Application of rice F-box protein gene OsFBK14 in resistance to brown planthopper
By overexpressing the OsFBK14 gene in rice, the resistance of rice to brown planthopper was enhanced, solving the problem of insufficient resistance of rice to brown planthopper and achieving highly efficient enhancement of rice's insect resistance.
Patent Information
- Application Number
- CN202411532256.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-30
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2044-10-30
AI Technical Summary
In existing technologies, rice lacks sufficient resistance to brown planthoppers, leading to withering of rice plants, reduced yields, or even crop failure, thus affecting food security.
By increasing the expression level of the OsFBK14 gene in rice, an overexpression vector was constructed using genetic engineering techniques and introduced into rice cells to enhance the rice's resistance to brown planthoppers.
Rice plants overexpressing the OsFBK14 gene showed significantly enhanced resistance to brown planthoppers. After feeding on the brown planthoppers, the survival rate decreased, the body weight decreased, and the honeydew secretion decreased, while the rice growth was normal.
Smart Images

Figure CN119752923B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the rice F-box protein gene OsFBK14 in resistance to brown planthopper. Background Technology
[0002] Rice planthoppers belong to the family Plantipodidae in the order Hemiptera. They are monophagous pests of rice. The main species are the brown planthopper (Nilaparvata lugens Stål), the white-backed planthopper (Sogatella furcifera Horvath), and the gray planthopper (Laodelphax striatellus Fallén), with the brown planthopper causing the most severe damage. Widely distributed in my country, brown planthoppers exhibit strong seasonality, migratory activity, and reproductive capacity. Outbreaks can easily become devastating, leading to rice plant wilting, reduced yields, and even total crop failure.
[0003] Rice is an important food crop in my country, with more than 60% of the population relying on it as their staple food. Over the past decade, my country's total demand for rice has remained stable at 195 million to 215 million tons. Therefore, curbing the development of brown planthoppers to ensure the safety of rice production is of great significance to safeguarding my country's food security.
[0004] F-box genes, one of the largest gene families in plants, are involved in regulating plant growth and development and responding to abiotic stress. With the continuous improvement of genome sequencing, the functions of more and more F-box genes are being reported; however, these reported genes represent only the tip of the iceberg for the entire F-box gene family. Therefore, further in-depth research on the F-box gene family is needed. Summary of the Invention
[0005] To address the shortcomings of the existing technologies, this invention provides the application of the rice F-box protein gene OsFBK14 in resistance to brown planthopper.
[0006] To achieve the above objectives, the specific technical solution of the present invention is as follows:
[0007] In a first aspect, the present invention provides the application of the rice F-box protein gene OsFBK14 in improving rice resistance to brown planthopper, wherein the CDS (Coding sequence) of the gene OsFBK14 is (i) or (ii):
[0008] (i) The nucleotide sequence shown in SEQ ID NO.1 has a full-length ORF of 1128 bp, encoding 376 amino acids;
[0009] (ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO.1 that has been substituted, deleted and / or added with one or more nucleotides, and that expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.
[0010] Those skilled in the art will understand that, based on the nucleotide sequence shown in SEQ ID NO: 1, substituting, deleting, and / or adding one or more nucleotides yields an amino acid sequence with the same function. For example, in sequences with different rice backgrounds, substituting or deleting one or more nucleotides does not result in frameshift mutations in the encoded amino acid sequence; only partial amino acid deletions or point mutations occur. Therefore, the coding sequence of the gene OsFBK14 described in this invention also includes nucleotide sequences showing the nucleotide sequence shown in SEQ ID NO: 1, after substituting, deleting, and / or adding one or more nucleotides, and having the same or similar function as the nucleotide sequence shown in SEQ ID NO: 1.
[0011] Furthermore, the gene OsFBK14 encodes either the following protein (a) or (b):
[0012] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2;
[0013] (b) A protein derived from (a) whose amino acid sequence shown in SEQ ID NO: 2 has been substituted, deleted and / or added with one or more amino acids and has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO: 2.
[0014] Those skilled in the art should understand that, without affecting the activity of the protein encoded by the OsFBK14 gene (i.e. not at the active site of the protein), they can make various substitutions, additions, and / or deletions of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2 to obtain an amino acid sequence with equivalent function.
[0015] The present invention relates to the application of the rice F-box protein gene OsFBK14 in improving rice resistance to brown planthopper. Increased activity and / or expression of the OsFBK14 gene enhances rice resistance to brown planthopper. This enhanced resistance is primarily manifested in the following ways: after brown planthoppers feed on rice leaf sheaths, control group rice plants die, while plants with overexpression of the OsFBK14 gene grow normally. Simultaneously, after brown planthoppers feed on the leaf sheaths of plants with overexpression, the survival rate of brown planthoppers decreases, their weight gain decreases, and the amount of honeydew secreted decreases.
[0016] Secondly, the present invention provides a biomaterial containing the gene OsFBK14, wherein the biomaterial is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector, or an engineered bacterium; the CDS sequence of the gene OsFBK14 is (i) or (ii):
[0017] (i) The nucleotide sequence shown in SEQ ID NO.1;
[0018] (ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO.1 that has been substituted, deleted and / or added with one or more nucleotides, and that expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.
[0019] Thirdly, the present invention provides the application of gene OsFBK14, or the biomaterial of claim 3, in the breeding of rice varieties with resistance to brown planthopper, characterized in that the CDS sequence of gene OsFBK14 is (i) or (ii):
[0020] (i) The nucleotide sequence shown in SEQ ID NO.1;
[0021] (ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO.1 that has been substituted, deleted and / or added with one or more nucleotides, and that expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.
[0022] Fourthly, the present invention provides a method for preparing brown planthopper-resistant rice, comprising: using genetic engineering techniques to increase the activity and / or expression level of the OsFBK14 gene.
[0023] Furthermore, the genetic engineering includes: constructing an overexpression vector for the OsFBK14 gene and transforming rice with the vector.
[0024] Furthermore, the overexpression vector is introduced into plant cells using conventional biotechnological methods, including but not limited to the use of Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation.
[0025] Furthermore, the overexpression vector is introduced into plant cells using Agrobacterium-mediated transformation for the conversion of rice.
[0026] Fifthly, the present invention provides the application of transgenic rice obtained by the method in rice breeding.
[0027] Furthermore, the breeding methods include: transgenic, hybridization, backcrossing, self-pollination, or asexual reproduction.
[0028] The discovery and functional verification of the OsFBK14 gene described in this invention:
[0029] (1) Discovery process: Through transcriptome analysis of rice resistant to and susceptible to brown planthoppers, a gene OsFBK14 was discovered that was upregulated in rice resistant to brown planthoppers when fed by brown planthoppers.
[0030] (2) Genetic transformation verification function: An overexpression vector of the OsFBK14 gene was constructed. The vector backbone was a pCXUN vector containing the Ubiquinti promoter. The overexpression vector was introduced into susceptible rice using the Agrobacterium EHA105-mediated genetic transformation method. Transgenic plants were screened, and positive transgenic rice plants with overexpression of the OsFBK14 gene were finally obtained. Quantitative PCR analysis was performed on the T2 generation plants, and two representative lines with relatively high expression levels (FBK14OE-1 and FBK14OE-2) were selected for functional verification. Insect resistance was identified in the T2 generation transgenic plants, including seedling group method, survival rate, insect weight gain and honeydew amount, etc. It was found that the two lines had significantly enhanced resistance to brown planthopper.
[0031] Compared with the prior art, the advantages of the present invention are:
[0032] This invention, by increasing the expression of the OsFBK14 gene in insect-prone rice, found that transgenic rice plants with overexpression exhibited enhanced insect resistance. This invention is the first to reveal that the OsFBK14 gene enhances rice resistance to the brown planthopper, and can be used for research on plant insect resistance responses. Plant cells contain many F-box genes involved in various biological functions; therefore, the research on the OsFBK14 gene in this invention provides valuable reference for subsequent studies on the functions of other F-box gene members. Attached Figure Description
[0033] Figure 1 The results are from quantitative PCR detection of transgenic plants; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001;
[0034] Figure 2 Insect-resistant phenotypes in transgenic rice lines FBK14OE-1 and FBK14OE-2; Figure 2 A is a photograph of a rice plant after it has been fed on by brown planthoppers; Figure 2 B represents the resistance level of rice to brown planthopper; the smaller the value, the stronger the resistance. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.
[0035] Figure 3 The study investigated changes in survival rate, weight gain, and honeydew volume of brown planthoppers after feeding on different transgenic strains; among these changes... Figure 3 A shows the change in survival rate of brown planthoppers after feeding on different transgenic strains; Figure 3 B shows the changes in the weight gain of brown planthoppers after feeding on different transgenic strains; Figure 3 C represents the change in honeydew amount after brown planthoppers fed on different transgenic lines; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001. Detailed Implementation
[0036] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0037] This invention provides the application of the rice F-box protein gene OsFBK14 in improving rice resistance to brown planthopper, wherein the CDS (Coding sequence) of the gene OsFBK14 is (i) or (ii):
[0038] (i) The nucleotide sequence shown in SEQ ID NO.1 has a full-length ORF of 1128 bp, encoding 376 amino acids;
[0039] (ii) A nucleotide sequence of the nucleotide sequence shown in SEQ ID NO.1 that has been substituted, deleted and / or added with one or more nucleotides, and that expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.
[0040] This invention, through transcriptome analysis of resistant and susceptible rice before and after feeding by brown planthoppers, found that the OsFBK14 gene was significantly upregulated in resistant rice after feeding, while no significant change was observed in susceptible rice, suggesting that the OsFBK14 gene may play a role in the rice's insect resistance mechanism pathway. To investigate the specific role of this gene in rice resistance to brown planthoppers, this invention used Agrobacterium-mediated genetic transformation to transfer its overexpression vector into the susceptible rice variety Nipponbare. The results showed that the overexpressed transgenic plants exhibited stronger resistance to brown planthoppers compared to the control Nipponbare plants. Specifically, after feeding by brown planthoppers, the control Nipponbare plants withered and died, while the transgenic plants survived relatively well. Furthermore, the survival rate, weight gain, and honeydew secretion of brown planthoppers after feeding on transgenic plants were significantly reduced. This invention has significant reference value for studying gene molecular function and breeding work.
[0041] In the following specific implementations, unless otherwise specified, conventional experimental methods were followed and the recombinant techniques described (such as Sambrook et al., Molecular Cloning: a Laboratory Manual, Sambrook J & Russell DW, 2001, etc.) were performed, or the conditions recommended in the manufacturer's instructions were followed.
[0042] Example 1
[0043] I. Obtaining the OsFBK14 gene in rice
[0044] The full-length sequence of the OsFBK14 gene in the Nipponbare database was found using the transcriptome sequencing ID. Primers were designed based on the ORF, and PCR amplification was performed using Nipponbare rice cDNA as a template. A 50µL reaction system of the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme) was used for amplification. The PCR conditions were: 95 ℃ pre-denaturation for 3 min; 95 ℃ denaturation for 15 s; 58 ℃ annealing extension for 30 s / kb, for 30 cycles. The PCR system is as follows:
[0045]
[0046] The PCR product was recovered and ligated into the pMD18-T vector. Positive clones were screened and sequenced. The sequencing results show that the sequence of the PCR product is shown in SEQ ID NO:1.
[0047] II. Construction of OsFBK14 gene overexpression vector and Agrobacterium-mediated genetic transformation
[0048] 1. Construction of OsFBK14 overexpression vector
[0049] The inventors designed primers by truncating a segment from each end of the ORF, with the following sequences:
[0050] F: cccgggggatccccaatactatgctaacacttgttggag (5'-3'), as shown in SEQ ID NO.3;
[0051] R: aacccgctgttatccccaatactactttcaatggtcacactgc (5'-3'), as shown in SEQ ID NO.4;
[0052] The vector used was pCXUN (a generous gift from Professor Liang Wang Guo of Ohio State University, GenBank: FJ905215.1, from a 2009 paper published in Plant Pathlology by Songbiao Chen, Pattavipha Songkumarn, Jianli Liu, and Guo-Liang Wang, titled "A Versatile ZeroBackground T-Vector System for Gene Cloning and Functional Genomics"). The pCXUN vector was digested with XcmI, and the exogenous fragment was directly ligated after adding an A. After sequencing verification, the resulting vector was the Os01g41460 gene overexpression vector, which was electroporated into Agrobacterium EHA105. Single colonies were picked and cultured for expansion. After PCR verification, an equal volume of 50% glycerol was added, mixed well, and stored at -80 ℃ for later use.
[0053] 2. Genetic transformation
[0054] The OsFBK14 gene overexpression vector was introduced into the japonica rice variety Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282). Transgenic plants were obtained, and positive plants were detected using the universal primers Hyg-L and Hyg-R for hygromycin.
[0055] RNA was extracted from the flag leaves of T2 generation positive plants, reverse-engineered into cDNA, and its expression level was detected by quantitative PCR. The results are as follows: Figure 1 As shown in the figure. The results indicate that the overexpression of the two different transgenic lines (FBK14OE-1 and FBK14OE-2) was significantly enhanced.
[0056] III. Phenotypic Analysis of Plants with OsFBK14 Gene Overexpression
[0057] 1. Seedling Group Method
[0058] Transgenic plants FBK14OE-1 and FBK14OE-2 (overexpressing the transgenic strain) and the control plant Nipponbare (a transgenic background plant, susceptible to the insect) were sown in milk tea cups, 15 seeds per cup, with three replicates per group. Insects were released when the rice reached the three-leaf stage, ensuring 8 2nd-3rd instar brown planthopper nymphs per rice seedling. When the mortality rate of the susceptible control group exceeded 90%, photographs were taken, and the resistance level of each rice plant in each cup was recorded. The average value was taken as the resistance level of the transgenic line. The experimental results are shown in […]. Figure 2 ,in, Figure 2 A is a photograph of a rice plant after it has been fed on by brown planthoppers; Figure 2 B represents the rice's resistance level to brown planthoppers; a lower value indicates stronger resistance. From Figure 2 As can be seen from A, when the control plants Nipponbare withered and died due to feeding on brown planthoppers, the transgenic plants FBK14OE-1 and FBK14OE-2 still survived.
[0059] 2. Determination of survival rate, insect weight gain, and honeydew amount
[0060] Similarly, transgenic plants FBK14OE-1 and FBK14OE-2, and the control plant Nipponbare, were sown in milk tea cups. Ten cups were placed in each group, with one plant per cup. When the plants reached the five-leaf stage, 20 2nd-3rd instar brown planthopper nymphs were inoculated into each cup. The number of surviving brown planthoppers on different plants was recorded daily, and the survival rate was calculated. The results are as follows: Figure 3 As shown in Figure A, the results indicate that the survival rate of brown planthoppers significantly decreased after consuming overexpressing transgenic plants.
[0061] Transgenic plants FBK14OE-1 and FBK14OE-2, and the control plant Nipponbare, were sown in milk tea cups. Three cups were used per group, with six seeds per cup. When the rice reached the five-leaf stage, folded wax bags were tied to the rice stems, two bags per plant. One brown planthopper was placed in each bag. After feeding for 48 hours, the wax bags were removed, and the brown planthoppers and wax bags were weighed. The difference in weight of the brown planthopper before and after feeding was calculated as the planthopper's weight gain, and the difference in weight of the wax bags before and after feeding was calculated as the amount of honeydew secreted by the brown planthopper. The results are shown below. Figure 3 As shown in B and 3C. The results indicate that after brown planthoppers fed on transgenic plants with overexpression, their weight gain and the amount of honeydew secreted both decreased significantly.
[0062] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.
Claims
1. Rice F-box protein gene OsFBK14 Its application in improving rice resistance to brown planthopper is characterized by, The gene OsFBK14 The CDS sequence is the nucleotide sequence shown in SEQ ID NO.
1.
2. A gene OsFBK14 Its application in breeding rice varieties resistant to brown planthoppers is characterized by, The gene OsFBK14 The CDS sequence is the nucleotide sequence shown in SEQ ID NO.
1.
3. A method for preparing brown planthopper-resistant rice, characterized in that, include: Using genetic engineering techniques to enable OsFBK14 Increased expression of the gene OsFBK14 The CDS sequence is the nucleotide sequence shown in SEQ ID NO.
1.
4. The method for preparing brown planthopper-resistant rice according to claim 3, characterized in that, The genetic engineering includes: constructing OsFBK14 Gene overexpression vector, used to transform rice.
5. The application of transgenic rice obtained by the method described in claim 3 or 4 in rice breeding.
6. The application according to claim 5, characterized in that, The breeding methods include hybridization, backcrossing, self-pollination, or asexual reproduction.
Citation Information
Patent Citations
Gene TaFBK1 with F-box structure field, and expression vector and application thereof
CN104593383A
Brown planthopper NlSP2 protein as well as coding gene and application thereof
CN117700515A