Application of LpDUF707-1 gene in positive regulation of plant root growth and drought stress response

Abstract

The invention relates to the technical field of biology, in particular to a bovine litchis gene LpDUF707-1 and application thereof.Based on bovine litchis genome data and BSA re-sequencing data, the LpDUF707-1 gene is cloned, the expression mode under drought stress is analyzed through a real-time quantitative PCR technology, and the LpDUF707-1 gene is obtained; through verification, it is found that the LpDUF707-1 gene can promote plant root growth and improve plant drought tolerance, a foundation is laid for revealing a drought tolerance mechanism of the LpDUF707-1 gene, and a gene resource and a theoretical basis are provided for plant drought tolerance molecular breeding.

Description

[Technical field]

[0001] The invention relates to the field of biotechnology, and in particular to application of LpDUF707-1 gene in positively regulating plant root growth and drought stress response. [Background technology]

[0002] my country has rich native grass resources, which are not only highly tolerant to stress, but also contain excellent stress-resistant genes. They are valuable resources for studying the drought-resistant mechanism of plants and the molecular improvement of drought-resistant forage grasses. However, current research on native grasses in my country is mostly focused on the preservation and evaluation of germplasm resources, domestication and breeding, and the research on drought-resistant gene mining and drought-resistant molecular mechanisms is relatively weak. Therefore, it is urgent to conduct research on the drought-resistant mechanism of domestic native grasses, explore excellent drought-resistant gene resources, and use stress-resistant molecular breeding to accelerate the cultivation of new varieties of drought-resistant forage grasses and ecological restoration grasses.

[0003] Lespedeza potaninii is a perennial herbaceous semi-shrub plant of the genus Lespedeza in the family Fabaceae. As a strong drought-tolerant native grass unique to my country, Lespedeza potaninii can grow normally in desert sites with a precipitation of 150 mm. It has a well-developed root system and strong drought tolerance. However, there is a lack of research on the drought-adaptive phenotype of Lespedeza potaninii, such as the relationship between its well-developed axial root system and drought tolerance. At the same time, the exploration and functional analysis of the drought-tolerant gene resources of Lespedeza potaninii are very scarce.

[0004] The DUF707 protein family is a class of proteins containing a conserved domain of unknown function of DUF707. In recent years, some studies have shown that DUF707 is involved in the development of plant organs or tissues, such as bast fibers, grains, and pollen. In addition, some studies have shown that plant DUF707 may be involved in abiotic stress responses. So far, the theoretical basis for the function of DUF707 family proteins in plants is still weak, and research on the regulation of plant response to drought by this family of proteins is still blank. [Summary of the invention]

[0005] In view of the above, it is necessary to provide a LpDUF707-1 gene and its application, which can enhance the root growth of Rhizoma Corydalis and thus enhance the drought resistance of Rhizoma Corydalis.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] LpDUF707-1 gene, the nucleotide sequence of the LpDUF707-1 gene is shown in SEQ ID NO.1.

[0008] The present invention also includes a protein encoded by the LpDUF707-1 gene, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0009] The present invention also includes primers for amplifying the LpDUF707-1 gene, wherein the primers are primer P1 / primer P2, the sequence of primer P1 is shown in SEQ ID NO.3, and the sequence of primer P2 is shown in SEQ ID NO.4.

[0010] The present invention also includes an expression vector, which contains the coding sequence SEQ ID NO.1 of the LpDUF707-1 gene.

[0011] The present invention also includes the use of the LpDUF707-1 gene in improving plant drought resistance and / or promoting plant root growth.

[0012] The present invention also includes a method for improving plant drought resistance and / or promoting plant root growth using the LpDUF707-1 expression vector, the method comprising:

[0013] (1) Using the plasmid of T-LpDUF707-1 as a template, PCR amplification was performed using primers P3 / primer P4 with a high-fidelity enzyme to obtain the LpDUF707-1 gene fragment;

[0014] (2) Cut plasmid pBI121 with XbaI and BamHI to obtain linearized vector of pBI121;

[0015] (3) connecting the LpDUF707-1 gene fragment of step (1) and the linearized vector of pBI121 to obtain the prokaryotic expression vector pBI121-LpDUF707-1;

[0016] (4) using the electroporation method, the pBI121-LpDUF707-1 plasmid was transformed into Agrobacterium rhizogenes K599, and then the Agrobacterium rhizogenes K599 was used to infect the hairy roots of the Codonopsis pilosula.

[0017] The sequence of the primer P3 is shown in SEQ ID NO.5, and the sequence of the primer P4 is shown in SEQ ID NO.6.

[0018] Furthermore, the plant is Rhizoma Coptidis.

[0019] The present invention has the following beneficial effects:

[0020] The present invention is based on the genome data of Codonopsis pilosula, clones the LpDUF707-1 gene, and uses real-time quantitative PCR technology to analyze the expression pattern under drought stress. It is verified that the LpDUF707-1 gene can promote the growth of the root system of Codonopsis pilosula and improve the drought resistance of Codonopsis pilosula. The present invention lays a foundation for revealing the drought tolerance mechanism of the LpDUF707-1 gene and provides gene resources and theoretical basis for plant drought-resistant molecular breeding.

Brief Description of the Drawings

[0021] Figure 1 This is the genetic structure diagram of Botrytis cinerea LpDUF707-1.

[0022] Figure 2 This is the phylogenetic tree of the amino acid sequence encoded by the gene of LpDUF707-1 of Botrytis cinerea and DUF707 of other plants.

[0023] Figure 3 This is a graph showing the transcriptional response of L. truncatula LpDUF707-1 to drought stress.

[0024] Figure 4 This is an agarose gel electrophoresis diagram of positive hairy roots identified by PCR of hairy roots transfected with OE-LpDUF707-1 gene. In the figure, M is a marker, (-) is a negative control: empty vector transgenic ddH2O PCR product, (+) is a positive control: pBI121-LpDUF707-1 plasmid PCR product. The remaining lanes 1-14 are the PCR products of transgenic hairy roots of OE-LpDUF707-1.

[0025] Figure 5 This is the agarose gel electrophoresis diagram of the positive hairy roots identified by PCR after transfection of RNAi-LpDUF707-1 gene.

[0026] In the figure, M is a marker, (-) is a negative control: empty vector transgenic ddH2O PCR product, (+) is a positive control: RNAi-LpDUF707-1 plasmid PCR product. The remaining lanes 1-14 are RNAi-LpDUF707-1 transgenic hairy root PCR products.

[0027] Figure 6 This is a graph of the relative expression levels of LpDUF707-1 in the positive OE-LpDUF707-1 and RNAi-LpDUF707-1 gene-transfected hairy roots of C. truncatula and the empty-loaded control hairy roots.

[0028] Figure 7 It is a diagram showing the aboveground phenotype, underground phenotype and physiological index measurement of OE-LpDUF707-1 and RNAi-LpDUF707-1 gene-transformed hairy root plants under drought stress. [Specific implementation method]

[0029] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0030] Example 1

[0031] Cloning and sequence analysis of LpDUF707-1 gene:

[0032] (1) Using the reference genome of Botrytis cinerea as the reference sequence, primers (primer P1 and primer P2) were designed to amplify the LpDUF707-1 gene from the whole Botrytis cinerea plant.

[0033] (2) Extract total RNA from the whole plant of Botrytis cinerea according to the instructions of the RNA extraction kit. Reverse transcribe the extracted RNA into cDNA using a reverse transcription kit. Use this cDNA as a template and perform PCR amplification using primers P1: 5'-ATGGGAATCACCACTCGAAGTT-3' (SEQ ID NO.3) and primer P2: 5'-TTAATGAGCAGTGGAATCAGA-3' (SEQ ID NO.4) with a high-fidelity enzyme.

[0034] The reaction system of the above PCR amplification is as follows: 2× Max Buffer 12.5μL, dNTP 0.5μL, forward and reverse primers (10μM) 1μL each, Max Super-Fidelity DNA Polymerase (Novagen high-fidelity DNA polymerase) 0.5μL, ddH2O 8.5μL.

[0035] The PCR program was: 95°C for 3 min; 95°C for 30 s, 52°C for 30 s, 72°C for 1 min 30 s, 35 cycles; 72°C for 5 min.

[0036] (3) After the reaction, take 5 μL of the PCR product for 1.5% agarose gel electrophoresis. A band of approximately 1206 bp was observed in the UV gel imaging system, which was consistent with the expected size. The LpDUF707-1 gene fragment was recovered using a PCR product purification kit. The recovered and purified DNA fragment was connected using the 5min TA / Blunt-Zero Cloning Kit instructions. The recombinant plasmid T-LpDUF707-1 was transformed into Escherichia coli competent cells, and positive clones were screened using ampicillin Amp (100 mg / L) labeling, and the bacterial liquid was identified by PCR. The bacterial liquid of the positive recombinant plasmid was sequenced. The local TBtools software was used to analyze the composition of the introns and exons of the LpDUF707-1 gene, and MEGA7.0 was used to construct a phylogenetic tree. The constructed phylogenetic tree is shown in the figure. Figure 2As shown. The phylogenetic tree is clearly divided into three large branches. The scale represents the evolutionary distance, and the value on the node represents the percentage (%) of the node's credibility based on 1000 repetitions in the Bootstrap validation. The sources of the sequences used in the figure: Arabidopsis: AtDUF707-1 (AT1G08040.1), AtDUF707-2 (AT1G11170.1), AtDUF707-3 (AT1G13000.1), AtDUF707-4 (AT1G24570.1), AtDUF707-5 (AT1G61240.1), AtDUF707-6 (AT1G67850.1). 1), AtDUF707-7(AT2G28310.1), AtDUF707-8(AT3G26440.1), AtDUF707-9(AT3G27470.1), AtD UF707-10(AT4G12840.1), AtDUF707-11(AT4G18530.1); rice: OsDUF707-1(LOC_Os01g68260.1) , OsDUF707-2(LOC_Os01g69050.1), OsDUF707-3(LOC_Os01g73970.1), OsDUF707-4(LOC_Os02 g19510.1), OsDUF707-5(LOC_Os05g01760.1), OsDUF707-6(LOC_Os06g51180.1), OsDUF707-7 (LOC_Os06g51190.1), OsDUF707-8 (LOC_Os06g51200.1), OsDUF707-9 (LOC_Os06g51520.1), OsDUF707-10 (LOC_Os07g23190.1), OsDUF707-11 (LOC_Os07g37760.1); the amino acid sequence of LpDUF707-1 is (the amino acid sequence shown in SEQ ID No.2).

[0037] (4) The genetic structure of LpDUF707-1 gene is as follows Figure 1 The nucleotide sequence of LpDUF707-1 gene is shown in SEQ ID NO.1, which contains 1206 bases and encodes 401 amino acids. Its amino acid sequence is shown in SEQ ID NO.2, and its molecular weight is 46.08 kDa.

[0038] Figure 1 The gene structure of LpDUF707-1 of Botrytis cinerea. The DNA sequence of LpDUF707-1 includes 1206 nucleotides, consisting of 14 exons and 13 introns. Exons are represented by boxes, and the numbers are the numbers of nucleotides.

[0039] Example 2

[0040] Analysis of the expression pattern of LpDUF707-1 in the roots of Rhizoma Coptidis under drought stress

[0041] In order to further identify the involvement of LpDUF707-1 in the drought stress response of R. truncatum, the transcription level of LpDUF707-1 in different tissues and roots under drought stress was analyzed. RNA was extracted from different tissues such as the roots of R. truncatum after stress, and its expression level under drought stress was analyzed using real-time fluorescence quantitative PCR technology. The results are as follows Figure 3 As shown, Figure 3 In A, L is leaf, S is seed, ST is stem, R is root system, and F is flower; Figure 3 As can be seen from A, the expression level of LpDUF707-1 is highly expressed in the roots and stems, indicating that LpDUF707-1 mainly functions in the roots and stems. Figure 3 In B, RCK is the control, RLS is mild drought stress, RSS is severe drought stress, and RRW is rewatering treatment. Figure 3 It can be seen that the expression level of LpDUF707-1 in the roots of C. chinensis under mild drought stress (RLS) and severe drought stress (RSS) showed a significant up-regulation trend compared with the control, indicating that LpDUF707-1 responds to drought stress in the roots of C. chinensis.

[0042] Example 3

[0043] Plant overexpression vector construction

[0044] (1) Using the plasmid of T-LpDUF707-1 as a template, PCR amplification was performed using the upstream primer P3 and the downstream primer P4 with a high-fidelity enzyme, primer P3: 5'-GAGAACACGGGGGACTCTAGAATGGGAATCACCACTCGAAGT T-3' (SEQ ID NO. 5), primer P4: 5'-CCATGGTACCCCCGGGGATCCGATGAGCAGTGGAATCAG ATATA-3' (SEQ ID NO. 6);

[0045] The reaction system for PCR amplification is as follows: 2× Max Buffer 12.5μL, dNTP 0.5μL, forward and reverse primers (10μM) 1μL each, Max Super-Fidelity DNA Polymerase (Novagen high-fidelity DNA polymerase) 0.5μL, ddH2O 8.5μL.

[0046] The PCR program was: 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, 72°C for 1 min 30 s, 35 cycles; 72°C for 5 min.

[0047] (2) Take 5 μL of PCR product and perform 1.5% agarose gel electrophoresis. Use ultraviolet gel imaging to see the fragments with the expected size, and use a PCR product purification kit to recover the LpDUF707-1 gene fragment.

[0048] (3) Linearized vector: Use XbaI and BamHI to digest the plant overexpression vector plasmid pBI121. After digestion, purify the product using a PCR product purification kit. The digestion reaction system is as follows: 1 μg of vector plasmid, 1 μL of XbaI, 1 μL of BamHI, 2 μL of 10× buffer, and ddH2O to 20 μL. Incubate the digestion reaction at 37°C for 1 h.

[0049] (4) The LpDUF707-1 gene fragment from step (2) and the pBI121 vector linearized in step (3) were cloned using a one-step cloning kit. MultiS One Step Cloning Kit (Novozyme) was used for homologous recombination. The system was as follows: 2.5 μL of linearized pBI121 vector, 1 μL of LpDUF707-1 gene fragment, 1 μL of 5×CE MultiS Buffer, and 0.5 μL of Exnase MultiS. React at 37°C for 30 min; reduce to 4°C or immediately cool on ice. Transform Escherichia coli DH5α by heat shock method. Pick a single clone for bacterial liquid PCR detection, and send the positive single clone for sequencing. The single clone with the correct sequencing is the successful vector constructed. Shake the bacteria, extract the plasmid with a plasmid extraction kit, and obtain the prokaryotic expression vector: pBI121-LpDUF707-1, which is stored at -20°C.

[0050] Example 4

[0051] Gateway technology to construct RNAi expression vector:

[0052] (1) According to the Gateway instruction manual, the attB site was incorporated into the 5' end of the gene-specific upstream and downstream primers to obtain primers P5 and P6. The plasmid T-LpDUF707-1 was used as a template. Max Super-Fidelity DNA Polymerase was used for PCR amplification, and the PCR product was recovered using a gel recovery kit. The entry vector pDONR-Zeo and the gel recovery product were used for BP reaction to construct the entry vector; wherein, the P5 sequence is as follows: 5'-GGGGACAAGTT TGTACAAAAAAGCAGGCTTAATGGGAATCACCACTCGAAGTT-3' (SEQ ID NO.7); the P6 sequence is as follows: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAATCATTCCTAAGCTCATTAA GCTC-3' (SEQ ID NO.8);

[0053] The BP reaction system was as follows: 0.4 μL of Gateway BPⅡ Clonase enzyme mixture, 1 μL of gel recovery product (50 ng / μL), and 0.6 μL of pDONR-Zeo (150 ng / μL). The reaction was carried out at 25°C overnight.

[0054] (2) The ligation product was transformed into E. coli DH5α. 100 μL of the culture was spread on a LB solid plate containing bleomycin Zeo antibiotic at a final concentration of 33 mg / L. The positive single clone was detected using universal primers M13F and M13R and sent for sequencing. The single clone with the correct sequencing was shaken and the plasmid was extracted using a plasmid extraction kit and stored at -20°C.

[0055] RNAi vector pK7GWIWG2(II)RR and entry vector were used for LR reaction to construct RNAi recombinant vector. The LR reaction system was as follows: Gateway LRⅡClonase enzyme mixture 0.4μL, Entry Clone (150ng / μL) 0.6μL, target vector (150ng / μL) 0.6μL, ddH2O 0.4μL. React at 25℃ overnight. The ligation product was transformed into Escherichia coli DH5α. After the transformation, 100μL of culture was taken and spread on LB solid plate containing spectinomycin Spe antibiotic with a final concentration of 50mg / L. After the positive monoclonal bacterial solution was detected, the positive monoclonal with the target band was shaken and the plasmid was extracted with a plasmid extraction kit, that is, the successful RNAi-LpDUF707-1 recombinant plasmid was constructed and stored at -20℃.

[0056] Example 5

[0057] Transformation of hairy roots of Rhizoma Coptidis with LpDUF707 gene

[0058] The pBI121-LpDUF707-1 plasmid, RNAi-LpDUF707-1 and empty vector were transformed into Agrobacterium rhizogenes K599 by electroporation. Single clones were picked for bacterial liquid PCR detection, and the product fragment was consistent with the expected target fragment size, indicating that Agrobacterium with LpDUF707-1 gene overexpression and RNAi vector was successfully obtained.

[0059] 200 μL of K599, LpDUF707-1 overexpression vector and RNAi vector K599 bacterial solution were applied on the plate. After 7 days of germination of the seeds of the schizophyllum, the root tip of the schizophyllum was quickly cut off with a scalpel 5 mm above it. The cut seedlings were lightly dipped in the Agrobacterium biofilm and placed on the 1 / 2MS medium with PPM antibiotics, wrapped with tin foil and cultured in the dark for 3 days. After 3 days of co-culture, the seedlings were taken out of the dark treatment conditions, placed on the 1 / 2MS solid medium, and placed in a filter paper-seedling-filter paper structure, and placed upright in a 22℃ tissue culture room (16h light / 8h dark) for 14 days to start growing hairy roots, and then transferred to water for 15-20 days to observe the growth and conduct subsequent experiments.

[0060] Example 6

[0061] Identification of transgenic hairy roots of bovine twigs at the molecular level: The transgenic hairy roots of bovine twigs were identified at the genomic and transcriptional levels. Using the ultra-fast Mix, 1 mm of the root tip was taken, 20 μL of the partner was added, and the mixture was treated at 95°C for 5 minutes, followed by centrifugation. 1 μL of the supernatant was taken as a template, and the target band was detected by PCR using the upstream primers of the vector and the self-primers. Figure 4 and Figure 5 As shown, Figure 4 and Figure 5 M in the figure is a marker, (-) is a blank control: ddH2O PCR product, and (+) is a positive control; Figure 4 and Figure 5 The markers are all 2000bp, and from top to bottom they are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp; Figure 4 Can amplify the target band 1200bp and Figure 5 The target band of 300 bp was amplified, indicating that the target gene was successfully transformed into the hairy roots of C. Figure 6 As shown, Figure 6Figure A shows the results of fluorescence label detection after OE-LpDUF707-1 and RNAi-LpDUF707-1 transfected different hairy roots, Figure B shows the relative expression level of LpDUF707-1 in hairy roots after OE-LpDUF707-1 transfected different hairy roots; Figure C shows the relative expression level of LpDUF707-1 in hairy roots after RNAi-LpDUF707-1 transfected different hairy roots. The expression of LpDUF707-1 in transgenic hairy roots was detected by qRT-PCR, and it was found that compared with the control plant K599 (EV), the expression level of LpDUF707-1 gene was higher in the overexpression strain and lower in the RNAi strain.

[0062] Example 7

[0063] Drought tolerance test of transgenic complex schizophyllum: After the transformation control plant K599, schizophyllum overexpressing LpDUF707-1 vector, and schizophyllum RNAi-LpDUF707-1 vector grew hairy roots for 60 days, the complex schizophyllum was subjected to drought treatment for 3 weeks. After the stress, the aboveground phenotypes of the control, overexpressing LpDUF707-1, and RNAi strains were observed. Figure 7 As shown, Figure 7 Figure A① shows the phenotype of plants treated normally, and Figure B① shows the phenotype of plants treated with drought. Figure 7 A and Figure 7 In B, OE plants are plants overexpressing the LpDUF707 gene, EV is the blank group, and RNAi is the plant interfering with the LpDUF707 gene. Figure 7 A and Figure 7 As shown in B, after drought stress, the leaves of the overexpression complex showed normal phenotype, the leaves of the control complex wilted and turned yellow, and the leaves of the RNAi complex turned yellow and curled.

[0064] Figure 7 C is the result diagram of leaf relative water content. Figure 7 D is the result diagram of malondialdehyde. Figure 7 E is the aboveground dry weight result diagram, in which the gray-white blocks are plants in the blank group, the blue blocks are plants overexpressing the LpDUF707 gene, and the orange-yellow blocks are plants interfering with the LpDUF707 gene; it can be seen from the figure that after drought treatment, the relative water content of the leaves of the overexpression plants was significantly greater than that of the blank group, and the relative water content of the leaves of the interference expression plants was significantly less than that of the blank group; the aboveground dry weight of the overexpression plants was significantly greater than that of the blank group, and the aboveground dry weight of the interference expression plants was significantly less than that of the blank group; the malondialdehyde content of the overexpression plants was significantly lower than that of the blank group, and the malondialdehyde content of the interference expression plants was significantly greater than that of the blank group; therefore, combined with the results of physiological indicators such as leaf relative water content, aboveground dry weight and MDA, it can be seen that overexpression of the LpDUF707-1 gene improves the drought resistance of the complex Niuzhizi.

[0065] Example 8

[0066] Root phenotype detection of transgenic complex schizophyllum: After the transformation control plant K599, schizophyllum overexpressing LpDUF707-1 vector, and schizophyllum RNAi-LpDUF707-1 vector grew hairy roots for 60 days, the complex schizophyllum was subjected to 3 weeks of drought treatment. After the stress, the root phenotypes of the control, overexpressing LpDUF707-1, and RNAi strains were observed. Figure 7 As shown, Figure 7 A② and Figure 7 B② is the appearance of the root system. In the figure, OE plants are plants that overexpress the LpDUF707 gene, EV is the plant in the blank group, and RNAi is the plant that interferes with the LpDUF707 gene. Figure 7 A and Figure 7 As can be seen from B, after drought stress, the root growth of the overexpression complex was significantly promoted, while the root growth of the RNAi complex was significantly decreased.

[0067] Figure 7 F is the root weight result diagram, Figure 7 G is the root length result diagram, Figure 7 H is the root area result diagram, in which the orange-yellow blocks are plants in the blank group, the light green blocks are plants overexpressing the LpDUF707 gene, and the light purple blocks are plants interfering with the LpDUF707 gene; it can be seen from the figure that after drought treatment, the root length of the overexpression plants was significantly greater than that of the blank group, and the root length of the interference expression plants was significantly less than that of the blank group; the root length of the overexpression plants was significantly greater than that of the blank group, and the root length of the interference expression plants was significantly less than that of the blank group; the root area of ​​the overexpression plants was significantly greater than that of the blank group, and the root area of ​​the interference expression plants was significantly less than that of the blank group; therefore, combined with the results of root length, root dry weight, root area and other indicators, it can be seen that overexpression of the LpDUF707-1 gene promoted the root growth of the complex cattle branches, thereby improving the drought resistance of the complex cattle branches

[0068] In summary, the LpDUF707-1 gene isolated from Coix lacryma-jobi in the present application can promote the root growth of the Coix lacryma-jobi complex, thereby improving the drought resistance of the Coix lacryma-jobi complex.

[0069] The above-described embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several modifications and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the attached claims.

Claims

1. LpDUF707-1 gene, characterized in that The nucleotide sequence of the LpDUF707-1 gene is shown in SEQ ID NO.

1.

2. The protein encoded by LpDUF707-1 gene is characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. Primers for amplifying the LpDUF707-1 gene according to claim 1, characterized in that: The primers are primer P1 / primer P2, the sequence of primer P1 is shown in SEQ ID NO.3, and the sequence of primer P2 is shown in SEQ ID NO.

4.

4. An expression vector, characterized in that The expression vector contains the coding sequence SEQ ID NO.1 of the LpDUF707-1 gene as claimed in claim 1.

5. Use of the LpDUF707-1 gene as claimed in claim 1 in improving plant drought tolerance and / or promoting plant root growth.

6. A method for improving plant drought tolerance and / or promoting plant root growth using the LpDUF707-1 expression vector as claimed in claim 4, characterized in that: The method is: (1) Using the plasmid of T-LpDUF707-1 as a template, PCR amplification was performed using primers P3 / primer P4 with a high-fidelity enzyme to obtain the LpDUF707-1 gene fragment; (2) Cut plasmid pBI121 with XbaI and BamHI to obtain linearized vector of pBI121; (3) connecting the LpDUF707-1 gene fragment of step (1) and the linearized vector of pBI121 to obtain the prokaryotic expression vector pBI121-LpDUF707-1; (4) using the electroporation method, the pBI121-LpDUF707-1 plasmid was transformed into Agrobacterium rhizogenes K599, and then the Agrobacterium rhizogenes K599 was used to infect the hairy roots of the Codonopsis pilosula. The sequence of the primer P3 is shown in SEQ ID NO.5, and the sequence of the primer P4 is shown in SEQ ID NO.

6.

7. The method according to claim 6, characterized in that The plant is Rhizoma Cistanches.

Images