Rice OsALA4 gene as well as encoding protein and application thereof

Abstract

The invention discloses a rice OsALA4 gene as well as an encoding protein and application thereof, and belongs to the technical field of gene engineering. A seedling-stage low-temperature-resistant gene OsALA4 is cloned in rice in a positioned manner, knockout experiments prove that the low-temperature-resistant capability of the rice is remarkably reduced after the gene loses functions, and the low-temperature-resistant capability of a plant is remarkably increased after the gene is over-expressed, so that the OsALA4 gene has a positive regulation effect on the low-temperature resistance of the rice in the seedling stage. Therefore, the invention provides an important genetic resource for breeding of low-temperature-resistant varieties of rice.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a rice OsALA4 Genes, their encoded proteins and their applications. Background Art

[0002] Rice cold tolerance is a complex quantitative trait controlled by multiple genes. Due to the limitations of phenotypic identification for evaluating cold tolerance, the cold tolerance genes that have been located are still very limited. Among them, G protein signal regulator COLD1 (Ma et al., 2015), cytochrome P450 family monooxygenase HAN1 (Mao et al., 2019), and transcription factor bZIP73 (Liu et al., 2018) control the cold tolerance of rice vegetative growth, and all have a positive regulatory effect on rice cold tolerance. As an important food crop, rice is negatively affected by low temperature at multiple stages throughout its growth cycle, thus threatening the final yield and quality. Among them, encountering low temperature during the seedling stage directly leads to the inability of rice to grow and develop normally, causing seedlings to wither or baldness and shriveled grains during heading, which seriously reduces rice yield. Therefore, cloning genes related to cold tolerance in rice seedlings and analyzing their functions can provide important genetic resources for breeding rice cold-tolerant varieties. Summary of the invention

[0003] In order to solve the above-mentioned deficiencies in the prior art, the present invention aims to provide a rice OsALA4 Gene and its encoded protein and application, to provide a new gene that can regulate rice's low temperature tolerance.

[0004] The technical solution of the present invention to solve the above technical problems is as follows: a rice OsALA4 Gene, OsALA4 The nucleotide sequence of the gene coding region is shown in SEQ ID NO.1.

[0005] further, OsALA4 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0006] The present invention provides a OsALA4 Application of genes in regulating low temperature tolerance in rice.

[0007] Furthermore, regulating the low temperature tolerance of rice is a knockout rice OsALA4 The gene-modified rice has reduced its tolerance to low temperatures.

[0008] Further regulation of rice cold tolerance by overexpressing rice OsALA4 The gene-modified rice has enhanced its tolerance to low temperatures.

[0009] The present invention provides a preparation for enhancing the low temperature resistance of rice. OsALA4 Gene or above OsALA4 Protein encoded by a gene.

[0010] The present invention also provides a method for preparing a low-temperature resistant rice variety by overexpressing the rice OsALA4 Genes are used to produce cold-tolerant rice varieties.

[0011] The present invention has the following beneficial effects: the present invention locates and clones a low temperature tolerance gene in rice seedling stage OsALA4 The knockout experiment showed that the rice's ability to tolerate low temperatures decreased significantly after the gene lost its function, while the plant's ability to tolerate low temperatures increased significantly after the gene was overexpressed, proving that OsALA4 The gene has a positive regulatory effect on the low temperature resistance of rice seedlings. Therefore, the present invention provides important genetic resources for the breeding of low temperature resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a schematic diagram of the CRISPR / Cas9 vector of the rice OsALA4 gene in Example 1 of the present invention; Figure 2 The OsALA4 gene knockout target site and plant phenotype diagram in Example 1 of the present invention; Figure 3 This is a schematic diagram of the OsALA4 overexpression vector in Example 2 of the present invention; Figure 4 This is a phenotype diagram of the OsALA4 overexpressing plant in Example 2 of the present invention; Figure 5 This is the OsALA4 gene expression profile analysis in Example 3 of the present invention. DETAILED DESCRIPTION

[0013] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0014] Embodiment 1: OsALA4 Gene editing vector construction and transformation Rice OsALA4 The gene coding region and protein sequence were obtained from Rice Resource Center ( http: / / ricerc.sicau.edu.cn ), the coding region gene sequence is shown in SEQ ID NO.1, OsALA4 The protein sequence encoded by the gene is shown in SEQ ID NO.2.

[0015] The gRNA sequence of the target site for gene editing was selected using an online target site design tool (http: / / skl.scau.edu.cn / ), and the gRNA sequence was recombined into the pYLCRISPR / Cas9 P35s-N vector with plant resistance to G418 (see Figure 1 ), the specific operation methods refer to (Liu et al., Current Protocols in Molecular Biology, 2016), the gene editing vector transformation recipient material is japonica rice Nip, Agrobacterium transformation and transgenic experiments were completed by Wuhan Boyuan Company.

[0016] After extracting DNA from the transgenic plants using the CTAB method, amplification primers across the target sites were designed. After amplification, the target sequences in each individual plant were sent to a sequencing company for sequencing. The results are as follows: Figure 2 As shown in A, the obtained sequences were compared and analyzed by DNAMAN7 software, showing that a total of 1 transgenic plant with premature termination of protein translation and 1 plant with frameshift mutation of protein translation were obtained. The sequences of the amplification primers are as follows: F1-primer: AGCAGGATCGGCGGGCCGG (SEQ ID NO.3); R1-primer: CCTAGTCCTACTGGAGTGAGGA (SEQ ID NO. 4).

[0017] Embodiment 2: OsALA4 Phenotypic observation of gene knockout plants The two harvested T0 generations OsALA4 The knockout strains were planted to the T1 generation, and the seeds of the stable transgenic strains were harvested and treated for low temperature resistance at the seedling stage. The wild-type and mutant seeds were placed in a 96-well PCR plate after whitening and cultured in Hoagland's complete nutrient solution (Coolaber, Cat#NS1040, pH 5.8) for 14 days (28°C, 12 / 12 hours of light). Then, they were treated with low temperature in a plant light incubator (4°C, 12 / 12 hours of light). The results are shown in the figure. Figure 2 As shown in B-2D, the survival rate of knockout plants at low temperature during the seedling stage was significantly lower than that of the wild type, indicating OsALA4 Participates in regulating rice's low temperature tolerance.

[0018] Embodiment 3: OsALA4 Gene overexpression vector construction and transformation The vector used for overexpression was PC2300 (see Figure 3), designed specific amplification primers (F2-primer and R2-primer), amplified from Nip's cDNA, selected Sma1 and Xba1 as restriction sites, and connected the fragment and vector using CEII single-fragment recombinase from Novizan. The constructed overexpression vector was used as the recipient material for transformation of Nip, and Agrobacterium transformation and transgenic experiments were completed by Wuhan Boyuan Company.

[0019] After DNA was extracted from the T0 generation of overexpressing plants, primers (F3-primer and R3-primer) were used to detect the insertion of fragments. Subsequently, RNA was further extracted from the positive plants detected, and the quantitative primers of OsALA4 (F4-primer and R4-primer) were used to detect the expression level of the OsALA4 gene. The internal reference primers used UBQ5 (UBQ5-F and UBQ5-R), and 3 high-expressing strains were retained and propagated to the T1 generation stable strains (see Figures 4C-4D). The primer sequences are as follows: F2-primer: ggagaggacagggtacccgggATGAGGCTGAGCAGGCTGTACAG (SEQ ID NO.5); R2-primer: ggtactagtgtcgactctagaGGTAGATGTGGTTTGTGAATGTG (SEQ ID NO.6); F3-primer:ATGAGGCTGAGCAGGCTGTACAG (SEQ ID NO.7); R3-primer: GGTAGATGTGGTTTGTGAATGTG (SEQ ID NO.8); F4-primer: CAGCAGGATACCGAGGTAAACAA (SEQ ID NO.9); R4-primer: GAGGATTAGGTCAGCAGGGAAAA (SEQ ID NO.10); UBQ5-F:ACCTTCATGGCCAACCACTT (SEQ ID NO.11); UBQ5-R: CTAAGCCTGCTGGTTGTAGA (SEQ ID NO. 12).

[0020] Embodiment 4: OsALA4 Phenotypic observation of gene overexpression plants The three OsALA4 overexpression lines harvested from the T0 generation were planted into the seeds of the stable transgenic lines harvested from the T1 generation, and the seeds were treated for low temperature tolerance at the seedling stage. The wild-type and mutant seeds were placed in a 96-well PCR plate after whitening and cultured in Hoagland's complete nutrient solution (Coolaber, Cat#NS1040, pH 5.8) for 14 days (28°C, 12 / 12 hours of light). They were then treated with low temperature in a plant light incubator (4°C, 12 / 12 hours of light). The results are shown in the figure. Figure 4 As shown in A-4B, the survival rates of the three overexpression plants at low temperature at the seedling stage were significantly higher than those of the wild type, indicating that OsALA4 positively regulates rice tolerance to low temperature.

[0021] Embodiment 5: OsALA4 Gene expression profiling Different tissue samples of rice at different developmental stages were collected in the field, placed in 2 mL RNase-free centrifuge tubes, quickly frozen in liquid nitrogen, and stored at -80°C. Total RNA was extracted according to the instructions of the PlantTotal RNA Isolation Kit of Chengdu Fuji Biotechnology Co., Ltd. The synthesis operation was performed with reference to the instructions of the RTEasyTM II (With gDNase) kit of Chengdu Fuji Biotechnology Co., Ltd. The obtained cDNA product was diluted 3 times by adding 40 μL RNase-free ddH2O and stored at -20°C. OsALA4 Quantitative primers (F5-primer and R5-primer) detection OsALA4 Gene expression levels were detected by real-time quantitative system using UBQ5 (UBQ5-F2 and UBQ5-R2) as internal reference primers. OsALA4 The relative expression of genes. Figure 5 As shown, OsALA4 It is expressed throughout the entire growth period of rice, and is significantly highly expressed during leaf development. The primer sequences are as follows: F5-primer: CAGCAGGATACCGAGGTAAACAA (SEQ ID NO. 13); R5-primer: GAGGATTAGGTCAGCAGGGAAAA (SEQ ID NO. 14); UBQ5-F2:ACCTTCATGGCCAACCACTT (SEQ ID NO.15); UBQ5-R2: CTAAGCCTGCTGGTTGTAGA (SEQ ID NO. 16).

[0022] In the present invention OsALA4The coding region sequence and protein sequence of the gene are shown below: (1) Coding region sequence: (2) Protein sequence:

[0023] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A kind of rice OsALA4 A gene characterized by Said OsALA4 The nucleotide sequence of the gene coding region is shown in SEQ ID NO.

1.

2. according to claim 1 OsALA4 A gene characterized by Said OsALA4 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. The method according to any one of claims 1 to 2 OsALA4 Application of genes in regulating low temperature tolerance in rice.

4. The use according to claim 3, characterized in that: The rice cold tolerance regulation is knockout rice OsALA4 The gene reduces the rice's tolerance to low temperatures.

5. The use according to claim 3, characterized in that: The method for regulating the low temperature resistance of rice is to overexpress rice OsALA4 The gene-modified rice has enhanced its tolerance to low temperatures.

6. A preparation for enhancing the low temperature tolerance of rice, characterized in that: The preparation comprises the OsALA4 The gene or the one according to claim 2 OsALA4 Protein encoded by a gene.

7. A method for preparing a low temperature resistant rice variety, characterized in that: By overexpressing rice OsALA4 Genes to produce cold-tolerant rice varieties.

Images