Brassica campestris L. cold-resistant gene BrTIL1 and application thereof

Abstract

The invention belongs to the field of plant genetic engineering, and relates to a cold-resistant gene BrTIL1 of Brassica campestris and application of the cold-resistant gene BrTIL1 of Brassica campestris. The invention provides a cold-resistant gene BrTIL1 of Brassica campestris L. and application of the cold-resistant gene BrTIL1. The cold-resistant gene BrTIL1 can solve the problem of molecular mechanism of response of Brassica campestris L. to low-temperature stress and can be used for cultivating new cold-resistant

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, relates to a cold-resistant gene and an application thereof, and in particular to a Brassica rapa-type winter rapeseed cold-resistant gene BrTIL1 and an application thereof. Background Art

[0002] Rapeseed is one of the four major oil crops in my country, and its production is of great significance to the sustainable supply of edible oil in my country. The northern region of my country is cold in winter and dry in spring, the ecological conditions are harsh, farmland is seriously degraded by wind erosion, and the area of ​​land desertification is expanding. As the only main oil crop grown in winter, winter rapeseed can not only improve the economic benefits in the north, but also serve as a good winter cover crop, effectively increasing the vegetation coverage of farmland in winter and spring, improving the multiple cropping index and land utilization rate, increasing the organic matter content, conserving farmland, and promoting the balanced development of local economic production and ecological environment protection. Low temperature stress is one of the key natural factors affecting the growth and development of winter rapeseed of the cabbage type, which can cause changes in its physiological functions and limit crop productivity. Therefore, improving the cold resistance of winter rapeseed and studying the cold resistance mechanism of related cold resistance genes will help ensure the safe wintering of winter rapeseed, avoid damage caused by low temperature stress, and thus improve productivity and yield.

[0003] When plants are exposed to adversity, they will trigger a series of physiological and biochemical reactions, inducing the expression of a large number of stress proteins in the process to resist environmental changes such as low temperature. Lipocalin is a type of extracellular protein widely present in plants, which has very important functions, such as regulating cell growth, metabolism, binding to cell surface receptors, and responding to environmental changes. Temperature-induced lipocalin (TIL) is one of the types of plant lipocalin. TIL plays an important regulatory and signal transduction role in plant resistance to adversity. Based on the transcriptome expression data of winter rapeseed of Brassica rapa, the differentially expressed temperature response factor BrTIL1 was screened and obtained. By analyzing the functional information of BrTIL1, it provides important application value for further revealing the regulatory mechanism of TIL1 under cold stress of winter rapeseed of Brassica rapa and cultivating cold-resistant winter rapeseed varieties. Summary of the invention

[0004] In order to solve the above technical problems existing in the background technology, the present invention provides a Brassica rapa winter rapeseed cold-resistant gene BrTIL1 and its application which can solve the molecular mechanism problem of Brassica rapa winter rapeseed response to low temperature stress and can cultivate new cold-resistant varieties (lines).

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] A Brassica rapa winter oilseed rape cold-resistant gene BrTIL1, characterized in that the nucleotide sequence of the Brassica rapa winter oilseed rape cold-resistant gene BrTIL1 is as shown in SEQ ID NO.1.

[0007] The amino acid sequence encoded by the above-mentioned Brassica rapa winter rapeseed cold-resistant gene BrTIL1 is shown in SEQ ID NO.2.

[0008] The biological material containing the above-mentioned Brassica rapa winter rapeseed cold-resistant gene BrTIL1 is characterized in that the biological material is an expression cassette, an expression vector, a cloning vector or an engineered bacterium.

[0009] A primer for amplifying the aforementioned Brassica rapa winter rape cold-resistant gene BrTIL1, characterized in that: the primer comprises BrTIL1 F and BrTIL1 R, the sequence of the BrTIL1 F is shown in SEQ ID NO.3; the sequence of the BrTIL1R is shown in SEQ ID NO.4.

[0010] As previously described, the application of the Brassica rapa type winter rapeseed cold-resistant gene BrTIL1 in improving plant cold resistance or in breeding cold-resistant plant varieties.

[0011] As previously recorded, the application of the Brassica rapa type winter rapeseed cold-resistant gene BrTIL1 in improving the cold resistance of rapeseed or in breeding cold-resistant rapeseed varieties.

[0012] As previously described, the application of the Brassica rapa type winter rapeseed cold-resistant gene BrTIL1 in improving the cold-resistant property of Brassica rapa type winter rapeseed or in breeding cold-resistant varieties of Brassica rapa type winter rapeseed.

[0013] As previously recorded, the BrTIL1 cold-resistant gene of Brassica rapa is used to increase the antioxidant enzyme activity and soluble protein content in Brassica rapa winter rapeseed under low temperature stress.

[0014] The seeds of the new plant variety are prepared by the application as described above.

[0015] The cold-resistant seeds of winter rapeseed of Brassica rapa type are prepared by the application as described above.

[0016] The beneficial effects of the present invention are:

[0017] The present invention discloses a cabbage-type winter rape cold-resistant gene BrTIL1 and its application, wherein the nucleotide sequence is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2. The present invention performs low-temperature treatment on cabbage-type winter rape varieties with different cold resistance, extracts RNA for high-throughput transcriptome sequencing analysis, obtains differential gene sequences, screens and identifies the key gene BrTIL1 closely related to cold stress response, and at the same time, amplifies the gene using the BrTIL1 gene sequence information, constructs an overexpression vector, obtains transgenic Arabidopsis plants by the flower dipping method, and significantly enhances its cold resistance under low temperature conditions. The present invention provides a new gene resource for solving the response mechanism of cabbage-type winter rape to low temperature stress and cultivating new cold-resistant varieties (lines). The BrTIL1 gene provided by the present invention has important application value in improving the stress resistance of plants, and provides an important basis for research on improving the cold resistance of cabbage-type winter rape. It is of great significance to cultivate new cold-resistant varieties for plants, thereby increasing crop yields, and the present invention will have broad application space and market prospects in the field of agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is an agarose gel electrophoresis diagram of the BrTIL1 gene cloned in the present invention;

[0019] Figure 2 The invention is to screen the inbred Arabidopsis plants carrying the BrTIL1 gene;

[0020] Figure 3 The phenotype of Arabidopsis thaliana seedlings transferred with the BrTIL1 gene under low temperature treatment according to the present invention;

[0021] Figure 4 The present invention shows the changes in physiological indicators of wild-type and BrTIL1 gene-transfected Arabidopsis thaliana under low temperature stress. DETAILED DESCRIPTION

[0022] The technical scheme in the embodiments of the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. The experimental methods and reagents in the following embodiments are conventional methods and reagents unless otherwise specified.

[0023] Preparation of LB low-salt medium (1 L): 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, dilute to 1 L, add 15 g of agar to the solid medium, and sterilize at 121°C for 20 min.

[0024] Preparation of LB normal salt medium: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, dilute to 1 L, add 15 g of agar to the solid medium, and sterilize at 121°C for 20 min.

[0025] Preparation of 1 / 2MS medium (1L): 2.37g 1 / 2MS powder, 10g sucrose, pH 5.8, dilute to 1L, 8g agar powder, high temperature sterilization at 121℃ for 20min.

[0026] Example 1: Cloning of the Brassica rapa winter rape cold resistance gene BrTIL1 and construction of an overexpression vector

[0027] 1. Primers were designed based on the coding region sequence of the BrTIL1 gene of Brassica rapa, and the cDNA of Brassica rapa winter rape Longyou 7 was used as a template. Primers were designed using Primer Premier 5.0 and added Technology Version E vector adapter, and the primers were purified by PAGE. The primers were synthesized by Shanghai Shenggong Biological Co., Ltd. The designed primers are:

[0028] BrTIL1 F:AAAAAAGCAGGCTTCATGACGTCGACGGAGATGAAAGCT

[0029] BrTIL1 R: AGAAAGCTGGGTCCTTGCCGAAGATAGACTTTAGCC

[0030] 2. Refer to the instructions of the manufacturers of PrimeSTAR (R010A, TaKaRa, Dalian) and Gateway technology (Enzyme Mix, Carlsbad, USA) for amplification. Two rounds of PCR amplification are required to merge the aatB site into the upstream and downstream primers. In the first round, the upstream and downstream primers of the designed target gene are used, and the second round primers are replaced with aatB1 / B2 template as the first round PCR product.

[0031] in:

[0032] attB1:GGGGACAAGTTTGTACAAAAAAGCAGGCT

[0033] attB2:GGGGACCACTTTGTACAAGAAAGCTGGGT

[0034] The first round of PCR amplification reaction system:

[0035]

[0036]

[0037] PCR reaction program: 98℃ for 2min, 98℃ for 10sec, 60℃ for 5sec, 72℃ for 30sec, for a total of 30 cycles, extension at 72℃ for 7min, 12℃, Forever.

[0038] After the first round of PCR, 5 μl of the product was taken out for 0.1% agarose gel electrophoresis to check the bands, and then the second round was continued.

[0039] Second round PCR reaction system:

[0040]

[0041] Second round PCR reaction procedure:

[0042]

[0043] After two rounds of PCR, the amplified products were tested by electrophoresis (1%). Figure 1 As shown, in Figure 1 In the figure, M is a molecular weight standard, DL5000 Marker; Lane 1 and Lane 2 are BrTIL1 gene PCR products, respectively. Subsequently, a gel recovery kit (DP209, Tiangen Biochemical Technology Co., Ltd., Beijing) was used to recover the target fragment. The specific method is as shown in the instructions of the gel recovery kit (DP209, Tiangen Biochemical Technology Co., Ltd., Beijing):

[0044] (1) Add 500 μL of balancing solution BL to the adsorption column CA2, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the waste liquid. (2) Cut the target DNA band from the agarose gel and place it in a centrifuge tube and weigh it. (3) Add an equal volume of solution PN to the gel block and place it in a 50°C water bath, gently turning it over during the process to ensure that the gel block is dissolved. (4) Add the resulting solution to the adsorption column CA2, place it at room temperature for 2 min, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the waste liquid. (5) Add 600 μL of rinse solution PW to the adsorption column, centrifuge at 12,000 rpm for 1 min at room temperature, discard the waste liquid, and repeat the operation once. (6) Centrifuge at 12,000 rpm for 2 min at room temperature to remove as much rinse solution as possible, place the adsorption column CA2 at room temperature for several minutes, and dry it thoroughly. (7) Place the adsorption column CA2 in a clean centrifuge tube and drop an appropriate amount of sterilized ddH2O in the middle of the adsorption membrane. 2 O, place at room temperature for 2 min, and centrifuge at 12000 rpm for 2 min to collect the DNA solution.

[0045] 3. BP reaction

[0046] The target fragment obtained by gel recovery was connected with the entry vector pDONR. The connection reaction system was: BPⅡClonase: 0.5μL, gel recovery product: 1.5μL, pDONR: 0.5μL, and the total volume was 2.5μL. After the system was mixed, it was reacted in a 25℃ metal bath overnight. The reaction should not exceed 18h, and the transformation plate should be transformed at least 4h later. The next day, the connection product was transformed into E. coli DH5α competent cells. Add 2.5 μL of ligation product to 50 μL of DH5α competent cells, gently pipette to mix, place on ice for 30 min, heat shock at 42°C for 90 sec, and place on ice for 5 min. Add 400 μL of LB low-salt liquid medium without Zeo to the clean bench, shake on a shaker at 37°C for 1 h, take 100 μL of bacterial solution and spread it on LB low-salt solid medium containing bleomycin Zeo, culture overnight at 37°C, pick a single colony the next day for colony PCR detection, and the colony PCR detection reaction system is: 2×Tap plusmaster Mix 5 μL, ddH 2 O 3μL, bacterial solution 1μL, primers 0.5μL each of BrTIL1 F / R in Example 1; reaction program: 94℃4min, 94℃30sec, 60℃30sec, 72℃30sec, 35 cycles, 72℃10min, 4℃Forever. The single colony with the correct length of the electrophoresis detection band was re-added to the LB liquid culture medium and shaken well, and then sent to the company for sequencing. The PCR determination sequence is shown in SEQ ID NO.1, and the gene sequence length is 414bp. The amino acid sequence of the protein encoded by the cold-resistant gene BrTIL1 of Brassica rapa is shown in SEQ ID NO.2, which consists of 137 amino acids.

[0047] 4. Extract plasmid from bacterial solution with correct sequencing results according to the instructions of plasmid extraction kit (DP103, Tiangen Biochemical Technology Co., Ltd., Beijing). The specific method is as follows:

[0048] (1) Add 500 μL of balancing solution BL to the adsorption column CP3, centrifuge at 12000 rpm for 1 min at room temperature, and discard the waste liquid in the collection tube. (2) Take 6 mL of overnight cultured bacterial solution and add it to a 2 mL centrifuge tube. Centrifuge at 12000 rpm for 1 min at room temperature and remove the supernatant as much as possible. (3) Add 250 μL of solution P1 to the centrifuge tube with bacterial precipitate and vortex to thoroughly suspend the bacterial precipitate. (4) Add 250 μL of solution P2 and gently turn it upside down 8 times to fully lyse the bacteria. (5) Add 350 μL of solution P3 and immediately turn it upside down 8 times to mix thoroughly. A white flocculent precipitate appears and centrifuge at 12000 rpm for 10 min at room temperature. (6) Transfer the supernatant collected in the previous step to the adsorption column CP3 and centrifuge at 12000 rpm for 1 min at room temperature. Discard the waste liquid in the collection tube and place the adsorption column CP3 in the collection tube. (7) Add 600 μL of rinse solution PW to the adsorption column CP3, centrifuge at 12000 rpm for 1 min at room temperature, discard the waste solution, and repeat once. (8) Centrifuge at 12000 rpm for 2 min at room temperature to remove the remaining rinse solution, open the adsorption column CP3 and place it at room temperature for several minutes. (9) Place the adsorption column CP3 in a clean centrifuge tube and drop 75 μL of sterilized ddH2O into the middle of the adsorption membrane. 2 O, place at room temperature for 2 min, centrifuge at 12000 rpm for 2 min to obtain BP plasmid, collect the BP plasmid into a centrifuge tube for later use.

[0049] 5.LR reaction

[0050] Plant overexpression vector (pEarlyGate101): 1.5 μL, BP plasmid: 0.5 μL, LRIIClonase: 0.5 μL, total system 2.5 μL, after ligation, place in a metal bath at 25°C overnight, the reaction should not exceed 18 hours, and the transformation plate should be taken at least 4 hours later. Add 2.5 μL of LR reaction product to 50 μL of DH5α competent cells, gently pipette to mix, place on ice for 30 min, heat shock at 42°C for 90 sec, and stand on ice for 5 min. Add 400 μL of LB liquid culture medium without kanamycin Kan to the clean bench, shake on a shaker at 37°C for 1 h, spread 100 μl of bacterial solution on LB solid culture medium containing Kan, and culture overnight at 37°C. Pick a single colony the next day for colony PCR detection, add the single colony with the correct band length back to the LB liquid culture medium, shake well, and use a plasmid extraction kit to extract the recombinant plasmid to obtain the recombinant expression vector plasmid pEarlyGate101-BrTIL1.

[0051] Example 2: Transformation of Agrobacterium with recombinant plasmid

[0052] (1) Take the prepared Agrobacterium competent cells GV3101 and place them on ice to thaw. (2) Take 4 μL of the recombinant expression vector plasmid pEarlyGate101-BrTIL1 and add it to 50 μL of Agrobacterium competent cells, ice bath for 5 minutes, liquid nitrogen for 5 minutes, 37°C water bath for 5 minutes, and ice bath for 5 minutes. (3) Add 700 μL of antibiotic-free LB liquid culture medium to the clean bench and culture on a shaker at 28°C for 1 hour. (4) Take out the bacterial solution, centrifuge at 12000 rpm at room temperature for 1 minute, keep a small amount of supernatant, beat the bacterial solution with a pipette tip to mix it, and then spread it on the LB solid culture medium containing rifampicin Rif and kanamycin Kan, and culture it upside down at 28°C for 2 days. Take a single colony for colony PCR identification.

[0053] Example 3: Construction of BrTIL1 gene-transfected Arabidopsis

[0054] (1) Preparation of infection solution: A single Agrobacterium colony obtained in Example 2 was picked up and placed in LB liquid medium containing rifampicin Rif and kanamycin Kan, and cultured overnight at 28°C and 220 rpm in a shaking incubator until the OD of the Agrobacterium solution reached 0.1. 600 =1.2-1.6; activate the Agrobacterium culture in the 2mL collection tube, expand the culture to 50mL in LB medium, centrifuge at 6000rpm for 5min, and evenly suspend with 5% sucrose solution. 600 After the value is adjusted to 0.8, 3 / 10000 of surfactant (Silwet L-77) is added for use.

[0055] (2) Select Arabidopsis with strong growth, cut off the blooming flowers and mature siliques before infection, immerse the entire inflorescence in a culture dish containing bacterial solution for 1 minute, take out and wipe off the excess bacterial solution, culture in the dark at 25°C for 24 hours, and then continue to culture in the light. Infect again after one week, and infect 3 times in total. After the Arabidopsis matures, collect seeds from each plant. The harvested Arabidopsis seeds from each plant are placed in a 4°C incubator for vernalization for 3 days, disinfected and sterilized with 75% anhydrous ethanol and 15% sodium hypochlorite, and then sown in 1 / 2MS medium containing the herbicide Basta (1 / 10000) to select resistant seedlings (the plants that can survive are positive seedlings), and transplanted for culture. After the seedlings grow up, cut the leaves of the Arabidopsis plants, use a DNA extraction kit to extract Arabidopsis leaf DNA, perform PCR detection, and harvest seeds from mature Arabidopsis plants. After the Arabidopsis seeds harvested from a single plant were vernalized, they were planted in 1 / 2MS medium containing Basta to select homozygous transgenic Arabidopsis plants, and homozygous transgenic Arabidopsis plants with the BrTIL1 gene were obtained. Figure 2 As shown, in Figure 2 In the figure, A is the T1 generation herbicide Basta spraying screening; B is the T2 generation positive plant screening; C is the T3 generation homozygous screening.

[0056] Example 4: Identification of cold resistance of transgenic BrTIL1 Arabidopsis

[0057] After the homozygous plants of the transgenic BrTIL1 gene Arabidopsis obtained in Example 3 and the wild-type Arabidopsis were cultured and grown for one month, they were placed in a -4°C low-temperature incubator for 3h, 6h, 12h, and 24h, respectively, and then continued to be cultured at room temperature. The seedling growth characteristics were observed after one week, and the survival rate of Arabidopsis was counted. The transgenic Arabidopsis and wild-type Arabidopsis after low-temperature treatment were subjected to cold-resistant related antioxidant enzymes (superoxide dismutase SOD, peroxidase POD, catalase CAT) and regulatory substances soluble protein SP content were determined. Among them, the superoxide dismutase SOD activity was determined by nitroblue tetrazolium (NBT) photoreduction method, the peroxidase POD activity was determined by guaiacol method, the catalase CAT activity was determined by ultraviolet absorption method, and the soluble protein SP was determined by Coomassie brilliant blue method.

[0058] The results show:

[0059] (1) Under -4℃ low temperature treatment conditions, both wild-type plants and overexpression plants showed signs of yellowing leaves 12 hours after low temperature treatment, and WT plants died 24 hours after low temperature treatment, while overexpression plants had some yellowing leaves and some survived 24 hours after low temperature treatment. Figure 3 shown.

[0060] (2) Under normal conditions, the enzyme activities (SOD, POD, CAT) and soluble protein content SP of wild-type and transgenic Arabidopsis plants were similar, with no significant difference. After 3 hours of low-temperature treatment at -4°C, the activity of SOD, POD, CAT and the content of soluble protein in the Arabidopsis strains all showed an increasing trend. As time went on, the activities of the three enzymes in the transgenic strains were higher than those in the wild-type, and the soluble protein content was also significantly different from that in the wild-type. After 24 hours of low-temperature treatment, the activities of the three enzymes SOD, POD and CAT and the content of soluble protein SP all reached their maximum values. The results are shown in Table 1. Figure 4 As shown, in Figure 4 In the figure, A is the superoxide dismutase activity of Arabidopsis thaliana; B is the peroxidase activity of Arabidopsis thaliana; C is the catalase activity of Arabidopsis thaliana; and D is the soluble protein content of Arabidopsis thaliana.

[0061] Therefore, it can be concluded that under low temperature stress, the antioxidant enzyme activity and soluble protein content in the transgenic BrTIL1 gene Arabidopsis increased, and the low temperature tolerance of Arabidopsis plants was improved, indicating that the BrTIL1 gene is involved in the plant's response to low temperature stress and can be used in the breeding of cold resistance in other crops.

Claims

1. A Brassica rapa winter rape cold resistance gene BrTIL1, characterized in that: The nucleotide sequence of the Brassica rapa winter rapeseed cold-resistant gene BrTIL1 is shown in SEQ ID NO.

1.

2. The cold-resistant gene BrTIL1 of winter rapeseed of Brassica rapa according to claim 2, characterized in that: The amino acid sequence encoded by the Brassica rapa winter rapeseed cold-resistant gene BrTIL1 is shown in SEQ ID NO.

2.

3. The biological material containing the Brassica rapa winter rape cold-resistant gene BrTIL1 as claimed in claim 1 or 2, characterized in that: The biological material is an expression cassette, an expression vector, a cloning vector or an engineering bacterium.

4. A primer for amplifying the cold-resistant gene BrTIL1 of winter rapeseed of Brassica rapa according to claim 1 or 2, characterized in that: The primers include BrTIL1 F and BrTIL1 R, the sequence of the BrTIL1 F is shown in SEQ ID NO.3; the sequence of the BrTIL1 R is shown in SEQ ID NO.

4.

5. Use of the Brassica rapa winter rape cold-resistant gene BrTIL1 as claimed in claim 1 or 2 in improving plant cold resistance or in breeding cold-resistant plant varieties.

6. Use of the Brassica rapa winter rape cold-resistant gene BrTIL1 as claimed in claim 5 in improving the cold resistance of rapeseed or in breeding cold-resistant rapeseed varieties.

7. Use of the Brassica rapa winter oilseed rape cold-resistant gene BrTIL1 as claimed in claim 6 in improving the cold resistance of Brassica rapa winter oilseed rape or in breeding cold-resistant varieties of Brassica rapa winter oilseed rape.

8. Use of the cold-resistant gene BrTIL1 of winter rapeseed of Brassica rapa as claimed in claim 7 for increasing the antioxidant enzyme activity and soluble protein content in winter rapeseed of Brassica rapa under low temperature stress.

9. The seeds of a new plant variety prepared by the use as claimed in any one of claims 5 to 8.

10. Cold-resistant seeds of winter rapeseed of Brassica rapa type prepared by the use according to any one of claims 5 to 8.

Images