OsRNE gene and application of protein coded by OsRNE gene in rice leaf color regulation and chloroplast development

Abstract

The invention discloses an OsRNE gene and application of protein coded by the OsRNE gene in rice leaf color regulation and chloroplast development. The nucleotide sequence of the gene OsRNE is as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein of the gene OsRNE is as shown in SEQ ID NO.2. According to the invention, the OsRNE is knocked out by using a CRISPR / Cas9 gene editing technology, and a functional loss mutant is obtained. The mutation of the gene causes damaged development of rice chloroplast, influences chlorophyll synthesis, albinism of seedlings and death within the trefoil stage, so that the gene can be used as a marker character in the seedling stage to assist rice molecular breeding. The OsRNE gene is mainly expressed in leaves, protein coded by the OsRNE gene is positioned in chloroplast, and development of the chloroplast and normal growth of seedlings are further affected by affecting metabolism of ribosome RNA in the chloroplast. Therefore, the method can be applied to rice leaf color character molecular genetic breeding, and has important significance in further understanding a rice chloroplast development regulation mechanism and improving the rice yield.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to the application of OsRNE gene and protein encoded by the gene in rice leaf color regulation and chloroplast development. Background Art

[0002] Rice is one of the most important food crops, with more than half of the population relying on rice as their staple food. Chloroplasts are important organelles in rice leaves, which absorb light energy for photosynthesis, synthesize carbon dioxide and water into energy-rich organic matter, and release oxygen. In addition, chloroplasts can synthesize chlorophyll to keep the leaves green. Therefore, the development of chloroplasts affects the yield and quality of rice.

[0003] Chloroplast development can be divided into three stages: replication and synthesis of plastid DNA, "construction" of chloroplasts, and synthesis of photosynthetic apparatus. In the second stage, nuclear-encoded RNA polymerase NEP (Nuclear-encoded RNApolymerase) is preferentially transcribed into plastid housekeeping genes to promote transcription and translation of chloroplast genes. In the third stage, plastid-encoded RNA polymerase PEP (Plastid-encoded RNApolymerase) combines with nuclear-encoded proteins to form a photosynthetic and metabolic system that controls chloroplast development. Chloroplasts are semi-autonomous organelles with independent genomes. Because their own genomes are too small, most proteins are encoded by nuclear genes and transferred to chloroplasts through transit peptides after translation to function. The genome of rice chloroplasts is about 135kb, containing 34 RNA-encoding genes and 120 protein-encoding genes. There are about 3,000 proteins that play an important role in chloroplast function, of which more than 95% are encoded by nuclear genes. In short, chloroplast development is coordinated and regulated by plastid and nuclear-encoded genes. Therefore, cloning and characterization of these nuclear genes should help to elucidate the complex regulatory mechanisms of plant chloroplast development.

[0004] Any defect in the chloroplast development process will produce leaf color phenotypic mutants. Scientists have identified many mutants, such as light green, yellow, white stripes, variegated and albino mutants. These mutants, especially albino mutants, are ideal materials for studying the molecular mechanisms of chloroplast and leaf development. Rice leaf color mutants can be used as morphological markers to cultivate three-line or two-line sterile lines carrying leaf color markers and improve the purity of hybrid seeds. In addition, with the rapid development of rice functional genomics, more and more genes that control chloroplast development have been cloned. In-depth research and analysis of the molecular mechanisms of these genes involved in regulating rice leaf color will help us improve rice leaf color through genetic engineering, improve leaf photosynthetic efficiency and rice yield.

[0005] The rice OsRNE gene is located on chromosome 8 and encodes a protein with a CBM2 (Carbohydrate-binding module 2) domain at the N-terminus and an RNaseE / G domain at the C-terminus. So far, there have been no reports on the functional studies of the OsRNE gene and its encoded protein in rice. Earlier, we obtained a homozygous mutant of OsRNE by using the CRISPR / Cas9 site-directed editing method, which affected chloroplast development and chlorophyll synthesis, resulting in seedling albinism. Functional studies of the rice OsRNE gene will help reveal its mechanism of action and related applications in regulating rice leaf color and chloroplast development. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development.

[0007] The technical problem that the present invention is to solve is to provide an application of the protein encoded by the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development.

[0008] The technical problem that the present invention also aims to solve is to provide a recombinant expression vector, an expression cassette or a recombinant bacterium containing an OsRNE gene for use in regulating rice leaf color and / or regulating chloroplast development.

[0009] The technical problem that the present invention needs to solve is to provide an oligonucleotide, a knockout vector and a recombinant strain.

[0010] The final technical problem to be solved by the present invention is to provide the application of the oligonucleotide, the knockout vector and the recombinant strain in changing the color of rice leaves and / or reducing the chlorophyll content and / or improving the development of chloroplasts.

[0011] Technical solution: The present invention provides the use of OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, wherein the nucleotide sequence of the OsRNE gene is as shown in SEQ ID NO.1 or a mutant, allele or derivative thereof generated by inserting, replacing or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.1.

[0012] The present invention also includes the use of the protein encoded by the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development. The amino acid sequence of the protein is as shown in SEQ ID NO.2, or an amino acid sequence or derivative generated by inserting, replacing or deleting one or more amino acids in the shown amino acid sequence or a homologous sequence of other species.

[0013] The present invention also includes the use of a recombinant expression vector, an expression cassette or a recombinant bacterium containing the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development. The nucleotide sequence of the OsRNE gene is as shown in SEQ ID NO.1 or a mutant, allele or derivative thereof generated by inserting, substituting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.1.

[0014] Wherein, the regulation method includes reducing or increasing the expression or activity of the protein encoded by the OsRNE gene.

[0015] Wherein, the method for reducing the expression or activity of the protein encoded by the OsRNE gene includes RNAi interference technology or gene knockout method.

[0016] The present invention also includes an oligonucleotide, the sequence of which is shown in SEQ ID NO.3.

[0017] The present invention also includes a knockout vector, which is obtained by annealing a double-stranded DNA fragment obtained by designing a primer pair based on the oligonucleotide and connecting it with the vector.

[0018] The present invention also includes a recombinant strain, which is obtained by introducing the knockout vector into a host bacterium.

[0019] The present invention also includes the use of the oligonucleotide, the knockout vector, and the recombinant strain in changing the color of rice leaves and / or reducing the chlorophyll content and / or improving the development of chloroplasts.

[0020] Wherein, the application includes increasing the expression levels of rpoA, rpoB, rpoC1 and rpoC2 and / or decreasing the expression levels of psaA1, psaA2, psbD1, atpA, atpB, rbcL, OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1 and / or OsPORA.

[0021] The specific technical steps for implementing the present invention are as follows: The mutation of the leaf color regulation gene and chloroplast development gene OsRNE involved in the present invention is obtained by knocking out the conventional japonica rice Zhonghua 11 using CRISPR / Cas9 gene editing technology. The mutant osrne has leaf albino from seed germination, and the seedlings grow to death at the three-leaf stage. Its chlorophyll a, chlorophyll b and carotenoid contents are significantly reduced compared with the wild type. Transmission electron microscopy observation results show that the ultrastructure of wild-type chloroplasts is normal, containing a large number of well-developed thylakoids inside, while the mutant osrne chloroplast morphology has two types, one is that the number of thylakoid membranes is significantly reduced, and the other is more serious, and the chloroplasts basically do not contain thylakoids. SDS-PAGE found that the content of Rubisco large subunit RbcL in mutant leaves was significantly reduced. The mutant basically cannot detect the rRNA of chloroplast ribosome 23S and 16S subunits.

[0022] The above-mentioned rice leaf color regulatory gene OsRNE encodes rice chloroplast nuclease, which is mainly responsible for the metabolic activity of rRNA in chloroplasts. Its mutation leads to reduced chloroplast photosynthesis and serious abnormalities in chloroplast ultrastructure.

[0023] Beneficial effects: Compared with the prior art, the advantages of the present invention are as follows: The present invention uses the reverse genetics technology CRISPR / Cas9 technology to verify the function of the OsRNE gene. The OsRNE gene encodes a chloroplast localization protein, and its mutants have albinism leaves in the seedling stage and plant death in the later stage. Since OsRNE is involved in the metabolic process of chloroplast rRNA, mutations in this gene can lead to abnormal chloroplast thylakoid results and cause a decrease in leaf photosynthesis. Analyzing the biological function of OsRNE is of great significance for further understanding the mechanism of chloroplast development. In addition, since osrne homozygotes are lethal, three-line or two-line sterile lines carrying leaf albino markers can be cultivated in the future through genetic engineering to improve the purity of hybrid seeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The genotype and seedling phenotype of the OsRNE knockout mutant obtained using CRISPR / Cas9. Figure 1 A is the gRNA sequence for knocking out the target site; Figure 1 B is the sequencing peak diagram of the knockout mutant target site; Figure 1 C is the normal phenotype of wild-type seedlings; Figure 1 D shows the albino phenotype of osrne-1 mutant seedlings.

[0025] Figure 2 Pigment content and rRNA analysis of wild type and osrne-1 mutant. Figure 2A is the content of chlorophyll a, chlorophyll b and carotenoids in the wild type and osrne-1 mutant; Figure 2 B is SDS-PAGE analysis of the content of RbcL protein in the wild type and osrne-1 mutant; Figure 2 C and Figure 2 D, Detection of rRNA of chloroplast ribosomal 23S and 16S subunits in wild type and osrne-1 mutant.

[0026] Figure 3 Ultrastructural observation of chloroplasts of wild type and osrne-1 mutant. Figure 3 A and Figure 3 B is the observation of wild-type chloroplast structure, where Figure 3 B is Figure 3 A: Enlargement of the boxed area; Figure 3 C- Figure 3 F is the chloroplast structure observation of osrne-1 mutant. Figure 3 D and Figure 3 F Figure 3 C and Figure 3 E: Enlargement of the box area; compared with the wild type, Figure 3 D and Figure 3 F represents two different types of thylakoid changes in the mutant. Figure 3 F contains almost no thylakoids.

[0027] Figure 4 is the expression level of OsRNE in various tissues of rice. Figure 4 A is the analysis result of gene expression database; Figure 4 B and Figure 4 C is the OsRNE at heading stage ( Figure 4 B) and three-leaf stage ( Figure 4 C) Relative expression levels in different tissues of rice. R represents root; C represents stem; L represents leaf; LS represents leaf sheath; P represents panicle; YR represents young root at the three-leaf stage; YS represents young stem at the three-leaf stage; L2 represents the second leaf at the three-leaf stage; L3 represents the third leaf at the three-leaf stage.

[0028] Figure 5 Subcellular localization of OsRNE protein in tobacco and rice. Figure 5 A shows the localization of OsRNE-GFP in tobacco mesophyll cells; Figure 5 B shows the localization of OsRNE-GFP in rice protoplasts.

[0029] Figure 6 Expression analysis of chlorophyll metabolism and chloroplast development genes in wild type and osrne-1. Figure 6 A is the expression level of chloroplast biosynthesis-related genes detected by qRT-PCR; Figure 6 B is the expression level of photosynthesis-related genes detected by qRT-PCR; Figure 6 C is the expression level of chlorophyll synthesis related genes detected by qRT-PCR. DETAILED DESCRIPTION

[0030] The present invention is further described below by specific examples. Obviously, the described examples are only a part of the embodiments of the present invention, rather than all the embodiments. The experimental methods in the following examples are conventional methods unless otherwise specified.

[0031] The background material selected in the present invention is japonica rice Zhonghua 11 (ZH11), which is a conventional rice variety, and the base editing receptor variety is from Wuhan Boyuan Biotechnology Co., Ltd. Among them, the wild-type OsRNE gene sequence of ZH11 is shown in SEQ ID NO.1, and the amino acid sequence of OsRNE protein is shown in SEQ ID NO.2.

[0032] SEQ ID NO.1:

[0033]

[0034]

[0035]

[0036]

[0037] SEQ ID NO.2

[0038]

[0039] Example 1 Selection of CRISPR / Cas9 knockout targets

[0040] The OsRNE gene (LOC_Os08g23430) contains 14 exons and 13 introns. The CDS of the gene is 3258 bp in length and encodes 1085 amino acids ( Figure 1 A). To obtain a mutant with complete loss of OsRNE function, a suitable target site was designed on its first exon. The primer sequences are as follows:

[0041] Target: GACGCATGGATACCGGCGTG (SEQ ID NO.3) ( Figure 1 A)

[0042] The following oligonucleotides were synthesized by Nanjing Qingke Biotechnology Co., Ltd. for the targeting sequence: CR-OsRNE-F: 5'-TGTGTGACGCCGGTATCCATGCGTC-3' (SEQ ID NO. 4); CR-OsRNE-R: 5'-AAACGACGCATGGATACCGGCGTCA-3' (SEQ ID NO. 5).

[0043] The synthesized primer working solution with a concentration of 10 μM was mixed in the following proportions: 8 μL ddH2O + 1 μL CR-OsRNE-F + 1 μL CR-OsRNE-R, and annealed to obtain a double-stranded DNA fragment with a linker. The CRISPR / Cas9 editing vector (CRISPR / Cas9 was donated by Professor Zhang Hui of Shanghai Normal University, the article of the vector: Generation of new glutinous rice by CRISPR / Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties. Zhang J, Zhang H, Botella JR, Zhu JK) was digested with BsaI, and the linear vector fragment was recovered by agarose gel electrophoresis. The digested vector was connected to the double-stranded DNA with sticky ends formed by annealing and transformed into DH5α Escherichia coli, and the positive clones were identified and sequenced for verification.

[0044] The constructed OsRNE knockout vector was delivered to Wuhan Boyuan Biotechnology Co., Ltd. to transform the callus tissue of japonica rice Zhonghua 11 to obtain transgenic lines. The knockout mutants osrne-1 and osrne-2 were obtained through genotyping. The two lines had single base A and T insertions in the first exon of OsRNE, respectively ( Figure 1 B), resulting in frameshift translation of OsRNE and premature termination of protein. Compared with the wild-type Zhonghua11, the leaves of the homozygous mutant seedlings were white and gradually died in the seedling stage ( Figure 1 C, D). The above results indicate that knocking out the OsRNE gene by gene editing technology can produce a leaf albino lethal phenotype.

[0045] Example 2 Phenotypic Analysis of OsRNE Knockout Mutants

[0046] By measuring the content of photosynthetic pigments, it was found that the contents of chlorophyll a, chlorophyll b and carotenoids in the mutant osrne-1 were significantly lower than those in the wild type ( Figure 2 A). SDS-PAGE results showed that the RbcL protein content in the mutant seedlings was significantly reduced compared with the wild type ( Figure 2B). In addition, the rRNA of chloroplast ribosomal 23S and 16S subunits was almost undetectable in the mutant ( Figure 2 C,D).

[0047] To further clarify the changes in chloroplast morphology, transmission electron microscopy was used to observe the ultrastructure of wild-type and osrne-1 mutant chloroplasts. The wild-type chloroplasts were well developed and contained a large number of thylakoids. The thylakoid membrane structure could be clearly seen ( Figure 3 A, B), while the chloroplasts in the mutants were seriously changed and contained two types: one with very few thylakoid membranes ( Figure 3 C, D), and the other contains almost no thylakoids ( Figure 3 E, F). In summary, the chloroplast development is defective in the mutant osrne-1, resulting in abnormal thylakoid development, blocked photosynthetic pigment synthesis, and reduced rRNA content of 23S and 16S subunits.

[0048] Example 3 Analysis of tissue expression of OsRNE gene and subcellular localization of encoded protein

[0049] The expression pattern of OsRNE was analyzed using the website (https: / / bar.utoronto.ca / efprice / cgi-bin / efpWeb.cgi). The results showed that OsRNE showed a constitutive expression pattern, with a higher expression level in leaves ( Figure 4 A). We then designed and synthesized fluorescent quantitative primers qRT-OsRNE-F: 5'-TTGCCATGGTATTGGCCGTGTG-3' (SEQ ID NO.6) and qRT-OsRNE-R: 5'-GCAAGGCGTCGACAGATTTCAC-3' (SEQ ID NO.7). The RNA from various tissues of Zhonghua 11 and the endosperm at different stages after flowering was extracted using the Trizol method, and reverse transcribed into cDNA for qRT-PCR reaction. The results showed that the OsRNE gene was expressed in roots, stems, leaves, leaf sheaths and panicles, with the highest expression level in leaves ( Figure 4 B). Analysis of various tissues of seedlings at the three-leaf stage revealed that the highest expression level was found in the L3 leaf of the seedlings ( Figure 4 C). The above results indicate that OsRNE is mainly expressed in green tissue leaves of rice and is involved in leaf color regulation and chloroplast development.

[0050] In order to study the subcellular localization pattern of OsRNE protein, we constructed a truncated OsRNE-GFP fusion expression vector containing an N-terminal transit peptide, with primers SL-OsRNE-F: 5'-GGACTAGTATGGCCGCCCGCGCGCT-3' (SEQ ID NO.8) and SL-OsRNE-R: 5'-CGCGGATCCTTTCATCCACAGATCTTTC-3' (SEQ ID NO.9). OsRNE-GFP fusion protein was expressed using tobacco and rice protoplast transient expression systems, respectively. The expression of OsRNE-GFPP fusion protein was observed by laser confocal microscopy, and it was found that the green fluorescence signal overlapped with the chloroplast autofluorescence signal ( Figure 5 A, B). The above results indicate that OsRNE is localized in chloroplasts.

[0051] Example 4 Expression analysis of chlorophyll metabolism and chloroplast development genes in wild-type and mutant seedlings

[0052] To further investigate the effect of the OsRNE mutation on the expression of other genes related to chlorophyll biosynthesis and chloroplast development, we examined four chloroplast development genes (rpoA, rpoB, rpoC1, and rpoC2), seven photosynthesis-related genes (psaA1, psaA2, psbD1, atpA, atpB, rbcL, and RCA), and six chlorophyll biosynthesis genes (OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1, and OsPORA) by qRT-PCR analysis ( Figure 6 The expression levels of rpoA, rpoB, rpoC1, and rpoC2, which are involved in chloroplast development, were significantly increased in the mutant ( Figure 6 A), while the expression of photosynthesis-related genes, including nuclear-encoded genes (RCA) and plastid-encoded genes (psaA1, psaA2, psbD1, atpA, atpB, and rbcL), was significantly decreased in osrne-1 ( Figure 6 B). In addition, the transcription levels of chlorophyll biosynthesis genes (OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1, and OsPORA) were significantly reduced in the osrne-1 mutant ( Figure 6 C).

Claims

1. Application of OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, characterized in that: The nucleotide sequence of the OsRNE gene is shown in SEQ ID NO.1, or a mutant, allele or derivative thereof generated by inserting, substituting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.

1.

2. Application of the protein encoded by the OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, characterized in that: The amino acid sequence of the protein is as shown in SEQ ID NO. 2 or an amino acid sequence or derivative generated by inserting, substituting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown.

3. Use of a recombinant expression vector, expression cassette or recombinant bacteria containing an OsRNE gene in regulating rice leaf color and / or regulating chloroplast development, characterized in that: The nucleotide sequence of the OsRNE gene is shown in SEQ ID NO.1, or a mutant, allele or derivative thereof generated by inserting, substituting or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.

1.

4. The use according to any one of claims 1 to 3, characterized in that: The regulation method includes reducing or increasing the expression or activity of the protein encoded by the OsRNE gene.

5. The use according to claim 4, characterized in that: The method for reducing the expression or activity of the protein encoded by the OsRNE gene includes RNAi interference technology or gene knockout method.

6. An oligonucleotide, characterized in that The sequence of the oligonucleotide is shown in SEQ ID NO.

3.

7. A knockout vector, characterized in that The knockout vector is obtained by annealing the oligonucleotide designed primer pair according to claim 6 to obtain a double-stranded DNA fragment and connecting it to the vector.

8. A recombinant strain, characterized in that The recombinant strain is obtained by introducing the knockout vector described in claim 7 into a host bacterium.

9. Use of the oligonucleotide according to claim 6, the knockout vector according to claim 7, and the recombinant strain according to claim 8 in changing the color of rice leaves and / or reducing the chlorophyll content and / or improving chloroplast development.

10. The use according to claim 9, comprising increasing the expression levels of rpoA, rpoB, rpoC1 and rpoC2 and / or decreasing the expression levels of psaA1, psaA2, psbD1, atpA, atpB, rbcL, OsHEML, OsCHLH, OsCHLI, OsCRD1, OsCAO1 and / or OsPORA.

Images