTGGTGGTTCTTCATTAGGAACCA

[0154] GAGTTAAGGAGATTGGTGTTAGTAACCTGGCTGCGAGCAGAGTGCCAAGAAAGGG

[0155] GAAGCCCAATGGGGATCTGATCCCAAAGATGGGGTGACCCCAAGGTCAGGGAGGC

[0156] TGTCCCCCAGCCTTGAGTACTTAGCCCCTGTGCGCCAGGAGTAAAGAATAATAATA

[0157] ATAATAATTCTATTTATCTAAGTTATGATGACGGGTCAGGTACAGTGAGCTGGAGAG

[0158] GGAAAGGGAATCTTTTTTTTTTTTTTTTTTTGTGCTAAGGGTATTCTAGACAAATGC

[0159] ATCTGTGTATAGATAGACAAATGATAGTGGAGACCTTCGTAGATTTCTATCATCGAG

[0160] GTCTCTGAGTTTCTTTTTCAGCGGAGTTTTGGGTTGTTAGGCCTCTTTTAGTTTATGTGGGTGTCTCTCTGTGAGGCAGTCACTAAGATC(SEQ ID NO:15).

[0161] 2. Microinjection

[0162] The obtained sgRNA, Cas9 RNA and donor-Osx-ires-cre were injected into rat fertilized oocytes through a microinjection system. The specific steps are as follows:

[0163] By injecting hormones into 10 3-4 week old SD female rats, fertilized oocytes were obtained after superovulation and mating. After mating with ligated male rats at 8 weeks old, female rats with thrombosis were selected as recipient rats. After mixing sgRNA1, sgRNA2, Cas9RNA and donor-Osx-ires-cre (wherein, in the mixed system, the final concentration of sgRNA1 is 10ng / mL, the final concentration of sgRNA2 is 10ng / mL, the final concentration of Cas9 RNA is 25ng / mL, and the final concentration of donor-Osx-ires-cre is 4ng / mL), the microinjection system was injected into the fertilized oocytes of rats, and the injection volume was 20μL. After being placed in an incubator (37°C, CO2 concentration is 5%) for 1 hour, the surviving cells were selected and transplanted into the oviduct of the recipient rats. Osx-Cre rats can be obtained in about 20 days.

[0164] 3. Genotype identification of Osx-Cre rats

[0165] The Osx-Cre rats obtained were numbered after their toes and tail tips were cut off 7 days after birth, and the rat genomic DNA was extracted using the genomic DNA extraction kit (EE101-12) of Quanshijin Company, which was then used as template DNA for PCR amplification using primers. The primer sequences used are shown in Table 1.

[0166] Table 1

[0167]

[0168]

[0169] PCR reaction system 1: 2×M-PCR OPTI TM Add 8.0 μL of MIX (purchased from Bimake, Cat: B45012), 0.1 μL of R-OSX-CRE-UPF1, 0.1 μL of R-CRE-A, 1.0 μL of template DNA, and add ddH2O to a total volume of 20.0 μL.

[0170] PCR reaction system 2: 2×M-PCR OPTI TM Add 8.0 μL of MIX (Bimake Cat: B45012), 0.1 μL of R-CRE-S, 0.1 μL of R-OSX-CRE-DOR1, 1.0 μL of template DNA, and add ddH2O to a total volume of 20.0 μL.

[0171] The PCR reaction program was: 92°C, 5 min; 90°C, 30 s, 57°C, 30 s, 69°C, 2-3 min, 35 cycles; 70°C, 10 min. The target fragment of reaction system 1 was 3130 bp, and the target fragment of reaction system 2 was 1800 bp.

[0172] After the PCR product is amplified using the above PCR reaction system and reaction procedure, 10 μL of the product is used for agarose gel electrophoresis, using 1% agarose gel, 140V electrophoresis, and development. The results are as follows: Figure 2 As shown in the figure, it can be seen that two bands of 3130 bp and 1800 bp were detected at the same time, which can be identified as Osx-Cre rats.

[0173] Example 3 Construction and identification of a rat model suitable for studying the mechanism of bone injury and repair

[0174] This example provides a rat model suitable for studying the mechanism of bone injury and repair. The rat model suitable for studying the mechanism of bone injury and repair is obtained by hybridizing the Osx-Cre rats constructed in Example 2 with rats carrying Loxp and a reporter gene (the construction strategy is as follows: Figure 3 The specific process is as follows:

[0175] Osx-cre rats ( Figure 4 C in the figure) and Reporter rats carrying two reporter genes, tdTomato and EGFP (Rosa26-CAG-Loxp-tdTomato-3xpolyA-Loxp-EGFP-WPRE-polyA reporter rats, purchased from Shanghai Model Organisms Technology Co., Ltd.) Figure 4 ) and obtained the target rat ( Figure 4 (as shown in B in the figure).

[0176] Seven days after the target rats were born, their toes and tail tips were cut off and numbered. The rat genomic DNA was extracted using a genomic DNA extraction kit (EE101-12) from Quanshijin Company, and then used as template DNA for PCR amplification using primers. The primer sequences used are shown in Table 3.

[0177] Table 3

[0178]

[0179] Cre gene identification:

[0180] PCR reaction system 1: 2×M-PCR OPTI TMAdd 8.0 μL of MIX (purchased from Bimake, Cat: B45012), 0.1 μL of R-OSX-CRE-UPF1, 0.1 μL of R-CRE-A, 1.0 μL of template DNA, and add ddH2O to a total volume of 20.0 μL.

[0181] PCR reaction system 2: 2×M-PCR OPTI TM Add 8.0 μL of MIX (Bimake Cat: B45012), 0.1 μL of R-CRE-S, 0.1 μL of R-OSX-CRE-DOR1, 1.0 μL of template DNA, and add ddH2O to a total volume of 20.0 μL.

[0182] The reaction program of PCR reaction system 1 was: 92°C, 5 min; 90°C, 30 s, 57°C, 30 s, 69°C, 2-3 min, 35 cycles; 70°C, 10 min.

[0183] The reaction program of PCR reaction system 2 was: 95°C, 15 min; 95°C, 30 s, 59°C, 30 s, 72°C, 1.5-2 min, 35 cycles; 72°C, 10 min.

[0184] The target fragment of reaction system 1 is 3130 bp, and the target fragment of reaction system 2 is 1364 bp.

[0185] After the PCR product is amplified using the above PCR reaction system and reaction procedure, 10 μL of the product is used for agarose gel electrophoresis, using 1% agarose gel, 140V electrophoresis, and development. If there are two bands of 3130 bp and 1364 bp at the same time, it can be identified as containing the Cre gene.

[0186] Reporter gene identification:

[0187] PCR reaction system 1 was as follows: 2.0 μL of 10× Taq PCR Buffer, 1 μL of dNTP (2.5 mM each), 0.5 μL of P1, 0.5 μL of P2, 0.1 μL of Taq DNA Polymerase, 1.0 μL of template DNA, and ddH2O was added to a total volume of 20.0 μL.

[0188] PCR reaction system 2 was as follows: 2.0 μL of 10× Taq PCR Buffer, 1 μL of dNTP (2.5 mM each), 0.5 μL of P3, 0.5 μL of P4, 0.1 μL of Taq DNA Polymerase, 1.0 μL of template DNA, and ddH2O was added to a total volume of 20.0 μL. (Taq DNA Polymerase was purchased from Takara, R001A).

[0189] The PCR reaction program was: 94°C, 5 min; 94°C, 30 s, 58°C, 30 s, 72°C, 1 min, 35 cycles; 72°C, 5 min. The target fragment of reaction system 1 was 566 bp, and the target fragment of reaction system 2 was 487 bp.

[0190] After obtaining the PCR product, take 10 μL of the product for agarose gel electrophoresis, using 1% agarose gel, 160V electrophoresis, development, and a 487 bp band can be identified as containing the Reporter gene.

[0191] The target rat identification results are shown in the figure Figure 5 As shown in the figure, it can be seen that the embodiment of the present invention successfully constructed a reporter rat model that can mark and track Osx positivity.

[0192] Example 4 Phenotypic identification of a rat model (target rat) suitable for studying the mechanism and effect of bone injury repair and its application in studying the mechanism and effect of bone injury repair

[0193] In this example, the target rats constructed in Example 3, i.e., the rat model suitable for studying the mechanism and effect of bone injury repair, were used as the research object. Frozen sections were made on the tibia of 5-week-old rats, and their phenotypes were observed under a microscope. At 8 weeks, a critical bone defect model of the tibia was made on the rats to observe the participation of osteoblast lineage cells expressing the Osx gene in bone repair. The specific steps are as follows:

[0194] 1. Frozen sections of skull and tibia of 5-week-old rats

[0195] The target rats of 5 weeks old were euthanized by CO2, and their skulls and tibias were taken out and fixed in 4% paraformaldehyde for 48 hours. Then, they were placed in decalcification solution to decalcify until the bone could be easily pierced by a 1 mL syringe needle. The bones were taken out and placed in 30%, 20%, and 10% sucrose solutions for dehydration for 12 hours each. After dehydration, they were embedded in OCT and frozen sections were made with a thickness of 10-15 mm. After sealing, the expression of fluorescence in the bones was observed under a microscope.

[0196] Fluorescence images of skull and tibia Figure 6As shown in the figure, it can be seen that cells expressing Osx undergoing genetic recombination have obvious green fluorescence, while others have red fluorescence. In the skull, the fluorescence is stronger in the periosteum; in the tibia, the fluorescence intensity of the periosteum, primary ossification center and secondary ossification center is stronger, which means that the cells expressing Osx in these locations are more concentrated and more active.

[0197] 2. Application of the model in bone injury and repair research

[0198] When the rats were 8 weeks old, bone defect models were established in the rats ( Figure 7 As shown in the figure, the steps of bone defect modeling are as follows: 8-week-old rats are placed in an anesthesia machine and anesthetized with isoflurane (induction concentration 3-3.5%, maintenance concentration 2-2.5%), and defect surgery is performed after routine disinfection; the rats are placed supine on the operating table, anesthesia is maintained, the skin near the tibia is cut, the muscles are peeled off to expose the tibia, and a circular hole is drilled 1 cm below the tibial plateau and on the inner side of the tibia with a low-speed bone drill 2.8 mm drill bit, and the defect should be able to reach the bone marrow cavity.

[0199] One week after modeling, the samples were collected, fixed, decalcified, dehydrated, embedded, and frozen sections were made for microscopic examination.

[0200] Microscopic examination results Figure 8 As shown in the figure, it can be seen that there is relatively concentrated green fluorescence around the defect area, growth plate and periosteum, indicating that osteoblast lineage cells expressing Osx have migrated from the growth plate and periosteum to the defect area and participated in the process of bone defect repair. The migration of osteoblast lineage can be tracked at the microscopic level. The specific applications of this model include but are not limited to this.

[0201] Rats are closer to humans in terms of conservation of genes related to immunity, tumors, nerves, metabolic detoxification, and chemical sensation. This may mean that when designing sgRNA, the rat model may be more suitable for simulating human diseases, so it may be necessary to be more meticulous when selecting sgRNA targets. Through the design of sgRNA in the scheme of the present invention, Ires-Cre was successfully knocked in at the Osx gene target site in the rat animal model with high knock-in efficiency, and an Ires-Cre knock-in rat animal model can be constructed 100%.

[0202] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A sgRNA for targeted knock-in of Ires-Cre at the rat Osx gene locus, characterized in that: The sgRNA includes sgRNA1 and sgRNA2, and the sequences of sgRNA1 and sgRNA2 are as follows: sgRNA1: CCAATCAGCCGCCCCGATCTTCC; sgRNA2: GGATCTCTCTCTGATCCCTTAGG.

2. A nucleic acid molecule encoding the sgRNA according to claim 1.

3. An expression cassette, a recombinant vector or a transgenic cell comprising the nucleic acid molecule according to claim 2.

4. A targeting vector, characterized in that: The targeting vector is used to target and knock in the Ires-Cre encoding gene at the rat Osx gene site through CRISPR / Cas9 gene editing technology, and the nucleotide sequence of the targeting vector is shown in SEQ ID NO:

17.

5. A kit, characterized in that: It comprises the sgRNA as claimed in claim 1, the targeting vector as claimed in claim 4 and Cas9 mRNA.

6. Use of the sgRNA according to claim 1, the nucleic acid molecule according to claim 2, the expression cassette, the recombinant vector or the transgenic cell according to claim 3, the targeting vector according to claim 4 or the kit according to claim 5 in any of the following: (a1) Construction of Osx-Ires-Cre rat model; (a2) Preparation of products for constructing an Osx-Ires-Cre rat model.

7. A method for constructing an Osx-Ires-Cre rat model, characterized in that: The construction method comprises the following steps: transferring the sgRNA1 and sgRNA2, Cas9 mRNA and the targeting vector as described in claim 1 into rat fertilized eggs, cultivating the fertilized eggs, and constructing an Osx-Ires-Cre rat model.

8. An Osx-Ires-Cre rat model, characterized in that The method according to claim 7 is used to construct the present invention.

9. Use of the Osx-Ires-Cre rat model according to claim 8 in any of the following: (b1) preparing a rat model suitable for studying the mechanism and effect of bone injury repair; (b2) preparing a rat model suitable for studying the mechanism and effect of bone injury repair; (b3) preparing a rat model containing a reporter gene; (b4) preparing a product for constructing a rat model containing a reporter gene; Preferably, the reporter gene includes at least one of LacZ, YFP, mCherry and EGFP genes.

10. A method for constructing a rat model containing a reporter gene, characterized in that: The following steps are involved: The Osx-Ires-Cre rat model as claimed in claim 8 is obtained by hybridizing rats carrying loxP gene and reporter gene.

11. A rat model containing a reporter gene, characterized in that: The method according to claim 10 is used to construct the present invention.

12. Use of the rat model containing the reporter gene according to claim 11 in any of the following: (c1) As an animal model for studying the mechanisms and effects of bone damage and repair; (c2) Tracking of osteoblastic lineage cells expressing Osx; (c3) Screening of drugs, materials and physical therapy methods for repairing bone damage.

Images