Application of rice F-box protein gene OsFBK14 in brown planthopper resistance

Abstract

The invention discloses application of a rice F-box protein gene OsFBK14 in brown planthopper resistance, and belongs to the technical field of plant genetic engineering. The CDS (Coding sequence) sequence of the gene OsFBK14 is as shown in SEQ ID NO. 1, and the CDS (Coding sequence) sequence of the gene OsFBK14 is as shown in SEQ ID NO. 1. According to the invention, the expression of the OsFBK14 gene is increased in insect-susceptible rice, so that the brown planthopper resistance of the transgenic rice over-expressed with the OsFBK14 gene is enhanced. The invention reveals that the OsFBK14 gene can enhance the resistance of rice to brown planthopper for the first time, and has great significance for ensuring the safe production of rice.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to application of a rice F-box protein gene OsFBK14 in resistance to brown planthoppers. Background Art

[0002] Rice planthoppers belong to the family Delphacidae in the order Homoptera of the class Insecta and are monophagous rice pests. The main species are the brown planthopper (Nilaparvata lugens Stål), the white-backed planthopper (Sogatella furcifera Horvath) and the gray planthopper (Laodelphax striatellus Fallén), of which the brown planthopper is the most serious. The brown planthopper is widely distributed in my country and has strong seasonality, migratory characteristics and reproductive capacity. It is easy to cause disasters when it breaks out, causing rice plants to wilt, reduce yields or even fail to produce crops.

[0003] Rice is an important food crop in my country. More than 60% of the country's population relies on rice as their staple food. In the past decade, my country's total rice demand has remained stable at 195 million to 215 million tons. Therefore, curbing the development of brown planthoppers to ensure the safety of rice production is of great significance to ensuring my country's food security.

[0004] As one of the largest gene families in plants, F-box genes can participate in regulating plant growth and development and responding to adverse stress. With the continuous improvement of genome sequencing, more and more functions of F-box genes have been reported, but these reported genes are just the tip of the iceberg for the entire F-box gene family. Therefore, research on the F-box gene family needs to be further deepened. Summary of the invention

[0005] In view of the above deficiencies in the prior art, the present invention provides an application of a rice F-box protein gene OsFBK14 in resistance to brown planthoppers.

[0006] To achieve the above purpose, the specific technical solutions of the present invention are as follows:

[0007] In a first aspect, the present invention provides an application of a rice F-box protein gene OsFBK14 in improving rice resistance to brown planthoppers, wherein the CDS (Coding sequence) sequence of the gene OsFBK14 is (i) or (ii):

[0008] (i) the nucleotide sequence shown in SEQ ID NO.1, whose ORF is 1128 bp in length and encodes 376 amino acids;

[0009] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0010] Those skilled in the art should understand that according to the nucleotide sequence shown in SEQ ID NO: 1, one or more nucleotides are replaced, deleted and / or added to obtain an amino acid sequence with the same function. For example, in the sequence under different rice backgrounds, one or more nucleotides are replaced or deleted, and the encoded amino acid sequence has no frameshift mutation, and only some amino acids are deleted or point mutations occur. Therefore, the coding sequence of the gene OsFBK14 described in the present invention also includes the nucleotide sequence shown in SEQ ID NO: 1, which is replaced, deleted and / or added with one or more nucleotides, and has the same or similar function as the nucleotide sequence shown in SEQ ID NO.1.

[0011] Furthermore, the gene OsFBK14 encodes the following protein (a) or (b):

[0012] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2;

[0013] (b) A protein derived from (a), wherein the amino acid sequence shown in SEQ ID NO: 2 is substituted, deleted and / or added with one or more amino acids, and has the same function as the protein consisting of the amino acid sequence shown in SEQ ID NO: 2.

[0014] Those skilled in the art should understand that, under the premise of not affecting the activity of the protein encoded by the gene OsFBK14 (i.e., not in the active center of the protein), those skilled in the art can make various substitutions, additions and / or deletions of one or several amino acids to the amino acid sequence shown in SEQ ID NO: 2 to obtain an amino acid sequence with equivalent function.

[0015] The invention provides an application of the rice F-box protein gene OsFBK14 in improving the resistance of rice to brown planthoppers. When the activity and / or expression amount of the gene OsFBK14 increases, the resistance of rice to brown planthoppers is enhanced. The enhanced resistance of rice to brown planthoppers is mainly manifested in that after the brown planthoppers feed on the rice leaf sheaths, the rice plants in the control group die, while the plants with overexpression of the gene OsFBK14 grow normally. Meanwhile, after the brown planthoppers feed on the leaf sheaths of the overexpression plants, the survival rate of the brown planthoppers is reduced, the weight gain of the brown planthoppers is reduced, and the amount of honeydew secreted is reduced.

[0016] In a second aspect, the present invention provides a biomaterial, wherein the biomaterial contains the gene OsFBK14, and the biomaterial is a recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium; the CDS sequence of the gene OsFBK14 is (i) or (ii):

[0017] (i) the nucleotide sequence shown in SEQ ID NO.1;

[0018] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0019] In a third aspect, the present invention provides a gene OsFBK14, or use of the biological material according to claim 3 in breeding rice varieties with resistance to brown planthoppers, characterized in that the CDS sequence of the gene OsFBK14 is (i) or (ii):

[0020] (i) the nucleotide sequence shown in SEQ ID NO.1;

[0021] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0022] In a fourth aspect, the present invention provides a method for preparing brown planthopper-resistant rice, comprising: increasing the activity and / or expression level of the OsFBK14 gene by genetic engineering means.

[0023] Furthermore, the genetic engineering comprises: constructing an overexpression vector of the OsFBK14 gene, and transforming rice with the vector.

[0024] Furthermore, the overexpression vector is introduced into plant cells using conventional biotechnology methods, including but not limited to the use of Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation.

[0025] Furthermore, the overexpression vector is introduced into plant cells using Agrobacterium-mediated method and is used to transform rice.

[0026] In a fifth aspect, the present invention provides the use of transgenic rice obtained by the method in rice breeding.

[0027] Furthermore, the breeding methods include: transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0028] Discovery and functional verification of the OsFBK14 gene described in the present invention:

[0029] (1) Discovery process: Through transcriptome analysis of rice resistant and susceptible to brown planthoppers, we found a gene OsFBK14 that was upregulated in brown planthopper-resistant rice when fed by brown planthoppers.

[0030] (2) Genetic transformation to verify function: An OsFBK14 gene overexpression vector was constructed. The vector backbone was a pCXUN vector containing the Ubiquinti promoter. The overexpression vector was introduced into susceptible rice plants using Agrobacterium EHA105-mediated genetic transformation. Transgenic plants were screened and finally, positive transgenic rice plants overexpressing the OsFBK14 gene were obtained. Quantitative PCR analysis was performed on the T2 generation plants, and two representative lines with relatively high expression levels (FBK14OE-1 and FBK14OE-2) were selected for functional verification. The insect resistance of the T2 generation transgenic plants was identified using the seedling group method, survival rate, insect weight gain and honeydew amount. It was found that the two lines had significantly enhanced resistance to brown planthoppers.

[0031] Compared with the prior art, the present invention is beneficial in that:

[0032] The present invention increases the expression of the OsFBK14 gene in insect-susceptible rice and finds that the overexpressed transgenic rice plants have enhanced insect resistance. The present invention reveals for the first time that the OsFBK14 gene enhances the resistance of rice to brown planthoppers and can be used for the study of plant insect resistance. There are many F-box gene members in plant cells, which are involved in a variety of biological functions. Therefore, the research on the OsFBK14 gene in the present invention has a good reference value for subsequent research on the functions of other F-box gene members. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The quantitative PCR test results of transgenic plants; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001;

[0034] Figure 2 The insect resistance phenotype of transgenic rice lines FBK14OE-1 and FBK14OE-2; Figure 2 A is a physical picture of rice after brown planthoppers have eaten it; Figure 2 B is the level of rice resistance to brown planthoppers, the smaller the value, the stronger the resistance; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

[0035] Figure 3 The changes in survival rate, insect weight gain and honeydew amount after brown planthoppers fed on different transgenic strains; Figure 3 A shows the changes in the survival rate of brown planthoppers after feeding on different transgenic strains; Figure 3 B shows the changes in the weight gain of brown planthoppers after feeding on different transgenic strains; Figure 3 C shows the changes in honeydew amount after brown planthoppers fed on different transgenic strains; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001. DETAILED DESCRIPTION

[0036] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] The present invention provides an application of a rice F-box protein gene OsFBK14 in improving the resistance of rice to brown planthoppers. The CDS (Coding sequence) sequence of the gene OsFBK14 is (i) or (ii):

[0038] (i) the nucleotide sequence shown in SEQ ID NO.1, whose ORF is 1128 bp in length and encodes 376 amino acids;

[0039] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0040] The present invention studies the transcriptome analysis of resistant and susceptible rice before and after brown planthopper feeding, and finds that the OsFBK14 gene is significantly upregulated in insect-resistant rice after brown planthopper feeding, but there is no obvious change in insect-susceptible rice, suggesting that the OsFBK14 gene may play a certain role in the rice insect resistance mechanism pathway. In order to study the specific role of the gene in rice resistance to brown planthoppers, the present invention transfers its overexpression vector into the insect-susceptible rice variety Nipponbare through Agrobacterium-mediated genetic transformation. The results show that the overexpressed transgenic plants show stronger resistance to brown planthoppers than the control Nipponbare plants, which is mainly manifested in that after brown planthoppers feed, the control Nipponbare withers and dies, while the transgenic plants still survive well, and at the same time, the survival rate, insect weight gain and secreted honeydew amount after brown planthoppers feed on transgenic plants are significantly reduced. The present invention has a good reference significance for studying gene molecular functions and breeding work.

[0041] In the following specific embodiments, unless otherwise specified, all are carried out according to conventional experimental methods and described recombination techniques (such as Sambrook et al. Molecular Cloning Laboratory Manual, Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, etc.), or according to the conditions recommended in the manufacturer's instructions.

[0042] Example 1

[0043] 1. Obtaining the Rice OsFBK14 Gene

[0044] Through the transcriptome sequencing ID, the full-length sequence of the OsFBK14 gene in the Nipponbare database was found. Primers were designed according to the ORF, and PCR amplification was performed using the Nipponbare rice cDNA as a template. The high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme) 50µL reaction system was used for amplification. The PCR conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing extension for 30 s / kb, 30 cycles. The PCR system is as follows:

[0045]

[0046] After the PCR product was recovered, it was connected to the pMD18-T vector, and the positive clones were screened and sequenced. The sequencing results showed that the sequence of the PCR product was as shown in SEQ ID NO:1.

[0047] 2. Construction of OsFBK14 gene overexpression vector and Agrobacterium-mediated genetic transformation

[0048] 1. Construction of OsFBK14 overexpression vector

[0049] The inventors cut a section at each end of the ORF to design primers, the sequences are as follows:

[0050] F: cccgggggatccccaatactatgctaacacttgttggag (5'-3'), as shown in SEQ ID NO.3;

[0051] R: aacccgctgttatccccaatactactttcaatggtcacactgc (5'-3'), as shown in SEQ ID NO.4;

[0052] The vector used was pCXUN (kindly donated by Professor Wang Guoliang of Ohio State University, USA, GenBank: FJ905215.1, from a paper published in Plant Pathlology in 2009 by Songbiao Chen, Pattavipha Songkumarn, JianliLiu, Guo-Liang Wang, titled A Versatile ZeroBackground T-Vector System for Gene Cloning and Functional Genomics). The pCXUN vector was digested with XcmI, and the exogenous fragment was directly connected after adding A. After sequencing verification, the resulting vector was the Os01g41460 gene overexpression vector, which was electroporated into Agrobacterium EHA105. A single clone was picked for expansion and culture, and after PCR verification, an equal volume of 50% glycerol was added to mix and stored at -80 ℃ for later use.

[0053] 2. Genetic transformation

[0054] The OsFBK14 gene overexpression vector was introduced into the japonica rice variety Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) to obtain transgenic plants, and positive plants were detected using the universal primers Hyg-L and Hyg-R for hygromycin.

[0055] The T2 positive plants were harvested from the flag leaves to extract RNA, which was then converted into cDNA and its expression was detected by quantitative PCR. Figure 1 The results showed that the overexpression effects of the two different transgenic lines (FBK14OE-1 and FBK14OE-2) were obvious.

[0056] 3. Phenotypic analysis of OsFBK14 overexpressing plants

[0057] 1. Seedling Group Method

[0058] Overexpressed transgenic plants FBK14OE-1, FBK14OE-2 and control plants Nipponbare (transgenic background plants, showing insect-susceptible) were sown in milk tea cups, 15 seeds per cup, and each group was repeated 3 times. When the rice reached the three-leaf stage, insects were released to ensure that each rice seedling had 8 2-3 year old brown planthopper nymphs. When the mortality rate of the insect-susceptible control group was above 90%, photos were taken and the resistance level of each rice plant in each cup was read. The average value was the insect resistance level of the transgenic line. The test results are shown in Figure 2 ,in, Figure 2 A is a physical picture of rice after brown planthoppers have eaten it; Figure 2 B is the level of rice resistance to brown planthoppers, and the smaller the value, the stronger the resistance. Figure 2 A shows that when the brown planthopper feeds on the control plant Nipponbare and causes it to wither and die, the transgenic plants FBK14OE-1 and FBK14OE-2 still survive.

[0059] 2. Determination of survival rate, insect weight gain and honeydew amount

[0060] Similarly, transgenic plants FBK14OE-1, FBK14OE-2 and control plant Nipponbare were sown in milk tea cups. Each group had 10 cups, with one plant in each cup. When the plants grew to the five-leaf stage, 20 2-3-year-old brown planthopper nymphs were inoculated into each cup. The number of brown planthoppers surviving on different plants was recorded every day, and their survival rate was calculated. The results are as follows: Figure 3 As shown in A. The results showed that the survival rate of brown planthoppers decreased significantly after feeding on overexpressed transgenic plants.

[0061] Transgenic plants FBK14OE-1, FBK14OE-2 and control plant Nipponbare were sown in milk tea cups. There were 3 cups in each group and 6 seeds in each cup. When the rice grew to the five-leaf stage, folded wax bags were tied to the rice stems, two wax bags per plant, and a brown planthopper was placed in each wax bag. After feeding for 48 hours, the wax bags were taken down, and the brown planthopper and the wax bags were weighed. The difference in weight of the brown planthopper before and after feeding was calculated as the insect weight gain of the brown planthopper, and the difference in the wax bags before and after feeding was calculated as the amount of honeydew secreted by the brown planthopper. The results were as follows: Figure 3 B, 3C. The results showed that after feeding on the overexpressed transgenic plants, the weight gain and honeydew secretion of brown planthoppers were significantly reduced.

[0062] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application of rice F-box protein gene OsFBK14 in improving rice resistance to brown planthopper, characterized in that: The CDS sequence of the gene OsFBK14 is (i) or (ii): (i) the nucleotide sequence shown in SEQ ID NO.1; (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.

1.

2. The use of the rice F-box protein gene OsFBK14 in improving the resistance of rice to brown planthoppers according to claim 1, characterized in that: The gene OsFBK14 encodes the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) A protein derived from (a), wherein the amino acid sequence shown in SEQ ID NO: 2 is substituted, deleted and / or added with one or more amino acids, and has the same function as the protein consisting of the amino acid sequence shown in SEQ ID NO:

2.

3. A biomaterial, characterized in that: The biological material contains the gene OsFBK14, and the biological material is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium; the CDS sequence of the gene OsFBK14 is (i) or (ii): (i) the nucleotide sequence shown in SEQ ID NO.1; (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.

1.

4. A gene OsFBK14 or a biological material according to claim 3 for use in breeding rice varieties with brown planthopper resistance, characterized in that: The CDS sequence of the gene OsFBK14 is (i) or (ii): (i) the nucleotide sequence shown in SEQ ID NO.1; (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.

1.

5. A method for preparing brown planthopper-resistant rice, characterized in that: include: The activity and / or expression level of the OsFBK14 gene is increased by genetic engineering.

6. The method for preparing brown planthopper-resistant rice according to claim 5, characterized in that: The genetic engineering comprises: constructing an overexpression vector of the OsFBK14 gene and transforming rice with the vector.

7. Use of the transgenic rice obtained by the method of claim 5 or 6 in rice breeding.

8. The use according to claim 7, characterized in that: The breeding methods include: transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

Images