DNA molecular cloning method based on GgeAgo and application of DNA molecular cloning method

Abstract

The invention belongs to the technical field of biology, and particularly discloses a DNA molecular cloning method based on GgeAgo and application of the DNA molecular cloning method. The method comprises the following steps: shearing a vector plasmid by a cleavage system; mixing a vector plasmid cleavage product with an exogenous fragment with a homologous region, assembling by adopting a recombination-based cloning method, and transforming escherichia coli to generate a recombinant plasmid. The cutting system comprises a guide nucleic acid molecule and a programmable endonuclease GgeAgo or / and a mutant thereof, the GgeAgo cuts plasmids under the guide of the guide nucleic acid molecule to linearize the plasmids, a to-be-inserted exogenous fragment with a homologous region is added, and after escherichia coli is transformed, the exogenous fragment is efficiently and accurately inserted into the target plasmids. The molecular cloning method provided by the invention is high in efficiency, short in time and simple and convenient to operate, and mutation caused by PCR is effectively reduced. The molecular cloning method provided by the invention provides a new thought for an Ago-based molecular cloning technology and a DNA synthesis and assembly technology.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a DNA molecule cloning method based on GgeAgo and an application thereof. Background Art

[0002] Molecular cloning technology plays an important role in various fields such as genetic engineering, clinical diagnosis, animal husbandry, etc. At present, this technology mainly relies on some restriction enzymes derived from bacteria that recognize specific DNA sequences and cut DNA at or near the recognition site, but most of them only recognize short DNA sequences (4-8 base pairs), which greatly limits their application in recombinant DNA technology.

[0003] Prokaryotic Argonaute proteins (pAgos) are a class of nucleases that can be guided by a variety of nucleic acids. They show a high degree of diversity in guide and target specificity. Compared with most other nucleases, they have advantages such as high specificity, no target sequence restrictions, and low reaction costs. These characteristics have given researchers the idea of ​​using pAgos as a molecular cloning tool. Our early studies on Ago from thermophilic prokaryotes have shown that some pAgos can not only specifically cut ssDNA targets under the guidance of gDNA, but can also cut dsDNA in vitro and produce dsDNA breaks under the guidance of a pair of complementary gDNAs. This activity enables pAgo to be used as a universal restriction endonuclease for in vitro molecular cloning.

[0004] In recent years, molecular cloning technology has made great progress, but it still faces challenges in cloning efficiency, cost control, GC content, etc. Therefore, the application of novel prokaryotic Argonaute nucleases with excellent properties in molecular cloning can help solve the above problems and is of great significance for promoting the development of synthetic biology. Summary of the invention

[0005] The purpose of the present invention is to address the above-mentioned shortcomings of existing nucleic acid detection technology and provide a DNA molecular cloning method based on the nuclease GgeAgo and its application. The method mainly combines the reaction system of Ago nuclease shearing plasmid or dsDNA with a recombination-based cloning assembly method (such as T5 cloning) to achieve various types of molecular cloning.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention is to provide a DNA molecular cloning method based on GgeAgo, comprising the following steps:

[0008] S1. The vector plasmid is sheared by a cutting system; the cutting system comprises:

[0009] (a) Guide nucleic acid molecule: gDNA;

[0010] (b) a programmable endonuclease GgeAgo or / and a mutant thereof, wherein the programmable endonuclease GgeAgo is derived from a thermophilic bacterium, and its amino acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the mutant of GgeAgo has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO.1;

[0011] (c) optionally a plasmid or dsDNA target;

[0012] (d) reaction buffer;

[0013] S2, the vector plasmid cutting products are mixed with the exogenous fragments with homologous regions and assembled using a recombination-based cloning method;

[0014] S3. The mixed solution obtained in step S2 is transformed into Escherichia coli to generate a recombinant plasmid.

[0015] Furthermore, the homologous region is 15-45 bp in length.

[0016] Preferably, the homologous region is 18-20 bp in length.

[0017] Furthermore, the plasmid or dsDNA cutting condition is 70-75° C. for 15-60 min.

[0018] Preferably, the plasmid or dsDNA cleavage condition is 70° C. for 30 min.

[0019] Furthermore, the GC content of any site to be inserted is 29%-64%.

[0020] Furthermore, a pair of forward and reverse gDNAs are designed according to the target site where the plasmid or dsDNA is to be inserted, so as to guide GgeAgo to cut the plasmid or dsDNA, and the obtained cutting products are directly used for DNA fragment insertion.

[0021] Furthermore, the gDNA is a 5'-phosphorylated guide DNA.

[0022] Preferably, the gDNA is an 18 nt 5'-phosphorylated guide DNA.

[0023] Furthermore, in step S3, T5 exonuclease system is added to the mixed solution, and the homologous region is digested in an ice water bath.

[0024] The second aspect of the present invention is to provide a kit for cloning a target DNA into a vector, comprising the above-mentioned cleavage system or a reagent for preparing the cleavage system.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] (1) The present invention provides a DNA molecular cloning method based on GgeAgo, which has a wide targeting range, high specificity, and can achieve site-specific insertion.

[0027] (2) The operation is simple and the plasmid or dsDNA cutting products can be directly used for the insertion of exogenous gene fragments without additional purification steps.

[0028] (3) Seamless cloning can be achieved by digesting the homology arms with T5 exonuclease.

[0029] (4) When the GC content of the proposed insertion site is 29%-64%, the cloning efficiency is higher. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the working principle of the GgeAgo-based DNA molecular cloning method;

[0031] Figure 2 Schematic diagram of the GC content of the target site in the pUC19 plasmid;

[0032] Figure 3 Schematic diagram of the effect of GgeAgo cutting pUC19 plasmid, where OC represents open circular plasmid (one strand of the plasmid is disconnected); LIN represents linearized plasmid (double strands of the plasmid are disconnected); SC represents supercoiled plasmid;

[0033] Figure 4 The figure shows the transformant plate;

[0034] Figure 5 This is the sequencing result of the positive recombinant. DETAILED DESCRIPTION

[0035] In order to explain the technical solution and beneficial effects of the present invention more clearly, the present invention is described in detail below in conjunction with the accompanying drawings and embodiments. It should be clear that the reference drawings described are only some embodiments of the present invention and are only used to explain the present invention, and cannot be understood as limiting the present invention.

[0036] The experimental methods and conditions used in the following examples are conventional methods unless otherwise specified, and refer to "Molecular Cloning Experiment Guide (4th Edition)" (Chinese version), published by Science Press. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0037] The present invention uses thermophilic bacteria as the starting strain to dig out a thermostable Argonaute nuclease, referred to as GgeAgo. The present invention constructs a recombinant plasmid pET28a-GgeAgo by PCR technology, transforms the recombinant plasmid into Escherichia coli, realizes the heterologous expression of GgeAgo, and then purifies the protein GgeAgo produced by the recombinant strain by Ni NTA column.

[0038] Heterologous expression and purification of GgeAgo:

[0039] The nucleotide sequence of GgeAgo was synthesized by Jinkairui Biotechnology Co., Ltd. and cloned into the pET28a expression vector together with the C-terminal 6×His tag to obtain the pET28a-GgeAgo plasmid, which was then transformed into Escherichia coli Rosetta (DE3). A single colony was picked and inoculated into LB liquid medium containing kanamycin and cultured in a shaking incubator at 37°C. When the bacterial OD 600 When it reaches 0.6-0.8, move to an 18°C ​​shaker and induce with IPTG overnight. Collect the bacteria by centrifugation, wash with buffer, resuspend the bacteria in Buffer A, add PMSF with a final concentration of 1mM, and break the bacteria under high pressure. Collect the supernatant by centrifugation. After filtering the supernatant, perform Ni-NTA purification. Gradient elution with 20mM-500mM imidazole, and take samples for SDS-PAGE detection. Collect the eluted fractions containing high-purity target protein. Perform a second purification with molecular sieves (Superdex 200 16 / 600column, GE Healthcare). Collect the purified protein, identify the purity and analyze it with SDS-PAGE, collect the eluted fractions containing high-purity target protein, and freeze them for later use.

[0040] The result of SDS-PAGE analysis of the purified high-purity GgeAgo protein was the target protein. The protein band of GgeAgo was consistent with the expected size of 82.3 kDa calculated by http: / / www.expasy.org / . The amino acid sequence of GgeAgo is shown in SEQ ID NO.1.

[0041] like Figure 1 As shown, it is a schematic diagram of the working principle of the DNA molecular cloning method based on GgeAgo. GgeAgo cuts the plasmid (such as pUC19, etc.) under the guidance of a pair of 5' end phosphorylated gDNA to linearize the plasmid, adds the exogenous fragment to be inserted with the homologous region, and transforms Escherichia coli using a recombination-based cloning assembly method (such as T5 cloning). Then, the exogenous fragment can be efficiently and accurately inserted into the target plasmid.

[0042] The cutting system provided by the present invention comprises:

[0043] (a) a guide nucleic acid molecule: gDNA, wherein the gDNA is a 5'-phosphorylated single-stranded DNA molecule;

[0044] (b) a programmable endonuclease GgeAgo or / and a mutant thereof, wherein the programmable endonuclease GgeAgo is derived from a thermophilic bacterium, and its amino acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the mutant of GgeAgo has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO.1;

[0045] (c) optionally a plasmid or dsDNA target;

[0046] (d) Reaction buffer.

[0047] In the cutting system, GgeAgo has high shear activity in the temperature range of 70-75°C, the reaction time is 15-60min, and the optimal shear activity temperature is 70°C for 30min.

[0048] The following is a detailed description of the DNA molecular cloning method using the prepared GgeAgo.

[0049] Example 1

[0050] GgeAgo recognizes and cuts the vector plasmid.

[0051] This example uses pUC19 plasmid as an example to briefly describe the steps of GgeAgo recognition and cleavage of the vector plasmid. Figure 2 The specific implementation steps are as follows:

[0052] A pair of forward and reverse gDNAs complementary to the pre-cut target sequence were designed according to the intended insertion target position of the target plasmid. In this embodiment, gDNAs were designed according to multiple target positions with GC contents of 29%, 39%, 45%, 53%, and 64% in the pUC19 plasmid and the experiments were carried out simultaneously. The sequences are shown in Table 1.

[0053] Table 1. Sequence information.

[0054]

[0055] After 8 pmol of GgeAgo was incubated with 2.5 pmol of forward and reverse gDNAs corresponding to the target cleavage sites with different GC contents to form Ago-single-stranded gDNA complexes, the forward and reverse gDNAs were mixed with the complexes formed with GgeAgo, reacted at 70°C for 30 min to treat the empty enzyme, and then 200 ng of pUC19 plasmid was added to react at 70°C for 30 min. After the reaction, 100 ng of the reaction sample was added to 5× loading buffer and detected by electrophoresis in 1% agarose gel.

[0056] The results are as follows Figure 3 As shown. The results show that GgeAgo can use a pair of gDNA to convert supercoiled plasmids into a linear state to a great extent. This indicates that GgeAgo can cut complementary supercoiled plasmid sites under the common guidance of forward and reverse gDNAs, converting supercoiled plasmids into open circles and / or linear states for the insertion of exogenous fragments.

[0057] Example 2

[0058] GgeAgo-based molecular cloning.

[0059] Based on the high activity and high precision shearing reaction of GgeAgo on plasmids, this example constructs a new molecular cloning technology that can insert exogenous gene fragments at any desired site in a selected plasmid. Here, inserting an exogenous GFP fragment (about 1 kb in size) into a pUC19 plasmid is used as an example for detailed description. The GFP sequence (SEQ ID NO.20) is as follows:

[0060] caatgacatcaattattata agccgttcgctgtgtcgcacaattcgtggacgtgggaaaattgatccc attctggtgccggatccctaagcccaatgtgtttttttctagtt

[0061] ggatttgctcccccgccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgaggggggca gggatggctatatttctgggagcgaactccgggcgaat

[0062] acgaagcgcttggatagcttcacttgtacagctcgtccatgccggtcgactctagaggatcctctaga tttaagaaggagatatacat ATGAGTAAAGGA

[0063] GAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATT

[0064] TTCAGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACT

[0065] ACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTCGCGTATGGTCTTCAATGCTTTGC

[0066] GAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAG

[0067] GAAAGAACCATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGT

[0068] GATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAGGATGGAAACATTCTTGGACA

[0069] CAAATTGGAATACATCTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCA

[0070] AAGTCAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACA

[0071] AAATACTCCAATTGGCGATGGCCCTGTCCTTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCC

[0072] TTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGAT

[0073] TACACATGGCATGGACGAGCTGTACAAGTGAagtatcctctagagcgctcgttgacaattaatcatcggc

[0074] The specific implementation contents include:

[0075] First, the pUC19 plasmid was linearized by GgeAgo using the method steps described in Example 1, and the product was directly used to insert the exogenous DNA fragment without the need for a purification step.

[0076] Second, two 20 bp end-compatible homologous regions were introduced into the insert by PCR, and then mixed with the plasmid excision product, among which the linearized vector and DNA fragment (molar ratio of 1:3-1:5, volume not exceeding 4 μL), 0.5 μL of 10×T5 Exobuffer, 0.5 μL of 10-fold diluted T5Exo with ddH2O, and the reaction system was made up to 5 μL with ddH2O, mixed well, and reacted on ice for 7 min.

[0077] Third, the mixture was transformed into E. coli DH5α competent cells to generate recombinant plasmids, which were diluted 10 times and then coated on plates for overnight culture after rapid transfection.

[0078] The specific sequences of the guide gDNA and PCR amplification primers involved in the above steps are shown in Table 1 and Table 2.

[0079] Table 2. PCR amplification primer sequence list.

[0080]

[0081] 20bp homologous ends to the digested backbones is underlined.

[0082] Representative transformation plate results are shown in Figure 4 The results showed that the vast majority of colonies emitted green fluorescence, indicating that the exogenous GFP protein gene was most likely successfully cloned into the pUC19 plasmid.

[0083] To further determine the accuracy and efficiency of the cloning method, this example further counted all transformants and green positive clones, and then randomly selected some transformed strains for Sanger sequencing.

[0084] The sequencing results are as follows Figure 5 As shown. The results show that the exogenous gene fragment is indeed accurately and efficiently integrated into the pUC19 plasmid at the intended insertion target position. When the GC content of the intended insertion target site is less than 53%, the cloning accuracy rate is more than half. The sequencing results also show that after using GgeAgo to cut the plasmid DNA, the exogenous gene fragment can be specifically inserted into the target vector plasmid, achieving accurate seamless cloning.

[0085] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A DNA molecular cloning method based on GgeAgo, characterized in that: The following steps are involved: S1. The vector plasmid is sheared by a cutting system; the cutting system comprises: (a) Guide nucleic acid molecule: gDNA; (b) a programmable endonuclease GgeAgo or / and a mutant thereof, wherein the programmable endonuclease GgeAgo is derived from a thermophilic bacterium, and its amino acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the mutant of GgeAgo has at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity with SEQ ID NO.1; (c) optionally a plasmid or dsDNA target; (d) reaction buffer; S2, the vector plasmid cutting products are mixed with the exogenous fragments with homologous regions and assembled using a recombination-based cloning method; S3. The mixed solution obtained in step S2 is transformed into Escherichia coli to generate a recombinant plasmid.

2. The DNA molecule cloning method according to claim 1, characterized in that: The homologous region is 15-45 bp in length.

3. The DNA molecule cloning method according to claim 1, characterized in that: The homologous region is 18-20 bp in length.

4. The DNA molecule cloning method according to claim 1, characterized in that: The plasmid or dsDNA cutting condition is 70-75° C. for 15-60 min.

5. The DNA molecule cloning method according to claim 1, characterized in that: The plasmid or dsDNA cutting condition is 70° C. for 30 minutes.

6. The method for DNA molecule cloning according to claim 1, characterized in that: The GC content of the arbitrary insertion site is 29%-64%.

7. The method for DNA molecule cloning according to claim 1, characterized in that: A pair of forward and reverse gDNAs are designed according to the target site where the plasmid or dsDNA is to be inserted, to guide GgeAgo to cut the plasmid or dsDNA, and the obtained cutting products are directly used for DNA fragment insertion.

8. The method for DNA molecule cloning according to claim 7, characterized in that: The gDNA is a 5'-phosphorylated guide DNA.

9. The method for DNA molecule cloning according to claim 1, characterized in that: In step S3, T5 exonuclease system is added to the mixed solution, and the homologous region is digested in an ice water bath.

10. A kit for cloning a target DNA into a vector, characterized in that: The method comprises the cleavage system according to claim 1 or a reagent for preparing the cleavage system.

Images