Plant super-multiple gene editing method and application thereof

Abstract

The invention discloses a plant super-multiple gene editing method and application thereof. According to the invention, intein is utilized to carry out segmented expression on a selection marker gene, and a vector combination for super-multiple gene editing is constructed. Based on the vector combination, the invention provides a plant super-multiple gene editing method, the vector combination is combined with Golden gate cloning and the like, so that the assembly of a super-multiple sgRNA expression box can be realized, and the super-multiple editing of the gene is carried out. The method overcomes the technical defects of high construction difficulty of a multi-editing vector and low ultra-multi-editing efficiency caused by instability of a plurality of sgRNA expression cassettes in the assembly and transformation process at present, has the advantages of simple and convenient construction process, high positive rate, stable multi-repeat sgRNA expression cassettes and the like, and has the advantages of high frequency of simultaneous editing of multiple targets in a transformation material, high efficiency, high efficiency and the like. Rich mutants can be rapidly obtained, and the method has a wide application prospect in the aspects of research of gene functions of plants and molecular breeding of crops.

Description

Technical Field

[0001] The present invention belongs to the field of gene editing technology, and more specifically, relates to a plant super-multiple gene editing method and its application. Background Art

[0002] CRISPR / Cas9 technology is now widely used to improve crop varieties. Since many complex plant traits are controlled by multiple genes, the genetic improvement of polygenic traits requires editing of multiple functional genes at the same time, and the demand for multiple editing is becoming increasingly urgent. When Cas9 and multiple sgRNAs are expressed simultaneously, multiple editing can be performed, but the difficulty of traditional multiple editing vector construction methods increases with the increase in the number of sgRNA expression cassettes, and the vector stability also decreases, resulting in a significant reduction in the efficiency of simultaneous editing of multiple targets.

[0003] The prior art mainly achieves multiple editing by optimizing the sgRNA expression cassette assembly method. Wang et al. reduced the homology of the sgRNA expression cassette by point mutation of the sgRNA sequence and tRNA sequence, thereby improving the assembly efficiency of multiple sgRNA expression cassettes (Wang et al., Plant Biotechnology Journal, 2024, 22: 460-471), but its editing efficiency is still low, less than 50%. Wu et al. assembled multiple sgRNA expression cassettes by combining the Golden gate cloning method with Gateway recombination. The process is not only complicated, but also unstable in Escherichia coli and Agrobacterium. Whether it is the transformation method of Agrobacterium or gene gun, the sgRNA expression cassettes in the transformed plants obtained are incomplete, and the editing efficiency of multiple target sites is low (Wu et al., The Crop Journal, 2024, 12: 569-582). Therefore, it is very necessary to effectively transform the editing vector and assembly.

[0004] 2A self-cleaving peptide (2A peptide) is a short peptide connecting multiple cistrons. It can mediate self-cleavage to break the fusion protein into multiple proteins to independently perform their respective functions. It is widely used in multi-gene co-expression and other aspects. Intein is a protein structure that can self-catalyze its own excision from the host after translation, and mediate the reconnection of protein residues outside the two sides (N-terminus and C-terminus) of its protein to form a new protein. Among them, the split intein usually has two parts, which are translated from two independent genes. The N-terminal part is called Intein. N , the C-terminal part is called Int C . Int N and Int CThe two ends carry the extensin proteins at both ends. Through dimerization and self-cleavage reactions, the extensin proteins are reconnected into functional proteins.

[0005] The N-terminus and C-terminus of the intein Npu DnaE9 from Nostoc punctiformme can be connected in series with segmented target genes and expressed separately in the same cell to form functional target proteins. This segmented expression method has been used for the segmented expression of different target genes (such as nucleases or screening marker genes, etc.). However, it is uncertain whether the target gene can be further fused with other genes or domains after segmentation, and whether the integrity and function of the target protein can be restored after fusion expression. It is also unclear how to use 2A peptides and intein peptides to achieve super-multiple gene editing in plants, or whether super-multiple gene editing in plants can be achieved using 2A peptides and intein peptides. Summary of the invention

[0006] In view of the problems of low assembly and editing efficiency and poor vector stability in existing multiple editing methods, the present invention provides a plant super-multiple gene editing method. The method is based on the vector combination constructed by the co-transformation strategy of split marker agent screening of the present invention, and has the advantages of simple construction process, high positive rate and stable multi-repeat sgRNA expression cassette, and can be applied to the construction of plant multi-gene mutants, etc.

[0007] The first object of the present invention is to provide a carrier combination.

[0008] The second object of the present invention is to provide an application of the vector combination in super-multiple gene editing of plants.

[0009] The third object of the present invention is to provide an application of the vector combination in the preparation of a product for super-multiple gene editing of plants.

[0010] The fourth object of the present invention is to provide a co-transformation vector system for super-multiple gene editing.

[0011] The fifth object of the present invention is to provide a method for super-multiple gene editing in plants.

[0012] The sixth object of the present invention is to provide application of the method in constructing plant multi-gene mutants.

[0013] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0014] The present invention adopts a co-transformation strategy of split marker agent screening, and obtains two editing vector combinations that use inteins to express the screening marker gene HPT in segments by selecting suitable 2A peptides and inteins, selecting suitable screening marker genes and segmentation sites, etc. Based on the vector combination of the present invention, the assembly of super-multiple sgRNA expression cassettes can be achieved in combination with Golden gate cloning and Gibson assembly, and then multiple editing of genes can be performed. It has been verified by experiments that the positive rate of super-multiple sgRNA expression cassette assembly using the vector combination is high, and a stable structure can be maintained in Agrobacterium, which is suitable for super-multiple gene editing of plants. Therefore, the present invention requests protection for the vector combination and its application.

[0015] Specifically, the vector combination includes a binary vector 1 that expresses a fusion protein of a nuclease that is sequentially connected in series with the N-terminal part of a screening marker gene HPT and the N-terminal part of an intein, and a binary vector 2 that expresses a fusion protein of a C-terminal part of a screening marker gene HPT that is sequentially connected in series with the C-terminal part of an intein; the amino acid sequence of the N-terminal part of the HPT is shown in SEQ ID NO.3, and the amino acid sequence of the N-terminal part of the intein is shown in SEQ ID NO.4; the nuclease and the N-terminal part of the screening marker gene HPT are connected in series via a 2A self-cleaving peptide; the amino acid sequence of the C-terminal part of the HPT is shown in SEQ ID NO.5, and the amino acid sequence of the C-terminal part of the intein is shown in SEQ ID NO.6.

[0016] In a specific embodiment of the present invention, the nucleotide sequence of the N-terminal portion of the screening marker gene HPT is shown as SEQ ID NO.11; the nucleotide sequence encoding the N-terminal portion of the intein is shown as SEQ ID NO.12; the nucleotide sequence of the C-terminal portion of the screening marker gene HPT is shown as SEQ ID NO.13, and the nucleotide sequence encoding the C-terminal portion of the intein is shown as SEQ ID NO.14.

[0017] Optionally, the nuclease is CRISPR / Cas9 or CRISPR / Cas12.

[0018] In a specific embodiment of the present invention, the nuclease is SpCas9.

[0019] Specifically, the amino acid sequence of the SpCas9 is shown in SEQ ID NO.1; the nucleotide sequence of the gene encoding the SpCas9 is shown in SEQ ID NO.9.

[0020] Specifically, both ends of the nuclease are provided with nuclear localization signals. The nuclear localization signals provided at both ends of the nuclease can be the same or different.

[0021] Optionally, the amino acid sequence of the nuclear localization signal is shown in SEQ ID NO.7 and / or SEQ ID NO.8, and the nucleotide sequence encoding the nuclear localization signal is shown in SEQ ID NO.15 and SEQ ID NO.16 respectively.

[0022] In a specific embodiment of the present invention, the N-terminus of the nuclease is provided with a nuclear localization signal as shown in SEQ ID NO.7, and the C-terminus is provided with a nuclear localization signal as shown in SEQ ID NO.8.

[0023] Specifically, the 2A self-cleaving peptide is a F2A self-cleaving peptide.

[0024] More specifically, the amino acid sequence of the F2A self-cleaving peptide is shown as SEQ ID NO.2, and the nucleotide sequence encoding the F2A self-cleaving peptide is shown as SEQ ID NO.10.

[0025] Specifically, the fusion protein in binary vector 1 is driven to be expressed by Pubi promoter; and the fusion protein in binary vector 2 is driven to be expressed by P35s promoter.

[0026] Specifically, when constructing the vector combination, the pYLCRISPR / Cas9Pubi-H vector is used as the backbone.

[0027] More specifically, the basic no-load used is 1300-Tnos-ccdB; the construction method of the basic no-load is:

[0028] Using the pYLCRISPR / Cas9Pubi-H vector plasmid as a template, PCR amplification was performed using primers F-1300-FK and R-1300-FK to obtain a 1300 backbone fragment in which the resistance screening marker gene expression cassette and the Cas9 expression cassette were removed (Tnos was retained) and the Pst I and BamH I restriction sites and self-ligated homology arms were extended; the 1300 backbone fragment was purified, and the purified product was treated with Dpn I to eliminate the template; the product after restriction digestion was self-ligated using a Gibson assembly reaction kit, and the ligated product was heat-shock transformed into Escherichia coli DB3.1 competent cells, the transformed single clones were screened, the obtained positive clones identified as having the correct sequence by sequencing were retained, and the plasmid was extracted to obtain the basic empty vector 1300-Tnos-ccdB.

[0029] Specifically, the nucleotide sequence of the primer F-1300-FK is: AGGATCCTActgcagTCGGCGTTAATTCAGTACATTAAAAACGTCCG; the nucleotide sequence of the primer R-1300-FK is: TTAACGCCGActgcagTAGGATCCTCCCGATCGTTCAAACATTTGGC.

[0030] In a specific embodiment of the present invention, the binary vector 1 is named as the super-multiple gene editing co-transformation vector 1300-Cas9::HPTn (9Hn); the binary vector 2 is named as the super-multiple gene editing co-transformation vector 1300-HPTc (Hc).

[0031] By using the vector combination of the present invention, Golden gate cloning and Gibson assembly can be combined to realize the assembly of super multiple sgRNA expression cassettes, which overcomes the technical defects of the current difficulty in constructing multiple editing vectors and the instability of multiple sgRNA expression cassettes during assembly and transformation, resulting in low super multiple editing efficiency, etc., and has the advantages of simple construction process, high positive rate, stable multi-repeat sgRNA expression cassettes, and high frequency of simultaneous editing of multiple targets in the transformation material. Therefore, the present invention also requests protection for the application of the vector combination in super multiple gene editing of plants.

[0032] The present invention also claims protection for the use of the vector combination in preparing products for super-multiple gene editing of plants.

[0033] The use of the vector combination of the present invention in constructing plant multi-gene mutants should also be within the protection scope of the present invention.

[0034] The present invention also provides a co-transformation vector system for super-multiple gene editing, which contains the vector combination of the present invention and reagents required for Golden gate cloning and / or Gibson assembly.

[0035] At the same time, the present invention also provides a method for assembling a super-multiple sgRNA expression cassette, including a first round of Goldengate cloning assembly and a second or Nth round of Gibson assembly cycle (each Gibson assembly retains a single restriction site PmeI at its end, so it can be used as the site for the next assembly).

[0036] The present invention also provides a plant super-multiple gene editing method, comprising the following steps:

[0037] S1. Design and construct multiple sgRNA expression cassettes for gene editing targets;

[0038] S2. inserting the multiple sgRNA expression cassettes in S1 into the binary vector 1 and / or 2 in the vector combination;

[0039] S3. Binary vectors 1 and 2 are transformed into Agrobacterium, respectively, and transformed into plants using Agrobacterium-mediated genetic transformation.

[0040] Specifically, when performing super-multiple gene editing in plants, the constructed multiple sgRNA expression cassettes can be inserted into binary vector 1 or 2 as needed, or divided into two groups and inserted into binary vectors 1 and 2 respectively. Based on the current test results, the number of sgRNA expression cassettes that can be inserted into a single binary vector is not less than 15, but the upper limit has not been reached.

[0041] Specifically, when constructing a multiple sgRNA expression cassette, the super-multiple sgRNA expression cassette assembly method described in the present invention can be used.

[0042] The present invention also claims to protect the application of the method in constructing plant multi-gene mutants.

[0043] Specifically, the plant is rice.

[0044] The present invention has the following beneficial effects:

[0045] The present invention uses intein to express the screening marker gene in segments, and constructs a vector combination for super-multiple gene editing. Based on the vector combination, the present invention provides a plant super-multiple gene editing method, which can realize the assembly of super-multiple sgRNA expression cassettes by using the vector combination in combination with Golden gate cloning, and perform super-multiple editing of genes. The present invention overcomes the technical defects of low super-multiple editing efficiency caused by the difficulty of constructing the current multiple editing vector and the instability of multiple sgRNA expression cassettes during assembly and transformation. It has the advantages of simple construction process, high positive rate, stable multi-repeat sgRNA expression cassettes, etc., and the frequency of simultaneous editing of multiple targets in the transformation material is high, and rich mutants can be quickly obtained, which has broad application prospects in the study of plant gene functions and crop molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The schematic diagram of the structure of the super-multiplex gene editing co-transformation vector 1300-Cas9::HPTn (9Hn) and 1300-HPTc (Hc) with split agent selection markers of the present invention; Pubi and P35s are promoters used to initiate translation and synthesize functional fusion proteins; HPTn and HPTc are the N-terminal part and C-terminal part of HPT, respectively; I N and I CThey are the N-terminal and C-terminal parts of the intein respectively; Tnos is a terminator used to terminate translation; ccdB is a lethal gene used to screen positive clones; LB and RB are the left and right boundaries of the T-DNA region respectively.

[0047] Figure 2 The present invention provides a method for using the super-multiple gene editing co-transformation vector with a split agent screening marker; a in the figure is a schematic diagram of the process of constructing a super-multiple sgRNA expression cassette using Golden gate-Gibson co-assembly (GG co-assembly); b in the figure is a schematic diagram of the process of super-multiple editing vector co-transformation mediated by split agent screening by intein, and the super-multiple editing vector combination 9Hn and Hc is co-transformed into callus induced by plant tissue, and after antibiotic screening, successfully co-transformed callus is obtained and induced into seedlings, so as to obtain positive plants in which the sites targeted by the sgRNA expression cassettes assembled on 9Hn and Hc are simultaneously edited.

[0048] Figure 3 The figure shows the construction method of the 9Hn-5T1 and Hc-5T2 vectors in Example 2; a in the figure is a schematic diagram of the combined structure of the 9Hn-5T1 and Hc-5T2 co-transfection vectors, which respectively refers to the assembly of 5 targets on 1300-Cas9::Hn (9Hn) and 1300-Hc (Hc) through golden gate; b in the figure shows the information of the 10 designed target sites, including the truncated promoter used, the target site name, the gene ID where the target site is located, and the target site sequence, and the bold words on the yellow background are NGG-PAM; c in the figure shows the colony PCR detection results of 9Hn-5T1 and Hc-5T2 in Escherichia coli (DH5α) and Agrobacterium tumefaciens (EHA105) after the successful assembly of the sgRNA expression cassette, and the full length of the target expression cassette is about 1.6 kb using primers SP-L1 and SP-R.

[0049] Figure 4 It is the editing situation of the positive plants obtained by co-transformation of 9Hn-5T1 and Hc-5T2 in Example 2; a in the figure is the leaf DNA amplification test result of the positive transformed plant obtained by resistance screening, and the amplified fragments are partial nucleotide sequences encoding Cas9, HPTn and HPTc respectively; b in the figure is the target editing efficiency of the positive transformed seedlings obtained by co-transformation of 9Hn-5T1 and Hc-5T2; c in the figure is the frequency of 0-10 target points mutated simultaneously in the positive transformed seedlings obtained by co-transformation of 9Hn-5T1 and Hc-5T2; d in the figure is the plant phenotype diagram of the transformed seedlings obtained by co-transformation of 9Hn-5T1 and Hc-5T2 and the wild type and their target mutation situation, the bold is the PAM motif, and the red font represents the generated mutant sequence.

[0050] Figure 5To demonstrate the sgRNA assembly method of the super-multiple editing vector using 15 sgRNA expression cassettes as an example; Figure a is a schematic diagram of the 9Hn-V1-15T and Hc-V2-15T vectors that use the GG joint assembly method to assemble 15 sgRNA expression cassettes respectively; Figure b is the basic information of the 30 target sites selected for super-multiple editing, including gene ID and target sequence; Figure c is a schematic diagram of the distribution of the 30 target sites selected for super-multiple editing on the chromosome.

[0051] Figure 6 The results of colony PCR detection and restriction enzyme verification during the construction of 9Hn-V1-15T and Hc-V2-15T vectors; a in the figure is a schematic diagram of the PCR verification primer positions and restriction enzyme cutting sites of 15 sgRNA expression cassettes; b in the figure is the colony PCR detection result of the first round of sgRNA expression cassette assembly by Goldengate, the primers are Sp-L1 and Sp-R, the target band is about 3.8kb, and the red arrows and red font marks indicate the clones that amplified the correct bands; c in the figure Colony PCR detection of the second round of sgRNA expression cassette assembly for Gibson assembly, primers are F-PmeI-jc and R-RB-jc, the target band is about 1kb, and the red font mark indicates the clone that amplified the correct band; Figure d is the target site specific primer PCR verification of 9Hn-V1-15T and Hc-V2-15T vector transformation Agrobacterium, with the correctly sequenced vector plasmid as the control; Figure e is the Asc I restriction enzyme verification result of the vector plasmid of 9Hn-V1-15T and Hc-V2-15T, with its corresponding empty vector 1300-Cas9::Hn (9Hn) and 1300-Hc (Hc) as the control. DETAILED DESCRIPTION

[0052] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0053] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0054] Example 1 Construction of co-transformation editing vector for super multiplex gene editing

[0055] In order to solve the problem that the traditional super-multiple editing vector is not suitable for super-multiple editing by simultaneous expression of Cas9 and multiple sgRNAs, the present invention provides a super-multiple gene editing co-transformation vector combination with a split proxy screening marker, wherein the construction process of the co-transformation editing vectors 1300-Cas9::Hn (9Hn) and 1300-Hc (Hc) contained therein is as follows:

[0056] The functional elements used in this embodiment for constructing a super-multiplex gene editing co-transformation vector with a split agent screening marker mainly include: SpCas9 nuclease (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.9); F2A self-cleavage peptide (amino acid sequence as shown in SEQ ID NO.2, nucleotide sequence as shown in SEQ ID NO.10); HPTn segmented eukaryotic resistance screening gene HPT N-terminal part (amino acid sequence as shown in SEQ ID NO.3, nucleotide sequence as shown in SEQ ID NO.11); Intein-N (I N ) is the N-terminal part of the intein (the amino acid sequence is shown in SEQ ID NO.4, and the nucleotide sequence is shown in SEQ ID NO.12); HPTc is the C-terminal part of the segmented eukaryotic resistance screening gene HPT (the amino acid sequence is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.13); Intein-C (I C ) is the C-terminal part of the intein (the amino acid sequence is shown in SEQ ID NO.6, and the nucleotide sequence is shown in SEQ ID NO.14); the NLS at the N-terminus of the nuclease (the amino acid sequence is shown in SEQ ID NO.7, and the nucleotide sequence is shown in SEQ ID NO.15); the NLS at the C-terminus of the nuclease (the amino acid sequence is shown in SEQ ID NO.8, and the nucleotide sequence is shown in SEQ ID NO.16).

[0057] 1. Construction of basic no-load 1300-Tnos-ccdB

[0058] (1) 1300 backbone reverse amplification

[0059] Using the pYLCRISPR / Cas9Pubi-H plasmid vector (Ma et al., 2015, Molecular Plant, 8:1274-1284) as a template, PCR amplification was performed using primers F-1300-FK (AGGATCCTActgcagTCGGCGTTAATTCAGTACATTAAAAACGTCCG) and R-1300-FK (TTAACGCCGActgcagTAGGATCCTCCCGATCGTTCAAACATTTGGC) to obtain a 1300 backbone fragment with the resistance selection marker gene expression cassette and Cas9 expression cassette removed (Tnos retained) and Pst I and BamH I restriction sites and self-ligated homology arms extended.

[0060] The PCR system (30 μL) was as follows: 2× Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, pYLCRISPR / Cas9Pubi-H vector 30 ng, 10 μM F-1300-FK 0.5 μL, 10 μM R-1300-FK 0.5 μL, ddH 2 Add HO to make up to 30 μL.

[0061] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 9 min), and extension at 72°C for 2 min.

[0062] (2) Enzyme digestion

[0063] The amplified 1300 backbone fragment was purified using the Genstar purification kit, and the purified product was treated with Dpn I to eliminate the template. The enzyme digestion reaction system was: 10× Faster digest buffer, 1 μL Dpn I, 600 ng of the purified product of the 1300 backbone fragment, ddH 2 The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0064] (3) Connection

[0065] The enzyme-digested products were self-ligated using the Gibson assembly reaction kit (NEB#E5510S).

[0066] Take 10 μL of the ligation product, heat-shock transform it into 100 μL of Escherichia coli DB3.1 competent cells, screen the transformed single clones on kanamycin-resistant (Kana) LB plates, retain the positive clones identified as having the correct sequence by sequencing, extract the plasmid, and obtain the basic empty vector 1300-Tnos-ccdB.

[0067] 2. Construction of the super-multiplex editing vector 1300-Cas9::Hn(9Hn)

[0068] (1) Amplification of Pubi-Cas9-2A fragment

[0069] Using the pYLCRISPR / Cas9Pubi-H plasmid vector as a template, PCR amplification was performed using primers F-Pubi (GCGGACGTTTTTAATGTACTGAATTAACGCCG) and R-Cas9 -2A (CGCCAGCGAGCTTGAG GAGGTCGAAGTTGAGGGTCTGCTTCACGGAGCCcttctttttcttagcctgtc) to obtain the Pubi-Cas9-2A fragment with a 2A peptide sequence extended at the C-terminus.

[0070] The PCR system (30 μL) was as follows: 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, pYLCRISPR / Cas9Pubi-H vector 30 ng, 10 μM F-Pubi 0.5 μL, 10 μM R-Cas9 -2A 0.5 μL, ddH 2 Add HO to make up to 30 μL.

[0071] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 5 min), and extension at 72°C for 2 min.

[0072] (2) Amplification of 2A-HPTn fragment

[0073] Using the pYLCRISPR / Cas9Pubi-H plasmid vector as a template, primers F-2A-HPTn (GCAG ACCCTCAACTTCGACCTCCTCAAGCTCGCTGGCGACGTCGAGTCTAATCCA GGACCAGGCTCTatgaaaaagcctgaactcacc) and R-HPTn-I N (CGGTCTCGTAGCTGAG GCAGCTGCCagccaaccacggcctccagaa) was amplified by PCR to obtain the 2A-HPTn fragment with a 2A peptide sequence extending at the N-terminus.

[0074] PCR system (30 μL): 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, pYLCRISPR / Cas9Pubi-H vector 30 ng, 10 μM F-2A-HPTn 0.5 μL, 10 μM R-HPTn-I N 0.5 μL, ddHO 2Add HO to make up to 30 μL.

[0075] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 30 s), and extension at 72°C for 2 min.

[0076] (3)I N Amplification of fragments

[0077] Using the plasmid carrying the nucleotide sequence encoding the intein (shown in SEQ ID NO.12+SEQ ID NO.14) synthesized by gene as template, primers FI N (GGCAGCTGCCTCAGCTACGA) and RI N (TTGCCAAATGTTTGAACGATCGGGACTAGTTCGGGAGGTTGTCCACCCTC) was amplified by PCR to obtain an I with a 2A peptide sequence extending from the N-terminus. N Fragment.

[0078] The PCR system (30 μL) was as follows: 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, 30 ng of the gene-synthesized plasmid carrying the intein nucleotide sequence, 10 μM FI N 0.5 μL, 10 μM RI N 0.5 μL, ddHO 2 Add HO to make up to 30 μL.

[0079] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 15 s), and extension at 72°C for 2 min.

[0080] (4) Amplification of fusion fragments

[0081] 2A-HPTn fragment and I N The amplified product of the fragment was used as a template, and primers F-2A-HPTn and RI N Overlapping PCR amplification was performed to obtain the fusion fragment 2A-HPTn-I N .

[0082] The PCR system (30 μL) was as follows: 2× Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, 2A-HPTn fragment and I N0.1 μL of each fragment (concentration of each is 100 ng / μL to 150 ng / μL), 0.5 μL of 10 μM F-2A-HPTn, 10 μM RI N 0.5 μL, ddHO 2 Add HO to make up to 30 μL.

[0083] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 1 min), and extension at 72°C for 2 min.

[0084] (5) Enzyme digestion

[0085] Purify the amplified product of Pubi-Cas9-2A fragment and the fusion fragment 2A-HPTn-I using Genstar purification kit N .

[0086] The purified product of Pubi-Cas9-2A fragment was treated with Dpn I to eliminate the template. The enzyme digestion reaction system was: 10× Faster digest buffer, 1 μL Dpn I, 600 ng of purified product of Pubi-Cas9-2A fragment, ddH 2 The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0087] The 1300-Tnos-ccdB basic empty vector was digested with Pst I and BamH I. The digestion reaction system was: 10× Fasterdigest buffer 1 μL, Pst I and BamH I 0.5 μL each, 1300-Tnos-ccdB basic empty vector plasmid 900 ng, ddH 2 The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0088] (6) Connection

[0089] The Pubi-Cas9-2A fragment treated with Dpn I and the purified 2A-HPTn-I were assembled using the Gibson assembly reaction kit (NEB #E5510S). N The fusion fragment was connected between Pst I and BamH I of the 1300-Tnos-ccdB basic empty vector plasmid. The ligation reaction system was: 2×Mix 5μL, Pubi-Cas9-2A fragment 60ng, 2A-HPTn-I N Fusion fragment 30ng, 1300-Tnos-ccdB basic empty load 90ng, ddH 2 The volume of HO was added to 10 μL. The ligation reaction procedure was: 50°C for 50 min.

[0090] Take 10 μL of the ligation product, heat-shock transform it into 100 μL of E. coli DB3.1 competent cells, screen the transformed single clones on kanamycin-resistant (Kana) LB plates, retain the positive clones identified as having the correct sequence by sequencing, extract the plasmid, and obtain the 1300-Cas9::Hn (9Hn) vector, whose structural schematic diagram is shown in the figure. Figure 1 shown.

[0091] 3. Construction of the super multiplex editing vector 1300-Hc (Hc)

[0092] (1) Amplification of P35s fragment

[0093] Using the pYLCRISPR / Cas9Pubi-H plasmid vector as a template, PCR amplification was performed using primers F-35S (CTGAATTA ACGCCGAattaattcgggggcggtttgcgtattggctag) and R-35S (Atctcattgccccccgggat) to obtain the P35s fragment.

[0094] The PCR system (30 μL) was as follows: 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, pYLCRISPR / Cas9Pubi-H vector 30 ng, 10 μM F-35S 0.5 μL, 10 μM R-35S 0.5 μL, ddH 2 Add HO to make up to 30 μL.

[0095] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 30 s), and extension at 72°C for 2 min.

[0096] (2)I C Amplification of fragments

[0097] The plasmid carrying the nucleotide sequence encoding the intein was used as a template and primers F1 and F2 were used. C (cgca gatcccggggggcaatgagatATGATCAAGATCGCCACAAG) and RI C (GCAACTGCT TCAACGGCACC) was amplified by PCR to obtain I C Fragment.

[0098] The PCR system (30 μL) was as follows: 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, 30 ng of the gene-synthesized plasmid carrying the intein nucleotide sequence, 10 μM FI C 0.5 μL, 10 μM RI C 0.5 μL, ddHO 2 Add HO to make up to 30 μL.

[0099] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 15 s), and extension at 72°C for 2 min.

[0100] (3) Amplification of HPTc fragment

[0101] Using the pYLCRISPR / Cas9Pubi-H plasmid vector as a template, PCR amplification was performed using primers F-HPTc (TCGCGAG CAACTGCTTCAACGGCACCtgtatggagcagcagacg) and R-HPTc-Tnos (ATTGCCAAA TGTTTGAACGATCGGGActatttctttgccctcggacg) to obtain the HPTc fragment.

[0102] The PCR system (30 μL) was as follows: 2× Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, pYLCRISPR / Cas9Pubi-H vector 30 ng, 10 μM F-HPTc 0.5 μL, 10 μM R-HPTc-Tnos 0.5 μL, ddH 2 Add HO to make up to 30 μL.

[0103] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 10 s), and extension at 72°C for 2 min.

[0104] (4) Amplification of fusion fragments

[0105] Take I C The amplified products of the fragment and HPTc fragment were used as templates and primers FI C Overlapping PCR amplification with R-HPTc-Tnos was performed to obtain fusion fragment I C -HPTc.

[0106] The PCR system (30 μL) was as follows: 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, I C 0.1 μL each of fragment and HPTc fragment (concentration of each is 100 ng / μL to 150 ng / μL), 10 μM F-I C 0.5 μL, 10 μM R-HPTc-Tnos 0.5 μL, ddH 2 Add HO to make up to 30 μL.

[0107] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 25 s), and extension at 72°C for 2 min.

[0108] (5) Enzyme digestion

[0109] Purify the amplified product of P35s fragment and fusion fragment I using Genstar purification kit C -HPTc.

[0110] The purified product of P35s fragment was treated with Dpn I to eliminate the template. The enzyme digestion reaction system was: 10× Faster digest buffer, 1 μL Dpn I, 600 ng of purified product of P35s fragment, ddH 2 The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0111] The 1300-Tnos-ccdB basic empty vector was digested with Pst I and BamH I. The digestion reaction system was: 10× Fasterdigest buffer 1 μL, Pst I and BamH I 0.5 μL each, 1300-Tnos-ccdB basic empty vector plasmid 900 ng, ddH 2 The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0112] (6) Connection

[0113] The P35s fragment treated with Dpn I and the purified I C -HPTc fusion fragment was connected between Pst I and BamH I of 1300-Tnos-ccdB basic empty vector plasmid. The ligation reaction system was: 2×Mix 5μL, P35s fragment 45ng, I C -HPTc fusion fragment 30ng, 1300-Tnos-ccdB basic empty load 90ng, ddH2 The volume of HO was added to 10 μL. The ligation reaction procedure was: 50°C for 50 min.

[0114] Take 10 μL of the ligation product, heat-shock transform it into 100 μL of E. coli DB3.1 competent cells, screen the transformed single clones on kanamycin-resistant (Kana) LB plates, retain the positive clones identified as having the correct sequence by sequencing, extract the plasmid, and obtain the 1300-Hc (Hc) vector, whose structural diagram is shown in the figure. Figure 1 shown.

[0115] Example 2 Feasibility evaluation of super-multiplex editing strategy for intein-mediated split agent screening

[0116] In order to detect the feasibility and editing efficiency of the co-transformation editing vector combination constructed in Example 1, five sgRNA expression cassettes were assembled on the 9Hn and Hc vectors respectively using the Goldengate method (the construction process is referenced to Figure 1 ), and get Figure 3 In the 9Hn-5T1 and Hc-5T2 shown in a, by Figure 2 The co-transformation method shown in b was used to transform callus tissue of indica rice purple leaf and detect its editing efficiency.

[0117] 1. Assemble sgRNA expression cassette

[0118] (1) Target selection and primer design

[0119] Searching for NGG-PAM target sites in the rice genome ( Figure 3 b shows the 10 targets selected in this example), use the online program CRISPR-GE webpage (http: / / skl.scau.edu.cn / ) (Xie et al., 2018, Molecular plant, 11: 720-735), enter the primer design (PrimerDesign) subroutine, enter the primerDesign-V branch program, select the corresponding promoter, check the box, select method2, click design, and automatically generate the design as shown in Table 1 for the first round of PCR amplification primers for assembling the sgRNA expression cassette, wherein the combination of primers UF and U#-T# is used to amplify the promoter sequence containing the target, and the promoter includes truncated promoters mU6a, mU6b, mU3 and mU6c, which are used to drive the sgRNA expression cassettes of different targets; the combination of primers gR-R and gR-T# is used to amplify the sgRNA sequence containing the target.

[0120] Table 1 Primer information for the first round of PCR amplification (taking the construction of the sgRNA expression cassette of 1300-Cas9::Hn as an example)

[0121]

[0122]

[0123] Note: Capital letters in the primer sequences represent target sequences, and lowercase letters represent partial sequences homologous to sgRNA or promoter.

[0124] (2) First round of PCR

[0125] Using high-fidelity DNA polymerase (Phanta enzyme) and the primers shown in Table 1, pYLgRNA-mOsU6a, pYLgRNA-mOsU6b, pYLgRNA-mOsU6c, and pYLgRNA-mOsU3 (i.e., "pYLgRNA-mOsU6a, pYLgRNA-mOsU6b, pYLgRNA-mOsU6c, and pYLgRNA-mOsU3" vectors in "Hao et al., 2020, Sci China Life Sci63, 933-935") were used as templates to amplify the mU6 / mU3 promoter sequence and sgRNA sequence, and the corresponding target sequence was extended downstream of the promoter and upstream of the sgRNA.

[0126] The PCR system (20 μL) for amplifying the mU6 / mU3 promoter sequence was as follows: 2×Phanta Max Buffer 10.0 μL, 10 mmol / L dNTPs Mix 0.4 μL, Phanta Max Polymerase 0.3 μL, pYLgRNA-mOsU6 / mOsU3 vector 30 ng, 10 μmol / L UF 0.4 μL, 10 μmol / LU#-T# 0.2 μL, ddH 2 Add HO to make up to 20 μL.

[0127] The PCR program for amplifying the mU6 / mU3 promoter sequence was: pre-denaturation at 95°C for 1 min, 28 PCR cycles (95°C for 10 s, 58°C for 15 s, and 72°C for 20 s), and extension at 72°C for 1 min.

[0128] The PCR system (20 μL) for amplifying sgRNA was as follows: 2×Phanta Max Buffer 10.0 μL, 10 mmol / L dNTPsMix 0.4 μL, Phanta Max Polymerase 0.3 μL, pYLgRNA-mU6 / mU3 vector 30 ng, 10 μmol / L gR-T# 0.2 μL, 10 μmol / L gR-R 0.4 μL, ddH 2 Add HO to make up to 20 μL.

[0129] The PCR program for amplifying sgRNA was as follows: pre-denaturation at 95°C for 1 min, 28 PCR cycles (95°C for 10 s, 58°C for 15 s, and 72°C for 20 s), and extension at 72°C for 1 min.

[0130] The products obtained from the first round of PCR are the mU3 / mU6 promoter carrying the target sequence downstream and the sgRNA carrying the target sequence upstream.

[0131] (3) Second round of PCR amplification

[0132] like Figure 3 As shown in a in FIG. 1 , five test targets are assembled in each of the vectors 1300-Cas9::Hn and 1300-Hc obtained in Example 1 by the Golden gate method, and five sgRNA expression cassettes need to be connected in series.

[0133] The second-round PCR primers Pps and Pgs shown in Table 2 were combined to splice the sgRNA expression cassette driven by the mU3 / mU6 promoter, and Bsa I restriction sites were added on both sides of the PCR product.

[0134] PCR system (50 μL): 2× Phanta Max Buffer 25.0 μL, 10 mmol / L dNTPs Mix 1.0 μL, Phanta Max Polymerase 1.0 μL, 10× diluted first-round PCR product 1.0 μL, 10 μmol / L primers for each of the five target sites: Pps-R / Pgs-2 (T1), Pps-2 / Pgs-3 (T2), Pps-3 / Pgs-4 (T3), Pps-4 / Pgs-5 (T4), Pps-5 / Pgs-L (T5), 1.0 μL each, ddH 2 Add HO to make up to 50 μL.

[0135] The PCR program was as follows: pre-denaturation at 95°C for 1 min, 30 PCR cycles (95°C for 10 s, 58°C for 15 s, and 72°C for 20 s), and extension at 72°C for 1 min.

[0136] The second-round PCR product was purified using the Genstar purification kit.

[0137] Table 2 Primer information for the second round of PCR amplification

[0138]

[0139] Note: The Bsa I digestion ends are designed as non-palindromic sequences to produce efficient ligation (Golden Gateligation).

[0140] (4) Assemble the sgRNA expression cassette into the editing vector

[0141] like Figure 4 As shown in a, the Golden gate cloning method based on Bsa I digestion and ligation was used, and the “cutting and ligating” reaction system (Ma and Liu, 2016, Current Protocols in Molecular Biology, 115: 31.6.1-31.6.21; Zeng Dongchang et al., 2018, Chinese Science: Life Sciences, 48: 783-794) was referred to. The sgRNA expression cassette was purified and cloned into the vectors 1300-Cas9::Hn (9Hn) and 1300-Hc (Hc) obtained in Example 1, respectively.

[0142] Golden gate cloning reaction system (15 μL): 10×CutSmart Buffer 1.5 μL, 10 mmol / L ATP 1.5 μL, 1300-Cas9::Hn(9Hn) (80-100 ng), purified sgRNA expression cassette 30 ng, Bsa I-HF 10 U, T4 DNA ligase 35 U, ddH 2 Add 0.1% HO to make up to 15 μL.

[0143] Golden gate cloning reaction procedure: First, use a PCR instrument to perform enzyme digestion and ligation reactions in variable temperature cycles: 37°C for 10 min; 13 cycles (37°C for 5 min, 10°C for 3 min, 20°C for 5 min); 37°C for 3 min.

[0144] Take 10 μL of the ligation product and heat-shock transform it into 100 μL of Escherichia coli DH5α competent cells. On a kanamycin-resistant (Kana) LB plate, perform colony PCR on the single clone using vector sequencing primers Sp-L1 and Sp-R. Screen the positive colonies with an amplified band size of 1.5 kb by gel electrophoresis for sequencing, retain the positive clones identified as having the correct sequence by sequencing, extract the plasmid, and obtain the editing vector 9Hn-5T1 for assembling 5 sgRNA expression cassettes on 9Hn.

[0145] Hc-5T2 was obtained by the same method.

[0146] 2. Genetic transformation

[0147] (1) Plasmid transformation of Agrobacterium

[0148] The successfully constructed editing vectors 9Hn-5T1 and Hc-5T2 plasmids were transformed into Agrobacterium EHA105 competent cells, and single clones were subjected to colony PCR on LB plates with kanamycin resistance (Kana) and chloramphenicol resistance (Chl) using primers Sp-L1 and Sp-R. Positive colonies with amplification band size of 1.6 kb were picked by gel electrophoresis (such as Figure 3 The cells were shaken to obtain the desired product (as shown in c).

[0149] (2) Agrobacterium-mediated genetic transformation of rice callus

[0150] Using Agrobacterium (EHA105)-mediated rice (purple leaf indica) callus transformation, the super-multiple edited co-transformation vector combination 9Hn-5T1 and Hc-5T2 were transformed into rice callus. After hygromycin selection, the callus was induced to seedling and T was obtained. 0 Transformed plants.

[0151] (3) Amplification sequencing

[0152] Extraction of T by SDS 0 The leaf DNA of the transformed plants was used as a template to amplify the genomic DNA fragment containing the editing target site.

[0153] The PCR reaction system (15 μL) was as follows: 2× Taq Mix 7.5 μL, primers 0.3 μL each, DNA template 1 μL, ddH 2 Add 0.1% HO to make up to 15 μL.

[0154] The PCR reaction program was as follows: pre-denaturation at 95°C for 1 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, and 72°C for 30 s), and extension at 72°C for 1 min.

[0155] The PCR products were recovered and subjected to high-throughput sequencing.

[0156] (4) Analysis of sequencing results

[0157] The editing efficiency of 9Hn-5T1 and Hc-5T2 was statistically analyzed by aligning the sequencing results with the reference sequences.

[0158] 3. Evaluation of editing efficiency

[0159] (1) Positive detection of transformed plants

[0160] PCR assay was performed using leaf DNA from transformed rice plants as template to evaluate the co-transformation efficiency.

[0161] Gene detection primers F-Cas9-jc (TCCAAGTCCAGGCGTCTCGAG) / R-Cas9-jc (AGCTCACCAAGGT GGATCTG), F-HPTn-jc (AAGAATCTCGTGCTTTCAGC) / R-HPTn-jc (CATTGTT GGAGCCGAAATCC), and F-HPTc-jc (TGTATGGAGCAGCAGACGCG) / R-HPTc-jc (CTATTTCTTTGCCCTCGGAC) were designed on the nucleotide sequences encoding SpCas9, HPTn, and HPTc, respectively. The correct target band sizes were 600 bp, 500 bp, and 300 bp, respectively. The vector plasmid 9Hn-5T1 was successfully constructed as a positive control for Cas9 and HPTn, Hc-5T2 was used as a positive control for HPTc, and the empty vector 1300-Tnos-ccdB was used as a negative control. Figure 4 As shown in a, all 20 transformed seedlings were able to amplify the correct target band.

[0162] (2) Analysis of editing efficiency results

[0163] like Figure 4 As shown in b, in the successfully co-transformed T 0 In the positive plants of the first generation, the editing efficiency of 8 out of 10 targets reached more than 90%, the editing efficiency of OsFNSi-T1 was slightly lower (75%), and the editing efficiency of OsFLS-T2 was the lowest, only 5%, which may be due to the complex structure of the target site selection, which makes it difficult to bind and edit the site. Figure 4 As shown in c, 80% of the positive plants were able to edit more than 8 target sites at the same time, that is, the five genes of most plants were successfully knocked out at the same time.

[0164] (3) Phenotype of mutant plants

[0165] like Figure 4 As shown in d, the background of the transformed material is purple-leaf indica rice. The wild type shows purple rice leaves that can synthesize anthocyanins, while in mutant plants #16 and #18, the key genes F3'H and DFR in the anthocyanin synthesis metabolic pathway are knocked out, resulting in the inability to synthesize anthocyanins in their leaves, thus showing green leaf traits. From the sequencing results, it can be seen that 4 genes in #16 were successfully knocked out, while 5 genes in #18 were successfully knocked out.

[0166] In summary, this example constructs editing vectors 9Hn-5T1 and Hc-5T2 that assemble five sgRNA expression cassettes on 9Hn and Hc, and detects the genomic target sites of the co-transformed positive materials, indicating that it is feasible to segment the resistance screening marker gene through the intein strategy to group the super-multiple sgRNA expression cassettes to achieve super-multiple editing, which reduces the difficulty of assembling the super-multiple sgRNA expression cassettes while improving their structural stability and has an efficient editing effect on each target site.

[0167] Example 3 Golden gate-Gibson assembly combined with super-multiple sgRNA expression cassette assembly

[0168] In order to construct more sgRNA expression cassettes on the co-transformation vector for split agent screening, this example adopts Figure 2 The Golden gate-Gibson assembly combined with the super-multiple sgRNA expression cassette assembly method shown in a in FIG. 15 sgRNA expression cassettes (such as Figure 5 In the first round, 12 sgRNA expression cassettes were assembled in the forward direction by Golden gate, and in the second round, 3 sgRNA expression cassettes were assembled in the reverse direction by Gibson assembly. The following uses 9Hn-V1-15T as an example to provide a specific method for constructing a super-multiple sgRNA expression cassette.

[0169] 1. First round: Golden gate cloning assembles 12 sgRNA expression cassettes and 3 sgRNA expression cassettes respectively

[0170] like Figure 5 b and Figure 5 As shown in c, 19 key genes affecting rice agronomic traits including grain type, plant type, yield, etc. were selected, and 30 target sites (divided into two groups, V1 and V2, 15 each) were designed through the online program CRISPR-GE webpage (http: / / skl.scau.edu.cn / ) (Xie et al., 2018, Molecular plant, 11:720-735) and the first round of PCR amplification primers for constructing sgRNA expression cassettes were generated (as shown in Table 3), and the use method was consistent with Example 2.

[0171] Table 3 Primer information for the first round of PCR amplification (taking the construction of the sgRNA expression cassette of 1300-Cas9::Hn as an example)

[0172]

[0173] Assemble targeting on 9Hn vector Figure 5 The construction method of the sgRNA expression cassettes of V1T1 to V1T12 shown in b is basically the same as that of Example 2, except that the primer pairs used in the second round of PCR amplification of the 12 sgRNA expression cassettes are Pps-R / Pgs-2 (T1), Pps-2 / Pgs-3 (T2), Pps-3 / Pgs-4 (T3), Pps-4 / Pgs-5 (T4), Pps-5 / Pgs-6 (T5), Pps-6 / Pgs-7 (T6), Pps-7 / Pg s-8(T7), Pps-8 / Pgs-9(T8), Pps-9 / Pgs-10(T9), Pps-10 / Pgs-11(T10), Pps-11 / Pgs-12(T11), Pps-12 / Pgs-L(T12); at the same time, in order to improve the connection efficiency, gel cutting recovery was used in the second round of PCR product purification and recovery, and the sgRNA expression cassette amplification products using the same promoter were mixed and then gel cutting recovery to reduce the interference of non-specific products; the variable temperature cycle in the Golden gate cloning reaction program was increased to 16; colony PCR was performed to screen positive clones using Sp-L1 and Sp-R, and the target band was 3.8kb, such as Figure 6 a and Figure 6 As shown in b, the positive rate was 12.5% ​​(3 / 24).

[0174] Assemble the targeting vector 9Hn Figure 5 The construction method of the sgRNA expression cassettes of V1T13 to V1T15 shown in b is basically the same as that of Example 2, except that the primer pairs used in the second round of PCR amplification of the three sgRNA expression cassettes are Pps-R / Pgs-2 (T1), Pps-2 / Pgs-3 (T2), and Pps-3 / Pgs-L (T3), respectively.

[0175] After sequencing and comparison, the correctly cloned plasmids were extracted to obtain 9Hn-V1-12T and 9Hn-V1-3T, which were assembled with 12 sgRNA expression cassettes and 3 sgRNA expression cassettes, respectively.

[0176] 2. Second round: Gibson assembly to assemble V1T13~V1T15 sgRNA expression cassettes into 9Hn-V1-12T

[0177] The full length of the three sgRNA expression cassettes in 9Hn-V1-3T was amplified and the homology arms at both ends of the Pme I restriction site were extended for Gibson assembly and connected to the single endonuclease site Pme I of 9Hn-V1-12T.

[0178] In order to avoid the problem of low assembly efficiency or vector instability caused by too many repetitive sequences, the homologous arms extended from the primers for amplifying 3T were swapped so that they could be reversely assembled to the single endonuclease site Pme I of 9Hn-V1-12T, and the Pme I restriction enzyme recognition site sequence was retained downstream of the V1T13~V1T15 expression cassettes for enzyme verification, which can also be used for connection to new sgRNA expression cassettes.

[0179] (1) Full-length amplification of V1T13-V1T15 sgRNA expression cassette

[0180] Using 9Hn-V1-3T as a template, PCR amplification was performed using primers F-3T-PmeI-GA (caatatatcctgtcaaacactgatagtttaaacACCGGTAAGGCGCGCCGTAG) and R-3T-PmeI-GA (atcagattgtcgtttcccgccttcaAGCTCGAGAGGCGCGCCAAT) to obtain the full-length fragment of the V1T13 to V1T15 sgRNA expression cassette, which was recorded as V1-3T.

[0181] The PCR system (30 μL) was as follows: 2×Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, 9Hn-V1-3T vector 30 ng, 10 μM F-3T-PmeI-GA 0.5 μL, 10 μM R-3T-PmeI-GA 0.5 μL, ddH 2 Add HO to make up to 30 μL.

[0182] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 30 s), and extension at 72°C for 2 min.

[0183] (2) Enzyme digestion

[0184] The 3T fragment was purified using the Genstar purification kit, and the purified product was treated with Dpn I to eliminate the template. The enzyme digestion reaction system was: 1 μL of 10× Faster digest buffer, 1 μL of Dpn I, 450 ng of the purified product of the V1-3T fragment, ddH 2 O to 10 μL. The enzyme digestion reaction program is: 37℃ for 1h. 9Hn-V1-12T was digested with Pme I. The enzyme digestion reaction system is: 10×Cutsmart buffer 1μL, Pme I 1μL, 9Hn-V1-12T vector plasmid 900ng, ddH 2The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0185] (3) Connection

[0186] The 3T fragment after enzyme digestion and the 9Hn-V1-12T backbone were connected using the Gibson assembly reaction kit (NEB#E5510S). The connection reaction system was: 2×Mix 5μL, 3T fragment 45ng, 9Hn-V1-12T enzyme digestion product 90ng, ddH 2 The volume of HO was added to 10 μL. The ligation reaction procedure was: 50°C for 50 min.

[0187] Take 10 μL of the ligation product and heat-shock transform it into 100 μL of E. coli DH5α competent cells. Use primers F-PmeI-jc (GCTGGCGTAATAGCGA AGAG) and R-RB-jc (GAACCCTGTGGTTGGCAT) to screen the transformed single clones on kanamycin-resistant (Kana) LB plates. Pick out single colonies with a target band size of 1 kb by gel electrophoresis for testing (the results are shown in Figure 2). Figure 6 a and Figure 6 The results of colony PCR showed that although the second round of assembly lacked the negative screening marker of the ccdB lethal gene, the positive rate was still high, reaching 54.2% (13 / 24). The positive clones identified as having the correct sequence by sequencing were retained, and the plasmid was extracted to obtain 9Hn-V1-15T.

[0188] By the same method, Hc-V2-15T can be obtained.

[0189] 3. Stability verification of carrier 9Hn-V1-15T

[0190] The stability of editing vectors assembled with multiple sgRNAs in prokaryotic cells reflects, to a certain extent, whether they are stable during genetic transformation. Therefore, it is crucial to verify the integrity of super-multiple editing vectors in Escherichia coli and Agrobacterium.

[0191] (1) Target-specific primer PCR verification

[0192] like Figure 6As shown in a, the target sequence in sgRNA was used as a specific primer sequence to pair and amplify with sp-L1 and sp-R to verify the stability of 9Hn-V1-15T and Hc-V2-15T in Escherichia coli and Agrobacterium. Using the vector plasmid for assembling 15 sgRNA expression cassettes as a template, Sp-L1 and T6R were used to amplify the fragment ① of 6 sgRNA expression cassettes, with a size of about 2kb; T6F and T10R were used to amplify the fragment ② of 4 sgRNA expression cassettes, with a size of about 1.2kb; T10R and Sp-R were used to amplify the fragment ③ of 2 sgRNA expression cassettes, with a size of about 0.7kb; F-PmeI-jc and R-RB-jc were used to amplify the fragment ④ of 3 sgRNA expression cassettes, with a size of about 1kb.

[0193] The correctly sequenced 9Hn-V1-15T and Hc-V2-15T vector plasmids and the plasmid extracted after picking a single colony of transformed Agrobacterium were used as templates, and the above-mentioned primer combinations were used for amplification verification.

[0194] The PCR system (30 μL) was as follows: 2× Phanta Max Buffer 15 μL, 10 mM dNTPs Mix 0.5 μL, PhantaMax Polymerase 0.5 μL, 9Hn-V1-15T / Hc-V2-15T vector plasmid 30 ng, 10 μM Sp-L1 / T6R or T6F / T10R or T10R / Sp-R or F-PmeI-jc / R-RB-jc 0.5 μL each, ddHO 2 Add HO to make up to 30 μL.

[0195] The PCR program was as follows: pre-denaturation at 95°C for 2 min, 30 PCR cycles (95°C for 10 s, 56°C for 15 s, 72°C for 2 min / 1 min / 30 s / 1 min), and extension at 72°C for 2 min.

[0196] The obtained PCR products were verified by agarose gel electrophoresis. Figure 6 As shown in Figure d, the fragments ① to ④ amplified using the plasmid extracted from the single clone of transformed Agrobacterium as a template are consistent in size with the fragments ① to ④ amplified using the correct vector plasmid, indicating that the 9Hn-V1-15T and Hc-V2-15T vectors maintain a stable structure in Agrobacterium.

[0197] (2) Plasmid Asc I restriction enzyme digestion verification

[0198] like Figure 6As shown in a, when the 3T fragment is amplified, its homology arms contain Asc I at both ends, so the assembled sgRNA expression cassette group can be verified by AscI single enzyme digestion. The editing vector without assembled sgRNA expression cassette will obtain a ccdB expression cassette fragment of 700bp after Asc I digestion; while the vector with 15 sgRNA expression cassettes will obtain 12 sgRNA expression cassettes and 3 sgRNA expression cassettes after Asc I digestion, with the full length of the fragments, which are 3.8kb and 1kb respectively, and the vector backbone (about 420bp) between the two groups of sgRNA expression cassettes.

[0199] The sequenced E. coli single colony was shaken and plasmids were extracted, and the obtained 9Hn-V1-15T and Hc-V2-15T vector plasmids were digested with Asc I. The digestion reaction system was: 10×Cutsmart buffer 1μL, Asc I 1μL, 9Hn-V1-15T / Hc-V2-15T vector plasmid 600ng, ddH 2 The volume of HO was added to 10 μL. The enzyme digestion reaction procedure was: 37°C for 1 h.

[0200] At the same time, the single Agrobacterium colony with correct PCR detection was shaken and plasmid extracted, then transformed into Escherichia coli, and a single clone was picked for shaking, plasmid extraction and enzyme digestion verification to detect its stability in Agrobacterium. The enzyme digestion reaction system and procedure were the same as above.

[0201] The digested products were verified by agarose gel electrophoresis. Figure 6 As shown in Figure e, the vector plasmids of 9Hn-V1-15T and Hc-V2-15T were digested with Asc I to obtain the target bands. 9Hn and Hc were empty vector controls that were also digested with Asc I, and only the ccdB band was obtained, indicating that the 9Hn-V1-15T and Hc-V2-15T vectors maintained stable structures in Escherichia coli and Agrobacterium.

[0202] From the above results, it can be seen that the construction process of the multiple sgRNA expression cassette assembled through two rounds is simple, has a high positive rate, and can maintain a stable structure in Agrobacterium, which can ensure the integrity of the T-DNA region transferred into the plant.

[0203] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A carrier combination, characterized in that: The invention comprises a binary vector 1 for expressing a fusion protein of a nuclease sequentially connected to the N-terminal part of a selection marker gene HPT and the N-terminal part of an intein, and a binary vector 2 for expressing a fusion protein of a C-terminal part of a selection marker gene HPT connected to the C-terminal part of an intein; the amino acid sequence of the N-terminal part of HPT is shown in SEQ ID NO.3, and the amino acid sequence of the N-terminal part of the intein is shown in SEQ ID NO.4; the nuclease and the N-terminal part of HPT are connected in series via a 2A self-cleaving peptide; the amino acid sequence of the C-terminal part of HPT is shown in SEQ ID NO.5, and the amino acid sequence of the C-terminal part of the intein is shown in SEQ ID NO.

6.

2. The carrier assembly according to claim 1, characterized in that: The nuclease is CRISPR / Cas9 or CRISPR / Cas12.

3. The carrier assembly according to claim 1, characterized in that: Both ends of the nuclease are provided with nuclear localization signals.

4. The carrier assembly according to claim 1, characterized in that: The 2A self-cleaving peptide is a F2A self-cleaving peptide.

5. The carrier assembly according to claim 1, characterized in that: The fusion protein in binary vector 1 is expressed by Pubi promoter; the fusion protein in binary vector 2 is expressed by 35S promoter.

6. Use of the vector combination of any one of claims 1 to 5 in super-multiple gene editing of plants.

7. Use of the vector combination according to any one of claims 1 to 5 in the preparation of a product for super-multiple gene editing in plants.

8. A co-transformation vector system for super-multiplex gene editing, characterized in that: The system contains the vector combination according to any one of claims 1 to 5, and also contains reagents required for Golden gate cloning and / or Gibson assembly.

9. A method for super-multiple gene editing in plants, characterized in that: The following steps are involved: S1. Design and construct multiple sgRNA expression cassettes for gene editing targets; S2. inserting the multiple sgRNA expression cassettes in S1 into the binary vector 1 and / or 2 in the vector combination; S3. Binary vectors 1 and 2 are transformed into Agrobacterium, respectively, and transformed into plants using Agrobacterium-mediated genetic transformation.

10. Use of the method according to claim 9 in constructing plant multi-gene mutants.

Images