Application of LCE5A as a target in the preparation of drugs for the treatment of inflammatory skin diseases including psoriasis

Abstract

The present invention discloses an application of LCE5A as a target in the preparation of a drug for treating inflammatory skin diseases including psoriasis, wherein the LCE5A is mainly expressed on the epidermis; the present invention confirms through a series of experiments that LCE5A can effectively alleviate imiquimod-induced psoriasis-like skin inflammation in mice. The protein can significantly improve the barrier function of mouse skin, inhibit the release of proinflammatory factors and reduce the infiltration of inflammatory cells by regulating the proliferation and differentiation of keratinocytes. This provides important experimental support for the use of LCE5A in the preparation of drugs for skin diseases caused by skin barrier damage, as well as the development of functional skin care products. The experimental results clearly show that LCE5A exhibits significant therapeutic effects in a mouse psoriasis-like inflammation model, and its effect is safe and stable. The protein has a simple extraction and purification process, has good industrial production potential, and lays a solid foundation for clinical application.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to an application of late phase envelope protein 5a (LCE5A) as a target in the preparation of a drug for treating inflammatory skin diseases including psoriasis. Background Art

[0002] Psoriasis is a common chronic inflammatory skin disease that is prone to recurrence. Typical skin lesions are mainly scaly papules and plaques. It occurs worldwide and can occur at any age, placing a heavy burden on individuals and society. Psoriasis develops from a complex interaction between proliferating keratinocytes and infiltrating immune cells, leading to the secretion of various cytokines and chemokines, including IL-23, IL-17, IL-22, IL-6, TNF-α, IFN-γ, and CXCL5, which trigger a proinflammatory systemic response. It is also associated with several important medical conditions, including psoriatic arthritis, depression, and cardiometabolic syndrome. The skin is the largest barrier organ. The epidermis is mainly composed of keratinocytes, which mainly include the basal layer, spinous layer, granular layer, and stratum corneum from the inside to the outside. The main feature of psoriasis is the excessive proliferation of keratinocytes with incomplete differentiation, forming thick keratinized plaques called scales. There is currently a lack of curative therapy for psoriasis, and clinical treatment faces many challenges. The main difficulties include:

[0003] 1. Complex etiology: The pathogenesis of psoriasis has not yet been fully clarified, and it involves the immune system, genetic factors, environmental stimulation, etc. Due to the complex etiology, it is difficult to find a targeted and complete cure.

[0004] 2. Large individual differences: There may be large individual differences in the symptoms, severity of the disease, and response to treatment of patients. A treatment is effective for some patients, but has no significant effect on other patients, which brings certain difficulties to clinical treatment.

[0005] 3. Chronic relapse: Psoriasis is characterized by chronic relapse. Although emerging treatments such as biologics and small molecule drugs can effectively improve symptoms, most patients relapse rapidly after stopping medication. The disease requires long-term treatment and management, which brings a heavy burden to families and society.

[0006] 4. Adverse drug reactions and diminished efficacy: Many drugs for the treatment of psoriasis (such as immunosuppressants, biologics, JAK inhibitors, etc.) have many side effects, such as increased risk of infection, thrombosis, immune drift, liver and kidney damage, etc. Long-term use of some drugs may also lead to diminished efficacy or resistance, affecting the treatment effect.

[0007] 5. Comorbidities: Psoriasis is often accompanied by other diseases, such as psoriatic arthritis, metabolic syndrome, cardiovascular disease, etc., which can cause disability or even life-threatening in severe cases.

[0008] 6. Psychological stress and quality of life: Psoriasis is not only a skin disease, it can also cause depression, anxiety, etc., seriously affecting the patient's quality of life.

[0009] 7. Economic burden: Certain treatments (such as biologics) are expensive, and many patients find it difficult to bear the high medical costs in the long term, especially when long-term maintenance treatment is required.

[0010] Therefore, the clinical treatment of psoriasis often requires comprehensive consideration of multiple factors, including individual characteristics of the patient, the stage of the disease, concomitant symptoms, and the need for long-term management. Since the specific pathogenesis of psoriasis has not been fully studied, although the current emerging treatments have achieved certain clinical efficacy, they still cannot solve key problems such as recurrence after drug discontinuation, which has also prompted researchers to further explore new treatment strategies.

[0011] The epidermal differentiation complex (EDC) is a gene cluster located on human chromosome 1q21. The structural and functional proteins encoded by EDC have a profound impact on the terminal differentiation of the human epidermis, especially in maintaining the integrity of the skin barrier structure and function. Recent studies have shown that the late phase envelope protein (LCE) gene cluster located within the EDC domain is considered to be a susceptibility locus for psoriasis. It is well known that most LCE genes are expressed in the granular layer of differentiated keratinocytes during epidermal keratinization. In large-scale GWAS studies of different populations, the identified gene loci, such as LCE1C (rs6701216), LCE1B (rs12023196), LCE3A (rs4845454), LCE3B, LCE3C, and LCE3D (rs512208), are significantly associated with psoriasis susceptibility. Some studies have reported that the LCE5A gene is downregulated in patients with psoriasis, but there is still a lack of sufficient evidence to link this gene to the pathogenesis of psoriasis. How LCE5A participates in these important processes is still unclear. Therefore, it is worth further exploring the role of the LCE5A gene in maintaining the normal structure and function of the skin barrier, as well as its role in the pathogenesis of inflammatory skin diseases such as psoriasis. Summary of the invention

[0012] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an application of late phase envelope protein 5a (LCE5A) as a target in the preparation of a drug for treating inflammatory skin diseases including psoriasis.

[0013] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0014] The present invention provides an application of late phase envelope protein 5a (LCE5A) in preparing a medicine for treating skin inflammatory diseases such as psoriasis.

[0015] The amino acid sequence of the above LCE5A (human) is shown in SEQ ID NO: 1:

[0016] MSCQQSQQQC QPPPKCTPKC PPKCTPKCPP KCPPKCPPQCSAPCPPPVSS CCGSSSGGCCSSEGGGCCLS HHRPRQSLRR RPQSSSCCGSGSGQQSGGSS CCHSSGGSGC CHSSGGCC

[0017] The nucleotide sequence of the gene LCE5A (human) corresponding to the above LCE5A (human) is shown in SEQ ID NO: 2:

[0018] agtctacctg tctcctgagt gatctgctgc agtgcctgaa ccaggtagag tgcttctcaggaccaggatgaactcttggt gctggtgttt tgggcagaaa gagcccctgg gtggaggttg aggccattcttgaagaaagacaaggataaa gaaggatttt ggaggggaag gttcttctgg aaggggaggg tggaagctttattcagcttctacagagatg tcctgccagc agagccagca gcagtgccag cctcctccca aatgtacccctaaatgccctcccaagtgta ctcctaagtg tcctcccaag tgtcccccaa aatgccctcc ccagtgttcagccccatgcccacctccagt ctcttcctgc tgtggttcca gctctggggg ctgctgcagc tctgagggtggtggctgctgcctgagccac cacaggcccc gccagtccct ccgacgccga cctcagagtt ccagctgctgtggcagtggcagtggccagc agtctggggg ctccagctgc tgccacagct ctgggggctc tggctgctgccacagctctggaggctgctg ctgacctggg ccatgaggag cacggaggag aaggactggc agatcccaggtgctgaagatgtgtgtcagc ctgaggcttc ttttctctca tttcccatgg aaggacttcg gaaatgccttaagttcccct ctttatcctgcccatgttca ctccattgta gggttgaagt ctagcttgtg atattttctggcctggcttt ccctctcaga catagctctttggagaacta ggtgttgtaa ttcagttatg aagctattttctctgtaaca ataaagcttt ttattcctga

[0019] The amino acid sequence of the above LCE5A (mouse) is shown in SEQ ID NO: 3:

[0020] MSCQQSQQQC QPPPKCKTPK CPPTSSCCSL GSGGCCGSSSGGCCSSGCGG CCLSHHKPRFSLRRRRHSSG CCSSGGSSCC GSSGGSSCCGSSGGSSGGSS GGSSGGSSCC GSSGGSSGGS SCCGSSSGGSSCCGSSSGGSSGGSSGGSSC CGSSGGSSGG SSSGSNSHQQ SGGSSCCSGG CC

[0021] The nucleotide sequence of the gene Lce5a (mouse) corresponding to the above LCE5A (mouse) is shown in SEQ ID NO: 4:

[0022] tcaatccatt actcgctgag tgatctactc cagtgcctga gttcctttgg agatgtcctgtcagcagagccagcaacagt gccagccccc tcccaaatgc aagaccccaa agtgccctcc aacctcttcctgctgtagcctgggttctgg gggctgctgt ggttccagct ccgggggctg ctgcagctct ggatgtggtggctgctgtctgagccaccac aagccccgat tctctctccg tcgccgacgt cacagctctg gatgctgtagcagcggtggcagcagttgct gtggcagcag cggtggcagc agttgctgtg gcagcagcgg tggcagcagcggtggcagcagcggtggcag cagcggtggc agcagttgct gtggcagcag cggtggcagc agcggtggcagcagttgctgtggcagcagc agcggtggca gcagttgctg tggcagcagc agtggtggca gtagcggtggcagtagcggtggcagcagct gctgtggtag cagtgggggc agcagtggtg gcagcagcag tggcagcaacagccatcagcagtctggggg ctctagctgc tgctctggag gttgctgctg acctggccac gaagaacatggaaagcagcattgactgaag acctgcaagc ctagggtctc ctcttctctg gttttcccgc agaagtacttagaactctctgtacgtcctc ttcatctccc taaagctcat ctaccacgag gtcttcaggt cccagctctgagatgcattggctttgcttt ttttctctga cacaactaat tgagaatgag atattgaaaa attagctttgaaaaatcttt ttctgggcaataataaagct tttgattcct gaca

[0023] In summary, the psoriasis is any one of psoriasis vulgaris, erythrodermic psoriasis and psoriasis pustulosa; the inflammatory skin disease includes but is not limited to atopic dermatitis, eczema, neurodermatitis, nodular prurigo, etc.

[0024] The present invention also provides an application of LCE5A in preparing a medicine for treating or improving abnormal epidermal manifestations such as scaling, erythema and hyperplasia.

[0025] The LCE5A of the present invention can treat psoriasis and clear skin scales, erythema and hyperplasia because LCE5A can significantly reduce the expression of inflammation-related genes TNF-α, IL-22, IL-23, IL-1β and IL-17F, and can significantly improve the skin barrier function, thereby effectively treating inflammatory skin diseases.

[0026] The present invention also provides a pharmaceutical composition for treating inflammatory skin diseases including psoriasis, wherein the pharmaceutical composition comprises LCE5A.

[0027] Furthermore, the pharmaceutical composition also includes excipients.

[0028] Furthermore, the auxiliary material is any one or two of vaseline, paraffin, lanolin, triglyceride, urea and glycerin.

[0029] The present invention also provides an application of LCE5A overexpression in the preparation of medicines for treating inflammatory skin diseases including psoriasis.

[0030] The present invention also provides a recombinant adenovirus vAAV2-LCE5A, wherein the recombinant adenovirus vAAV2-LCE5A is an adeno-associated virus type 2 (AAV2) into which the gene LCE5A is inserted, wherein the nucleotide sequence of the gene LCE5A is shown in SEQ ID NO:2.

[0031] The present invention also provides a use of the above-mentioned recombinant adenovirus vAAV2-LCE5A in the preparation of a medicine for alleviating psoriasis-like skin inflammation induced by imiquimod.

[0032] The present invention also provides a medicine for alleviating psoriasis-like skin inflammation induced by imiquimod, wherein the medicine contains recombinant adenovirus vAAV2-LCE5A.

[0033] The present invention also provides a reagent for detecting the expression of gene LCE5A for use in preparing a kit for auxiliary diagnosis of psoriasis, wherein the expression of LCE5A is analyzed by immunohistochemical staining or RT-qPC ( Figure 1 a).

[0034] The present invention also provides an application of LCE5A in preparing a drug for repairing skin diseases caused by skin barrier damage, and an application of LCE5A in developing functional skin care products.

[0035] Beneficial effects of the present invention:

[0036] The present invention proves through a series of experiments that LCE5A can effectively protect Imiquimod (IMQ)-induced psoriasis-like skin damage in mice, improve skin scaling, erythema, thickening and abnormal epidermal differentiation, and at the same time, reduce the massive infiltration of inflammatory cells, regulate the inflammatory response caused by psoriasis, play a certain anti-inflammatory effect, and enhance the barrier function of the skin. The experimental research of the present invention has clarified that LCE5A has obvious efficacy in the psoriasis model, is safe, efficient, has no side effects, and has a simple production process, and has the potential to achieve medical transformation. It also helps to expand the potential application value of LCE5A in various other skin inflammatory diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 LCE5A is significantly downregulated in psoriasis lesions ( Figure 1 a), LCE5A protein was upregulated after treatment ( Figure 1 b), and there is a significant correlation with KRT16 and other indicators ( Figure 1 c) schematic diagram;

[0038] Figure 2 This is a schematic diagram showing that the expression of LCE5A is significantly correlated with the progression of psoriasis;

[0039] Figure 3 Schematic diagram of spontaneous psoriasis-like inflammation in mice deficient in Lce5a expression;

[0040] Figure 4 The barrier function of both lesional and non-lesional areas of psoriasis patients is impaired ( Figure 4 a), Lce5a expression-deficient mice have impaired barrier function ( Figure 4 bd) Schematic diagram;

[0041] Figure 5 Schematic diagram showing that LCE5A-deficient keratinocytes are abnormally activated, overproliferate and abnormally differentiate, accompanied by the release of antimicrobial peptides such as S100A9 and LL37;

[0042] Figure 6 Schematic diagram showing that defective Lce5a expression exacerbates imiquimod-induced psoriasis-like inflammation;

[0043] Figure 7 The schematic diagram of the construction of the target plasmid (Mouse_Lce1m vector) after sequencing results showed that it was consistent with the target sequence, indicating successful construction;

[0044] Figure 8 Schematic diagram showing that vAAV2-LCE5A-mediated gene therapy in Lce5a expression-deficient mice successfully alleviated imiquimod-induced psoriasis-like skin inflammation. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0046] All experimental studies involving animals in this invention have been approved by the Institutional Animal Care and Use Committee of Huazhong University of Science and Technology and comply with the guidelines outlined in the Guide for the Care and Use of Laboratory Animals Animal Protocol Number: TJH-20209001. All efforts were made to minimize suffering. Human participation in the study was approved by the Institutional Ethics Committee of Wuhan First Hospital, approval number: YYLS2019-9.

[0047] Related samples and experimental materials

[0048] 1. Clinical samples

[0049] Psoriasis patients were diagnosed with psoriasis vulgaris by two senior dermatologists. Paraffin-embedded healthy skin tissues and psoriatic lesions were obtained from the Dermatological Pathology Laboratory, Wuhan Hospital of Integrated Traditional Chinese and Western Medicine, Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China). Written informed consent was obtained from all participants.

[0050] 2. Experimental Materials

[0051] (1) Cell lines

[0052] The human immortalized KC cell line HaCaT was purchased from China Center for Type Culture Collection (CCTCC).

[0053] (2) Mouse

[0054] Lce5a- / -, Lce5a+ / -, and Wt mice on a C57BL / 6j background were purchased from GemPharmatech Corporation (Nanjing, China).

[0055] Example 1 In psoriasis lesions, the expression of LCE5A was significantly downregulated.

[0056] 1. Methods

[0057] Immunohistochemical staining

[0058] 1. Fixation, paraffin embedding and sectioning

[0059] (1) Fixed

[0060] Separate the mouse tissue specimens, wash them in PBS or saline, and then fix them with 4% paraformaldehyde (generally at least overnight, depending on the specimen);

[0061] (2) Dehydration and transparency

[0062] Dehydrate the tissue specimens in an automatic tissue dehydrator overnight;

[0063] (3) Paraffin embedding

[0064] Use a paraffin embedding machine to embed tissue specimens in wax;

[0065] (4) Slicing

[0066] Take the embedded tissue specimen wax block and place it on the microtome for slicing. The slice thickness is 4μm-6um. The temperature of the slide is generally 42-45℃. Select the relatively intact slices of the tissue and stick them on the slide and mark them. Slice baking: temperature 60℃, time 1-2 hours.

[0067] 2. Immunohistochemical staining

[0068] (1) Dewaxing to water: Dewaxing by soaking in xylene for 3 times, 10 minutes each time, soaking in anhydrous ethanol for 2 times, 5 minutes each time, then soaking in 90% ethanol for 5 minutes, and finally washing with PBS for 5 minutes;

[0069] (2) Block endogenous peroxidase: Soak in 3% hydrogen peroxide (30% hydrogen peroxide 3 ml plus PBS to 100 mL) for 15 minutes, then wash with PBS three times, 5 minutes each time;

[0070] (3) Microwave antigen repair 3 times, 5 minutes each time, cooling for 1 minute, and washing once with PBS after completely cooling to room temperature;

[0071] (4) Blocking: incubate with 10% normal goat serum at room temperature for 15 minutes;

[0072] (5) Primary antibody incubation: After removing the serum, add the primary antibody (1:50 dilution), incubate in a humidified box at 4°C overnight, and then wash three times with PBS, 5 minutes each time;

[0073] (6) Secondary antibody incubation: After wiping, add HRP-labeled secondary antibody and incubate in a humidified chamber at 37°C for 30 min, then wash three times with PBS, 5 min each time;

[0074] (7) Color development: dilute the DAB stock solution 1:50 (1 μl / 50 μl) with diluent, develop color for about 10 minutes, control the degree of color development under a microscope, and then wash with water to stop color development;

[0075] (8) Restaining: Restain with hematoxylin for 2 minutes, wash with water until it turns blue, which takes about 2 minutes, differentiate with 1% hydrochloric acid ethanol (take it out immediately after putting it in), wash with water for 1 minute, blue with 1% ammonia water for 1 minute, and then rinse with running water;

[0076] (9) Sealing: Dehydrate with anhydrous ethanol twice, 5 minutes each time, clear with xylene twice, 5 minutes each time, and seal with neutral gum;

[0077] (10) After the slides are dried naturally, they are observed under a microscope and photographed;

[0078] (11) Image J software was used to quantitatively analyze the immunohistochemical imaging results.

[0079] 2. Conclusion

[0080] In order to better understand the effect of LCE5A on psoriasis, in this example, lesional skin samples from 19 psoriasis patients and normal skin samples from 9 healthy subjects were collected.

[0081] Immunohistochemical analysis showed that LCE5A expression was significantly downregulated in psoriasis lesions compared with healthy subjects ( Figure 1 a). The mean optical density (AOD) values ​​of the two groups also showed significant differences. Further analysis of the Gene Expression Omnibus dataset (GSE114729) showed that LCE5A mRNA levels were significantly upregulated in the lesional skin of psoriasis patients after glucocorticoid (GC) treatment ( Figure 1 b).

[0082] In addition, LCE5A mRNA levels were negatively correlated with KRT16 mRNA levels (proliferation marker) and NRP2 mRNA levels (angiogenesis marker), and positively correlated with LORICRIN levels (differentiation marker). Figure 1 c). It can be seen that the expression of LCE5A in local skin is positively correlated with the progression of psoriasis.

[0083] Based on the above findings, it is speculated that LCE5A may play a key role in the biological process of psoriasis by interacting with key proteins involved in keratinocyte differentiation and keratinization, thereby potentially affecting the progression of psoriasis.

[0084] Example 2 The expression of LCE5A is closely related to the disease progression, providing value for auxiliary diagnosis of psoriasis.

[0085] A transcriptome dataset (GSE114729, Downloaddatafor GSE114729-GEO-NCBI (nih.gov)), which contains pre-treatment, post-treatment, and relapse samples from 17 patients; thus, overlapping differentially expressed genes (DEGs) were identified between before and after treatment and between post-treatment and relapse. KEGG and GO analysis of these DEGs revealed key pathways involved, including the IL-17 signaling pathway and T cell regulation ( Figure 2 ac).

[0086] Notably, LCE5A, as a common differentially expressed gene, was significantly upregulated after treatment and downregulated at relapse ( Figure 2 d). In addition, changes in LCE5A mRNA levels were negatively correlated with psoriasis-related genes such as IL17A, IL17C, and KRT16, and positively correlated with keratinocyte differentiation or repair genes such as LCE2B, LCE1C, and LOR ( Figure 2 e).

[0087] Based on the above findings, it can be speculated that LCE5A plays an important bridging role between abnormal activation of keratinocytes and inflammatory response, and the two are synergistically involved in the prognosis of psoriasis.

[0088] Example 3 Lce5a-deficient mice exhibit spontaneous psoriatic inflammation

[0089] 1. HE staining

[0090] (1) Dewaxing to water: Dewaxing by soaking in xylene for 3 times, 10 minutes each time, soaking in anhydrous ethanol for 2 times, 5 minutes each time, then soaking in 90% ethanol for 5 minutes, and finally washing with PBS for 5 minutes;

[0091] (2) Preheat eosin and hematoxylin staining solutions at 37°C;

[0092] (3) After staining with hematoxylin for 3-5 minutes, rinse with double distilled water for 2 minutes;

[0093] (4) After differentiation with 1% hydrochloric acid and alcohol for 5-10 seconds, rinse with double distilled water to return to blue for 4 minutes;

[0094] (5) After eosin staining for 2-3 minutes, rinse with double distilled water for 1-2 minutes;

[0095] (6) Dehydration, transparency and sealing: dehydration with anhydrous ethanol twice, 5 minutes each time, transparency with xylene twice, 5 minutes each time, and sealing with neutral gum;

[0096] (7) After the slides are dried naturally, they are observed under a microscope and photographed;

[0097] (8) Use Image J software to analyze the results and perform statistics.

[0098] 2. Conclusion

[0099] To investigate the role of Lce5a (homologous gene in mice called Lce1m) in the pathogenesis of psoriasis, this example used CRISPR / Cas9 to generate Lce5a knockout mice. - / - Mice and wild-type (Lce5a + / + ) mice and obtained Lce5a + / - Offspring. The DNA genotypes of the mice were confirmed by PCR, Western blot, and immunohistochemical analysis.

[0100] Subsequently, the symptom changes of newborn, 8-month-old and 24-month-old mice were dynamically observed. + / - and Lce5a - / - The mice all developed localized skin thickening and hair loss, accompanied by peeling, blisters, scabs, and a small amount of white scales, mainly on the back between the ears. At the same time, HE staining showed that the mice had thicker skin, hyperkeratinization of keratinocytes, and obvious accumulation of inflammatory cells in the dermis, which was significantly increased in Lce5a. - / - mice, while Wt mice showed no obvious symptoms ( Figure 3 ac). In conclusion, LCE5A deficiency induces excessive proliferation and disrupted differentiation of keratinocytes in vivo, leading to cutaneous vascular proliferation and ultimately contributing to the development and maintenance of psoriatic inflammation.

[0101] Example 4 LCE5A is essential for skin barrier structure and function

[0102] 1. Instrument

[0103] pH meter ASP-02, Asahi, Japan;

[0104] TEWL detector AS-VT100RS, Asahi, Japan.

[0105] 2. Skin penetration test

[0106] 2.1 Fluorescein isothiocyanate isomer I (FITC) skin permeation experiment

[0107] (1) Remove the hair from the back skin of the mouse in an area of ​​approximately 2x2 cm;

[0108] (2) 1% FITC was diluted with acetone and dibutyl phthalate (1:4) for later use;

[0109] (3) Apply approximately 100 μl of 1% FITC to the prepared skin area of ​​the mouse;

[0110] (4) After 1% FITC was applied for 3 hours, the skin of the area (2.0 cm × 2.0 cm) was collected;

[0111] (5) To evaluate the fluorescence intensity of FITC penetration, 10 μm Tissue-Tek embedded sections were analyzed using an Olympus BX51 upright fluorescence microscope.

[0112] 2.2 Toluidine blue embryo penetration test

[0113] (1) Pregnant mice at day 18 were killed, and the embryos were removed and rinsed in PBS;

[0114] (2) sequentially immersed in 25%, 50%, 75%, 100%, 75%, 50%, and 25% methanol to allow penetration of toluidine blue;

[0115] (3) After the embryos were removed, they were soaked in PBS and then in 0.1% toluidine blue for 10 min;

[0116] (4) Wash in PBS;

[0117] (5) Symptom changes were observed and barrier function was evaluated based on the degree of dye penetration.

[0118] 3. Conclusion

[0119] As the largest barrier organ, the skin is the first line of defense against microbial invasion and damage. The structural and functional proteins encoded by EDCs, such as LCE5A, profoundly affect the terminal differentiation of keratinocytes and further affect the structure and function of the skin barrier.

[0120] Recently, skin barrier disorders have been recognized as a common feature of psoriasis. Therefore, this example first detected the transepidermal water loss (TEWL) and skin pH of psoriasis patients.

[0121] It was found that TEWL and pH values ​​in both lesional and non-lesional skin of patients with psoriasis were significantly increased compared with healthy individuals, suggesting that skin barrier defects may play an important role in the pathogenesis of psoriasis ( Figure 4 a). In addition, the skin barrier of Lce5a-deficient mice and Wt mice was dynamically examined in newborn, 8-month-old, and 24-month-old mice ( Figure 4 b). TEWL and pH values ​​in Lce5a-deficient mice were significantly increased compared with Wt mice of the same age. However, TEWL and pH values ​​only reflect the inner and outer barrier function of mouse skin.

[0122] To further evaluate the skin barrier function, the permeability of fluorescein isothiocyanate (FITC) and toluidine through the skin was evaluated ( Figure 4 c) Toluidine blue staining image of 19-day-old embryos shows that the dye penetrates into Lce5a - / - Mouse whole skin, in Lce5a + / -The staining was present on the ventral skin of mice but not on the dorsal skin and absent in Wt mice, further indicating that the skin barrier of Lce5a-deficient mice is underdeveloped.

[0123] Furthermore, FITC permeability assays in 7-week-old mice showed stronger fluorescence in the epidermis of Lce5a-deficient mice compared with Wt mice, especially in the Lce5a - / - In mice, low vacuum scanning electron microscopy showed that Lce5a - / - The paw skin of mice showed loosely structured keratinized bands, while Wt mice had tightly structured keratinized skin ( Figure 4 d).

[0124] In summary, the skin barrier is composed of two main components: the physical barrier and the immune barrier. These two components work together to maintain skin homeostasis. However, Lce5a deficiency disrupts this balance and triggers the occurrence of psoriasis.

[0125] Example 5 LCE5A expression deficiency leads to excessive proliferation and differentiation disorder of epidermal keratinocytes

[0126] 1. Methods

[0127] (1) HaCaT human immortalized keratinocyte cell line was purchased from China Center for Type Culture Collection (CCTCC) and cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (Sigma-Aldrich). In the HaCaT transduction experiment, cells were treated with siRNA-LCE5A. Then, the culture supernatant was collected 48 hours after transduction for cytokine bead array analysis. The expression of keratinocyte KRT1 and KRT16 was detected by immunofluorescence.

[0128] (2) Mice: Mouse skin was collected, dehydrated, paraffin-embedded, and sectioned, and the expression of KRT1 and KRT16 was analyzed by immunohistochemistry.

[0129] 2. Conclusion

[0130] Excessive proliferation and abnormal differentiation of keratinocytes lead to epidermal barrier dysfunction, which plays a vital role in initiating and maintaining psoriasis inflammation. In order to understand how LCE5A affects epidermal development and its role in the pathogenesis of psoriasis, this example uses siRNA technology to silence the expression of LCE5A in HaCaT cells. The efficiency of LCE5A siRNA knockdown was confirmed by qPCR and immunofluorescence detection. Immunofluorescence detection of K1 and K16 showed that in HaCaT cells with LCE5A knockdown, K16 was upregulated and K1 was downregulated ( Figure 5ad), indicating that LCE5A is essential for the differentiation and proliferation of keratinocytes.

[0131] Studies have shown that overexpression of antimicrobial peptides (AMPs), including S100A8, S100A9, and LL37, leads to aberrant activation of plasmacytoid dendritic cells (pDCs), thereby activating a stimulatory network between keratinocytes and Th1 / Th17 cells, which is critical for the sustained inflammatory response in psoriasis.

[0132] Therefore, this example first detected the expression of S100A9 and LL37 in mice of different ages by immunohistochemistry. It was found that AMP was significantly upregulated in Lce5a-deficient mice at 8 and 24 months of age, but not in Wt mice, and no significant difference was observed in newborn mice. Figure 5 e). Subsequently, the expression of S100A9 was detected in HaCaT cells after application of LCE5A siRNA, and AMP expression was found to be significantly upregulated ( Figure 5 f).

[0133] These results suggest that LCE5A is indispensable for the differentiation and proliferation of keratinocytes. LCE5A deficiency induces AMP expression and psoriasis-related cytokine secretion by stimulating keratinocytes.

[0134] Example 6 Lce5a expression deficiency aggravates imiquimod-induced psoriasis-like inflammation 1. Methods

[0135] (1) Experimental animals

[0136] Wt、Lce5a + / - and Lce5a - / - 5-6 female mice, 6-8 weeks old, weighing approximately 20-25 g;

[0137] (2) Main reagents and instruments

[0138] 5% imiquimod cream (Aidarol), TEWL tester, pH tester;

[0139] (3) Experimental methods

[0140] Day 0: All mice had their skin about 2 cm × 3 cm shaved on their backs with a razor;

[0141] Days 1-3: Apply 62.5 mg of 5% imiquimod cream on the back once a day for 3 consecutive days, record the changes in TEWL and PH every day, observe the changes in symptoms of mice, take pictures and perform PASI scoring (scoring principles are described below);

[0142] The PASI scoring principle is as follows: daily assessment of the severity of skin inflammation, including measurement of skin thickness, back skin scales, and erythema. Scoring is performed using a 5-point system (0-4), with dynamic records and statistical analysis:

[0143]

[0144]

[0145] (4) On the 4th day, the mice were killed and samples were collected for relevant tests.

[0146] 2. Conclusion

[0147] Imiquimod (IMQ) is a TLR7 / 8 ligand that is commonly used as a potent immune activator that induces psoriasis-like inflammation mediated by the IL-23 / IL-17 axis. To further verify the role of LCE5A deficiency-induced skin barrier damage in the pathogenesis of psoriasis, this example applied IMQ to the back skin of Lce5a-deficient mice and Wt mice ( Figure 6 a). Assessment of psoriasis severity by severity scoring and histological analysis.

[0148] The results showed that IMQ-induced psoriasis in Lce5a-deficient mice was aggravated compared with that in Wt mice ( Figure 6 bg). Thus, the lack of Lce5a expression exacerbates psoriatic inflammation in the IMQ-induced mouse model.

[0149] Example 7 AAV virus packaging for overexpression of mouse Lce5a gene (i.e., construction of recombinant adenovirus vAAV2-LCE5A)

[0150] 1. Construction of Mouse_Lce5a vector

[0151] 1. Experimental Materials

[0152] 1.1 Main experimental reagents

[0153]

[0154]

[0155] 1.2 Main experimental instruments

[0156]

[0157] 2. Methods

[0158] 2.1 Acquisition of target fragments 2.1.1 Primer design

[0159]

[0160] 2.1.2 PCR amplification of target fragments Prepare the following system, mix gently, and place in a PCR instrument for reaction;

[0161] Fragment PCR amplification system:

[0162]

[0163] PCR procedure:

[0164]

[0165] Note: 1) Annealing temperature is the primer Tm value, and annealing temperature directly determines amplification specificity;

[0166] 2) If the amplification specificity is poor, the annealing temperature can be appropriately increased by +2°C each time;

[0167] 3) Properly extending the extension time can help improve the amplification yield.

[0168] 2.2 Connection of target fragment and vector (2xGenRec recombination kit cloning and connection system)

[0169] Prepare the following reaction system in an ice-water bath; if the liquid accidentally sticks to the tube wall, it can be sunk to the bottom of the tube by brief centrifugation. After the ligation reaction solution reacts at 50℃ for 30 minutes, place it on ice for 5 minutes and transform immediately.

[0170]

[0171] Note: 1) It is recommended that when 2-3 fragments are connected, the total amount of DNA fragments used is 0.02-0.5pmols (generally, the amount of added fragments is 100-150ng, and the amount of vector is 50-100ng), and the total amount of DNA added when 4-6 fragments are connected is 0.2-1.0pmols. 2) The efficiency of DNA splicing gradually decreases with the increase of the number of spliced ​​fragments or the increase of the length of the spliced ​​fragments.

[0172] 3. Conversion

[0173] 1) After taking out the DH5α / Stbl3 competent cells from the -80℃ refrigerator, they should be immediately placed on ice to thaw. The competent cell packaging process should be gentle to reduce mechanical damage to them;

[0174] 2) After the competent medium has melted, add the ligation product in an amount not exceeding 1 / 10 of the competent medium volume (currently add 5 μL of ligation product) and place on ice for 15 to 20 minutes;

[0175] 3) Heat shock at 42℃ for 90s, and immediately incubate on ice for 3-4min;

[0176] In a clean bench, add 700 μL LB medium (note that it must be antibiotic-free LB medium) and gently invert it upside down 3-5 times;

[0177] 5) Incubate at 37°C, 230 rpm with shaking for 45-60 min;

[0178] 6) Apply the bacterial solution evenly to the solid plate with the corresponding resistance, and then place the plate upside down in a 37°C incubator for incubation for 10-12 hours.

[0179] 4. PCR Identification of Bacterial Fluid

[0180] 4.1 Bacterial liquid PCR identification system:

[0181]

[0182] Note: When configuring the mix, the proportions in the mix should be amplified in equal proportions. Number of clones to be verified; Select verification primers based on the vector used

[0183] 4.2 Bacterial liquid PCR identification procedure

[0184]

[0185] 5. Sequencing

[0186] Two clones were selected for sequencing from the positive clones screened out, and the sequencing results were compared and analyzed as follows:

[0187] 5.1 Sequencing results

[0188] like Figure 7 The sequencing result shows that the sequencing result is consistent with the target sequence, and the target plasmid (Mouse_Lce1m vector) is successfully constructed, wherein the vector contains the gene Lce5a (ie, Lce1m is the gene Lce5a), and its nucleotide sequence is shown in SEQ ID NO: 4:

[0189]

[0190] 2. Packaging of Mouse_Lce1m AAV

[0191] 1. Experimental Materials

[0192] 1.1 Cell lines

[0193] AAV Pro-293T, adeno-associated virus packaging cells, are anchorage-dependent epithelial-like cells, and the growth medium is DMEM (containing 10% FBS).

[0194] 1.2 Strains

[0195] Escherichia coli strain STBL3 was used to amplify viral vectors and auxiliary packaging vector plasmids.

[0196] 1.3 Viral packaging system

[0197] The successfully constructed adeno-associated virus recombinant plasmid and packaging plasmid were extracted using the Qiagen plasmid extraction kit. The obtained plasmid DNA was dissolved in sterile TE, and its concentration and purity were determined by ultraviolet absorption method to ensure that the A260 / A280 of the extracted plasmid DNA was between 1.8 and 2.0.

[0198] 1.4 Reagents

[0199]

[0200]

[0201] 1.5 Instruments

[0202]

[0203] 2. Methods

[0204] 2.1 Virus packaging

[0205] 1) AAV Pro-293T cell division

[0206] One day before transfection, the grown cells were subcultured into 10 cm culture dishes at an appropriate ratio, and transfection was prepared when the cells grew to 80% to 90%.

[0207] 2) Change medium before transfection

[0208] 1 to 2 hours before transfection, replace the cells to be transfected with fresh culture medium.

[0209] 3) Transfection

[0210] Take a sterile 1.5mL EP tube or 15mL centrifuge tube and prepare a transfection system according to the following table:

[0211]

[0212] After mixing, place at room temperature for 15-20 minutes, evenly add drops into the culture dish that has been replaced with liquid in advance, and then place in a CO2 incubator for culture.

[0213] 4) Change the fluid

[0214] 6 to 8 hours after transfection, carefully aspirate the cell culture medium and discard it into a waste liquid cup containing disinfectant, then add fresh cell culture medium and continue culturing.

[0215] 5) Add Enhancing buffer

[0216] After replacing the fresh culture medium, evenly add 100×Enhancing buffer to promote transfection, 100μL / dish.

[0217] 6) Virus collection

[0218] Cells and cell supernatants were collected 72 hours after transfection for subsequent concentration and purification.

[0219] 7) Virus concentration and purification

[0220] The cell suspension was repeatedly transferred between a dry ice ethanol bath and a 37°C water bath, and frozen and thawed three times, and centrifuged at 4000 rpm for 10 min.

[0221] 2.2 AAV Concentration

[0222] 1) The virus supernatant was placed in an ultracentrifuge tube and centrifuged at 10 WG for 2 hours.

[0223] 2) Add Benzonase to a final concentration of 50 U / mL and MgCL to a final concentration of 0.002 M, incubate at 37°C for 20 min.

[0224] 3) Filter with a 0.22 μm filter membrane and transfer the supernatant to a horizontal ultracentrifuge tube.

[0225] 2.3 Purification of AAV

[0226] 1) Prepare 60%, 40%, 25%, and 15% iodixanol and lay a gradient. The gradient order is: 60% iodixanol, 40% iodixanol, 25% iodixanol, 15% iodixanol, and balance.

[0227] 2) 27.5WG, 4℃, centrifuge for 4h.

[0228] 3) Transfer to a 50KD ultrafiltration tube, centrifuge at 4500rpm to the required virus amount, and discard the waste liquid at the bottom.

[0229] 4) After the virus is packaged, it is stored in a -80°C refrigerator to obtain the recombinant adenovirus vAAV2-LCE5A, wherein the nucleotide sequence of the gene Lce5a is shown in SEQ ID NO: 2.

[0230] 2.4 Determination of virus titer

[0231] Currently, the quantitative determination of AAV is done by detecting the genome copy number of the AAV vector in the genome through quantitative PCR to determine the number of AAV virus particles; quantitative PCR experimental steps:

[0232] 1) Prepare samples and standards, and gradient dilute the standard plasmid and the sample to be tested to 10 of the original concentration. -2 , 10-4 , 10 -5 , 10 -6 , 10 -7 ;

[0233] 2) Calculate the total reaction tube volume based on the number of reactions (X) (make two replicate wells for each gradient and prepare one more well for every 10 reactions);

[0234] 3) Add 18 μL of reaction solution to each reaction well, and then add 2 μL of template; the volume of each component in the PCR system is as follows:

[0235]

[0236] 4) On the machine, set the annealing temperature to 60°C, obtain the Ct value according to standard operations and calculate the copy number in the AAV sample.

[0237] Example 7 vAAV2-LCE5A-mediated gene therapy can alleviate imiquimod-induced psoriasis-like skin inflammation

[0238] 1. Methods

[0239] 1. After anesthetizing the mice with sodium pentobarbital, shave the hair on the back of the mice with a shaver and wipe with 70% alcohol;

[0240] 2. Grasp the skin at the midline fold of the back and gently pull it upward to form a "tent" shape to minimize non-purposeful injection of surrounding subcutaneous tissue;

[0241] 3. Use a 26G needle and a 1cc syringe to inject 100μL of virus suspension subcutaneously (subcutaneous swelling is visible if the injection is successful), approximately 1E+11VG;

[0242] 4. Slowly withdraw the needle, applying gentle pressure to prevent backflow;

[0243] 5. Return the mice to the cage for feeding and observation;

[0244] 6. Two weeks later, biopsy was performed on the back skin of mice, and the efficiency of LCE5A overexpression was detected by fluorescence and WB. When EGFP fluorescence and LCE5A were highly expressed, the modeling experiment was started.

[0245] 2. Conclusion

[0246] Preliminary studies have shown that in the skin lesions of psoriasis patients, the expression of LCE5A is reduced compared with that in healthy individuals, but the expression of LCE5A is increased in psoriasis patients after appropriate treatment. Therefore, to evaluate the therapeutic effect of LCE5A on psoriasis inflammation, we subcutaneously injected vAAV carrying the LCE5A overexpression vector into the back skin of mice, and mice injected with vAAV- carrying nonsense DNA (vAAV-NC) were used as negative controls. Mice injected with vAAV-LCE5A confirmed the expression of LCE5A and EGFP in the epidermis 21 days after injection. At the same time, compared with mice injected with vAAV-NC, mice injected with vAAV2-LCE5a showed significant improvement in clinical and pathological symptoms from 21 days onwards, with reduced PASI scores and epidermal hyperplasia ( Figure 8 ad). At the same time, LCE5A protein overexpression can significantly improve the skin barrier function of mice, including transepidermal water loss and pH value reduction ( Figure 8 c).

[0247] CBA results showed that vAAV-LCE5A-injected mice had lower levels of IL6 and TNF-α in the skin and lower levels of IL17a in the serum compared with vAAV-NC-injected mice treated with IMQ ( Figure 8 e).

[0248] The above results convincingly demonstrated that Lce5a gene therapy accelerated the resolution of psoriasis-like skin inflammation in Lce5a-deficient mice.

[0249] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. The use of LCE5A as a target in the preparation of a drug for treating inflammatory skin diseases including psoriasis.

2. The use according to claim 1, characterized in that: The psoriasis is any one of common psoriasis, erythrodermic psoriasis and impetigo psoriasis; the inflammatory skin disease is an inflammatory skin disease caused by impaired barrier function including psoriasis.

3. A use of LCE5A in the preparation of a drug for treating or improving skin diseases associated with skin scaling, erythema, thickening and epidermal abnormalities.

4. A pharmaceutical composition for treating inflammatory skin diseases including psoriasis, characterized in that: The pharmaceutical composition includes LCE5A.

5. Use of a late phase envelope protein 5a gene overexpression vector in the preparation of medicines for treating inflammatory skin diseases including psoriasis.

6. A recombinant adenovirus vAAV2-LCE5A, characterized in that: The recombinant adenovirus vAAV2-LCE5A is an adeno-associated virus type 2 into which the gene LCE5A is inserted, wherein the nucleotide sequence of the gene LCE5A is shown in SEQ ID NO:

2.

7. Use of the recombinant adenovirus vAAV2-LCE5A according to claim 6 in the preparation of a medicine for alleviating psoriasis-like skin inflammation induced by imiquimod.

8. A drug for alleviating imiquimod-induced psoriasis-like inflammation, characterized in that: The medicine contains recombinant adenovirus vAAV2-LCE5A.

9. Use of a reagent for detecting the expression of gene LCE5A in the preparation of a kit for auxiliary diagnosis of psoriasis, characterized in that: The expression of LCE5A was analyzed by immunohistochemistry or RT-qPCR.

10. Use of a late phase envelope protein 5a in the preparation of drugs for repairing skin diseases caused by skin barrier damage and in the development of functional skin care products.

Images