Plant gene editing vector and method for performing gene editing in plant

Abstract

The invention relates to a plant gene editing vector and a method for performing gene editing in a plant, a specific plant intron sequence is inserted into a Cas gene to construct an iCas vector with a high-efficiency gene editing function, so that the expression level and genome editing efficiency of the iCas vector in tobacco are remarkably improved; and a new strategy is provided for plant genome editing.

Description

Technical Field

[0001] The present disclosure relates to the technical field of plant molecular biology and genetic engineering, and in particular, to a vector for plant gene editing and a method for performing gene editing in plants. Background Art

[0002] As an extremely efficient gene editing tool, the CRISPR / Cas system has been widely used in many biological fields, and has shown great potential in plant genome editing. However, in some plants, especially dicotyledonous plants such as tobacco, the editing efficiency of Cas12 nuclease on their genomes is unsatisfactory, which greatly limits the application and expansion of this technology in complex plant genome editing. Due to its large molecular weight, Cas proteins are easily regarded as exogenous proteins by plant cells, which in turn triggers a degradation mechanism, resulting in poor expression stability, which seriously hinders the efficiency and durability of gene editing. At the same time, gRNA or crRNA is also very susceptible to degradation in plant cells, which not only reduces the accuracy of editing, but also significantly increases the risk of low editing efficiency. In addition, the expression level of traditional Cas genes in plants is generally not high, and there is a lack of intron optimization design, which fails to fully utilize the regulatory function of plant endogenous introns to enhance the transient expression level and stability of Cas proteins.

[0003] In addition, the lack of compatibility of different promoters in plant genomes has also brought bottlenecks. Most of the existing gene editing vectors are unable to adapt to the specific requirements of different plant species for promoters, resulting in difficulty in optimizing the expression of nucleases and gRNA or crRNA, affecting the editing effect. In summary, the degradation problem caused by the large size of Cas protein, the instability of gRNA or crRNA, the lack of promoter compatibility, the lack of suitable endogenous intron optimization design, and the low targeting specificity have made the existing plant gene editing technology face great challenges in improving efficiency and stability.

[0004] Therefore, there is an urgent need to provide technological innovations and improvements to promote the widespread application of plant gene editing in agricultural improvement, functional gene research and bioengineering. Summary of the invention

[0005] The purpose of the present invention is to provide a vector and method with efficient gene editing function, and to provide a new strategy for plant genome editing.

[0006] In order to achieve the above-mentioned object, the present disclosure provides a plant gene editing vector, which contains a Cas gene inserted with an exogenous intron, wherein the exogenous intron is at least one of the introns with nucleotide sequences as shown in SEQ ID NO.1-9.

[0007] Optionally, the Cas gene includes at least one of Cas9, Cas12a and Cas12i3.

[0008] Optionally, when the Cas gene is a Cas9 gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown in SEQ ID NO.10.

[0009] Optionally, when the Cas gene is a Cas12a gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown in SEQ ID NO.11.

[0010] Optionally, when the Cas gene is the Cas12i3 gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown as SEQ ID NO.12.

[0011] Optionally, a promoter, a guide RNA insertion region, a Cas gene promoter, an NLS, the Cas gene inserted with an exogenous intron, an NLS and an UBQ terminator are sequentially inserted into the vector.

[0012] Optionally, the promoter includes a type II promoter and / or a type III promoter; the nucleotide sequence of the type II promoter is shown in SEQ ID NO.13; the nucleotide sequence of the type III promoter is shown in SEQ ID NO.14; The guide RNA insertion region includes a gRNA insertion region and / or a crRNA insertion region; When the Cas gene is a Cas9 gene, the guide RNA insertion region is a gRNA insertion region, and the nucleotide sequence of the gRNA insertion region is shown in SEQ ID NO.15; When the Cas gene is a Cas12a gene, the guide RNA insertion region is a CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.16; When the Cas gene is a Cas12i3 gene, the guide RNA insertion region is a CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.17; The nucleotide sequence of the UBQ terminator is shown in SEQ ID NO.18.

[0013] In another aspect, the present disclosure provides a method for performing gene editing in a plant, the method comprising the following steps: (1) inserting a guide RNA coding sequence targeting the gene to be edited into the guide RNA insertion region of the above-mentioned vector to obtain a gene editing vector; (2) introducing the gene editing vector into Agrobacterium to obtain a transformant; (3) Infecting the pre-cultured plant leaves with the transformant, and culturing the infected plant leaves in a culture medium containing hygromycin.

[0014] Optionally, when the Cas gene in the vector is the Cas9 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO.19.

[0015] When the Cas gene in the vector is the Cas12a gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 20; When the Cas gene in the vector is the Cas12i3 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 21.

[0016] Optionally, the plant includes at least one of a monocot, a dicot, an algae, and a moss; The dicotyledonous plant includes at least one of tobacco, tomato, soybean, cotton, pepper, rape, eggplant, cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, winter grass, Phalaenopsis and Dendrobium officinale; The monocotyledonous plant includes at least one of rice, wheat, corn, sorghum, wild rice, millet, sugarcane, bamboo, onion, leek, ginger, banana and lily; The algae and bryophytes include at least one of green algae, blue algae, euglena, golden algae, dinoflagellates, brown algae, red algae, liverwort, gourd moss, fine-leaved feather moss, golden moss, true moss and large gray moss; Preferably, the plant is tobacco.

[0017] Through the above technical scheme, the present disclosure provides a vector and method for plant gene editing. By inserting a specific plant intron sequence into the Cas gene, an iCas vector with efficient gene editing function is constructed, which significantly improves its expression level and genome editing efficiency in tobacco, and provides a new strategy for plant genome editing.

[0018] Other features and advantages of the present disclosure will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 Schematic diagram of the gene editing vector containing intronic Cas nuclease.

[0020] Figure 2 Comparative analysis of the expression levels and homozygous gene editing efficiency of common Cas9 and intronic Cas nuclease (iCas9).

[0021] Figure 3 Comparative analysis of intronic MAD7 (iMAD7) and common MAD7 in tobacco genome editing.

[0022] Figure 4 Comparison of the editing efficiency of the PDS gene between codon-optimized nCas12i3 and intronic Cas12i3 (iCas12i3) in transient transformation of Nicotiana benthamiana.

[0023] Figure 5 Comparison of genome editing efficiency of nCas12i3 and iCas12i3 in stable transformation of tobacco.

[0024] Figure 6 Analysis of the editing efficiency of intronic Cas nucleases and guide sequences driven by different promoters. DETAILED DESCRIPTION

[0025] The specific implementation of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0026] In a first aspect, the present disclosure provides a vector for plant gene editing, which contains a Cas gene inserted with an exogenous intron, wherein the exogenous intron is at least one of the introns whose nucleotide sequences are shown in SEQ ID NO.1-9.

[0027] The present disclosure provides the 15th to 23rd introns of a specific Arabidopsis thaliana LRR-RLK receptor kinase ERECTA as exogenous introns, which are inserted into the Cas gene to construct a vector with efficient gene editing function. The nucleotide sequences of the 15-23 introns are shown in SEQ ID NO.1-9, and the above 9 introns differ in their sequence structure, length, nucleotide composition, etc. These differences will cause them to exhibit different characteristics when interacting with the Cas gene and functioning in plant cells, providing a variety of options for selecting suitable exogenous introns according to different plant species, editing targets, and experimental requirements.

[0028] Optionally, the Cas gene includes at least one of Cas9, Cas12a and Cas12i3.

[0029] When constructing a plant gene editing vector, the present invention can select one or more Cas genes from Cas9, Cas12a and Cas12i3 for combined application according to factors such as the specific plant species, gene editing target, experimental conditions, and the desired editing effect, so as to optimize the gene editing process and improve the success rate and effectiveness.

[0030] Preferably, when the Cas gene is a Cas9 gene, the nucleotide sequence of the Cas gene with an exogenous intron inserted therein is as shown in SEQ ID NO.10; When the Cas gene is a Cas12a gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown in SEQ ID NO.11; When the Cas gene is the Cas12i3 gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown in SEQ ID NO.12.

[0031] In the above preferred embodiment, the present invention selects specific exogenous introns for insertion into specific Cas genes, thereby achieving multi-faceted optimization of plant gene editing.

[0032] Optionally, a promoter, a guide RNA insertion region, a Cas gene promoter, an NLS, the Cas gene inserted with an exogenous intron, an NLS and an UBQ terminator are sequentially inserted into the vector.

[0033] The promoter is a specific DNA sequence located upstream of the gene. It plays a key role as a "switch" in the gene expression process, and determines when, where, and to what extent the entire gene editing system begins to transcribe and synthesize the corresponding RNA in plant cells. Guide RNA can recognize and specifically bind to the target DNA sequence during the gene editing process, and guide the Cas protein to accurately locate the genomic site that needs to be edited. The guide RNA insertion region is a specific region reserved for inserting the designed gRNA and / or crRNA, which facilitates researchers to flexibly insert the corresponding gRNA and / or crRNA that can target specific gene sequences according to different plant gene editing goals, thereby achieving precise editing of different plant genes, greatly increasing the targeting specificity and flexibility of the gene editing system. The Cas gene is the core executive element in the gene editing system. The Cas protein (such as Cas9, Cas12a, etc.) encoded by it has the key function of cutting DNA, ensuring that there is sufficient and appropriate amount of Cas protein in the cells and stages where gene editing is required to complete editing operations such as cutting the target DNA, while avoiding problems such as off-target risks caused by overexpression. NLS guides the Cas protein to be accurately recognized and transported into the cell nucleus during intracellular transport, ensuring that subsequent gene editing activities can be carried out smoothly in the nuclear environment where the genome is located. The UBQ terminator marks the end of the entire gene editing-related gene transcription process, allowing transcription to terminate at the appropriate location, ensuring that the generated RNA has the correct length and structure, and avoiding the endless transcription process and the generation of abnormal RNA transcripts, thereby ensuring that subsequent gene expression activities such as translation based on the RNA can be carried out normally and orderly, and ensuring the correct expression and function of each component of the gene editing system.

[0034] Optionally, the promoter includes a type II promoter and / or a type III promoter; the nucleotide sequence of the type II promoter is shown in SEQ ID NO.13; the nucleotide sequence of the type III promoter is shown in SEQ ID NO.14; The guide RNA insertion region includes a gRNA insertion region and / or a crRNA insertion region; When the Cas gene is a Cas9 gene, the guide RNA insertion region is a gRNA insertion region, and the nucleotide sequence of the gRNA insertion region is shown in SEQ ID NO.15; When the Cas gene is a Cas12a gene, the guide RNA insertion region is a CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.16; When the Cas gene is a Cas12i3 gene, the guide RNA insertion region is a CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.17; The nucleotide sequence of the UBQ terminator is shown in SEQ ID NO.18.

[0035] In another aspect, the present disclosure provides a method for performing gene editing in a plant, the method comprising the following steps: (1) inserting a guide RNA coding sequence targeting the gene to be edited into the guide RNA insertion region of the above-mentioned vector to obtain a gene editing vector; (2) introducing the gene editing vector into Agrobacterium to obtain a transformant; (3) Infecting the pre-cultured plant leaves with the transformant, and culturing the infected plant leaves in a culture medium containing hygromycin.

[0036] Optionally, when the Cas gene in the vector is a Cas9 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is as shown in SEQ ID NO. 19; When the Cas gene in the vector is the Cas12a gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 20; When the Cas gene in the vector is the Cas12i3 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 21.

[0037] Optionally, the plant includes at least one of a monocot, a dicot, an algae, and a moss; The dicotyledonous plant includes at least one of tobacco, tomato, soybean, cotton, pepper, rape, eggplant, cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, winter grass, Phalaenopsis and Dendrobium officinale; The monocotyledonous plant includes at least one of rice, wheat, corn, sorghum, wild rice, millet, sugarcane, bamboo, onion, leek, ginger, banana and lily; The algae and bryophytes include at least one of green algae, blue algae, euglena, golden algae, dinoflagellates, brown algae, red algae, liverwort, gourd moss, fine-leaved feather moss, golden moss, true moss and large gray moss; Preferably, the plant is tobacco.

[0038] The present invention is further described in detail below by way of examples.

[0039] Example 1 This example provides the construction and application of a gene editing vector containing intronic Cas9 (iCas9).

[0040] The nine intron sequences of the LRR-RLK receptor kinase were inserted into the specific positions of the Cas9 gene in order to generate an iCas9 sequence containing introns (SEQ ID NO. 10). The iCas9 sequence was synthesized by a commercial synthesis company (BGI Liuhe) and stored for future use. By using the enzyme ligation method, the synthesized iCas9 gene replaced the sequence from NcoI to BamHI endonuclease in the pDC40 vector (see patent ZL202110786304.5 for vector information). After the vector construction was completed, the correctness of the vector was confirmed by electrophoresis and enzyme digestion. The correct vector was named pDC40-iCas9. The vector structure provided in the present disclosure is as follows: Figure 1 shown.

[0041] The sgRNA sequence GAGGCAAGAGATGTCCTAGG (SEQ ID NO.23) targeting the tobacco gene PDS was designed and inserted into pDC40 and pDC40-iCas9 vectors, respectively. The corresponding vector sequences containing the tobacco PDS target were named pDC40-PDS and pDC40-iCas9-PDS. The corresponding vectors were introduced into Agrobacterium EH105 by heat shock transformation. The three binary vectors of pDC40, pDC40-PDS and pDC40-iCas9-PDS with correct sequencing were transformed into Agrobacterium EH105 and stored at -80°C for future use. The leaves of wild cultivated tobacco Honghua Dajinyuan (HD) were infected by the optimized leaf disc transformation method, as follows: First, the leaves of sterile seedlings with good growth were cut into 1.0×1.0 cm leaf discs, and the leaf edges were removed and placed in MS medium. They were pre-cultured for 2 days at 28°C, 16 h / d of light time, and 2000 LX of light intensity. The preserved Agrobacterium culture solution was taken and cultured in LB medium containing 50 mg / L kanamycin and 10 mg / L rifampicin until OD600 reached about 1.0. The bacteria were collected after centrifugation at 4000 rpm for 10 minutes, resuspended in MS liquid medium to OD600 of 0.6, and 20 mg / L acetosyringone was added and allowed to stand for 30 minutes to 2 hours for infection. Then, the pre-cultured leaf discs were immersed in the Agrobacterium infection solution and gently shaken for 5 minutes. The infected leaves were blotted dry on sterile filter paper and placed on MS medium containing 1 mg / L 6-BA and 0.1 mg / L IBA, and co-cultured in the dark in an artificial climate chamber at 26°C and 40% humidity for 3 days.

[0042] After co-cultivation, the leaves were transferred to S1 differentiation medium (MS medium containing 1 mg / L 6-BA, 0.1 mg / L NAA and 8 mg / L hygromycin), with 6-8 leaves placed in each dish. After 2 days of dark culture, they were transferred to light conditions until 0.5 cm buds grew on the edge of the leaves. The buds were then transferred to S2 differentiation medium (MS medium containing 1 mg / L 6-BA, 0.1 mg / L NAA and 10 mg / L hygromycin) and continued to be cultured under light conditions for 1-2 weeks to allow the buds to develop into young plants. The number of albino seedlings in each leaf disk was counted and averaged. The results showed that no albino seedlings were found in any of the regenerated strains transformed with the empty vector pDC40. Unlike the pDC40 transformants, approximately 0.6 albino seedlings were obtained per explant in the pDC40-PDS transformed material, while approximately 1.85 albino seedlings were found in each explant in the pDC40-iCas9-PDS transformed material, which is more than three times the efficiency of the pDC40-PDS vector. This indicates that the Cas9 (hereinafter abbreviated as iCas9) containing 9 intron sequences of the receptor kinase constructed in this example has a more efficient editing efficiency in the tobacco genome. In order to further understand why introns improve the editing efficiency of Cas9, this example further extracted 5-8 pDC40, pDC40-PDS and pDC40-iCas9-PDS transformation shoots at the same time, and used the OminiPlant RNA extraction kit (CW2598S) of Kangwei Century to extract RNA of different transformation strains. According to the instructions, the corresponding cDNA was synthesized using the qHS qPCR Kit (Accurate Biology, AG11728, China) of Accurate Biotechnology. The expression level of Cas9 in tobacco callus was determined by qRT-PCR, with the Ntubc2 gene as the internal reference gene. The expression level of the candidate gene was 2 −ΔΔCT The method was used for quantification. The qRT-PCR internal reference gene Ntubc2 forward primer (5'-3'): CTGACATCTCCCGCACTCTTA (SEQ ID NO.24) and reverse primer (5'-3'): CATAGTCCATTCGTAGTTGAGCA (SEQ ID NO.25); Cas9 gene forward primer (5'-3'): CGAGAGAATGAAGCGGATCGA (SEQ ID NO.26) and Cas9 reverse primer (5'-3'): CTCTGAGGCACGATATGGTCC (SEQ ID NO.27). The results showed that the expression level of cas9 containing the kinase intron was increased by more than 2 times, as shown in the following figure. Figure 2 shown.

[0043] Example 2 This example provides the construction of a gene editing vector containing intron-containing Cas12 (iMAD7).

[0044] Based on the above discovery that the intron sequence improves the expression level of the class II Cas nuclease Cas9 and can improve its editing efficiency in the tobacco genome, this example further verifies that this kinase intron sequence can also enhance the class V Cas nuclease family Cas12, and selects MAD7 as the research object.

[0045] MAD7, also known as ErCas12a, is a nuclease protein belonging to the Type Va CRISPR-Cas system developed by INSCRIPTA in the United States. It is derived from Eubacterium rectale. MAD7 belongs to the same family of homologous proteins as LbCpf1 from Lachnospiraceae, FnCpf1 from Francisella, and AsCpf1 from Acidaminococcus, but the amino acid homology is very low. It is a new Cas12a nuclease. The MAD7 protein contains 1263 amino acids and is about 148kDa. INSCRIPTA's optimization of MAD7 has made it widely applicable in a variety of systems and has opened up the patent right to use the nuclease.

[0046] First, the 15th to 23rd intron sequences were inserted into the MAD7 gene in sequence and evenly, so that the original MAD7 gene was divided into small fragments of 180-620bp in size, and iMAD7 was designed (see the attachment for the specific sequence). The iMAD7 sequence was synthesized by a commercial synthesis company (HuaDa Liuhe) and saved for future use. Homologous recombination adapters were designed, and forward primers (5'-3'): atctcacaacagtggccatggccccaaagaagaagc (SEQ ID NO.28) and reverse primers (5'-3'): ttgataagagtctctggatcctcacttcttcttcttagcttg (SEQ ID NO.29) containing adapters were synthesized, and the synthesized iMAD7 template was amplified. The recovered fragments were inserted into the NcoI and BamHI double-enzyme linearized vector of the pDC45 vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Norwegian, C112-01). The reaction was as follows:

[0047] Gently mix the reaction solution, react at 37℃ for 30min; cool to 4℃ or immediately place on ice. Take 4μL of the ligation product and add it to 50μL DH5a competent cells, let it stand on ice for 30 min, heat shock in a 42℃ water bath for 45 sec, immediately place it on ice for 2-3 min, add 600μL LB liquid culture medium (without antibiotics), shake at 37℃ for 1h (speed 220 rpm), use a sterile coating rod to evenly spread about 500μL of bacterial solution on a plate containing 50mg / L kanamycin, invert in a 37℃ incubator, culture overnight, pick 4 clones and sequence with 1300-gRNA-F2 primers, and the correctly sequenced plasmid is named 1300-iMAD7 and stored at -20℃ for subsequent experiments.

[0048] The guide sequence of the Arabidopsis thaliana type III promoter AtU6-26 promoter-driven MAD7 nuclease (SEQ ID NO.16) was synthesized, and the forward primer (5'-3'): gccagtgccaagcttcctaggcattcggagtttttgtatctt (SEQ ID NO.30) and the reverse primer (5'-3'): Aacaatgaatctattcctgcagggtcacgctgcactcaaaaa (SEQ ID NO.31) containing a linker were synthesized to amplify the above synthetic fragment. The fused fragment was inserted into the AvrII and SbfI double-enzyme linearized vector of the 1300-iMAD7 vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Norwegian, C112-01), and finally the pDC-iMAD7 vector was constructed. The specific structure is shown in the figure. Figure 1 shown.

[0049] The original MAD7 without introns was inserted between the NcoI and BamHI linearization sites of the pDC-iMAD7 vector using the same method to construct the pDC-MAD7 vector.

[0050] Design the cultivated tobacco PDS target forward primer (5'-3'): agatgtagtagcgactccatggg (SEQ ID NO.32) and reverse primer (5'-3'): ggcccccatggagtcgctactac (SEQ ID NO.33), take 5 μL of 10 μM PDS forward primer: and reverse primer, add 40 μL 0.5 x TE buffer, mix well and put into PCR instrument, heat at 98℃ for 4min, then take out the PCR tube directly, cool to room temperature to obtain double-stranded DNA of the target site with sticky ends. At the same time, pDC-MAD7 and pDC-iMAD7 vectors were linearized by BsaI, and the linearized vectors were connected with double-stranded PDS-gRNA by T4 to form MAD7-PDS_sg and iMAD7-PDS_sg. The three binary vectors of pDC-iMAD7 (empty), MAD7-PDS_sg and iMAD7-PDS_sg with correct sequencing were transformed into Agrobacterium EH105 and stored at -80℃ for future use. The optimized leaf disc transformation method was used to infect wild red flower Dajinyuan (HD ) leaves, the genetic transformation method is as in Example 1, and the albino seedlings of the regenerated buds of 20 explants in the S2 period are counted. It is found that no albino seedlings are found in pDC-iMAD7 and MAD7-PDS_sg without targets, indicating that high-frequency homozygous editing cannot be achieved in the original MAD7 vector. On the contrary, when iMAD7 containing introns is used, about 0.3 albino (or chimeric white) regenerated buds are found, indicating that the intron MAD7 designed in this example can significantly improve the editing efficiency of MAD7. Figure 3 shown.

[0051] Example 3 In this example, a gene editing vector containing intronic Cas12 (iCas12i3) was constructed and used for gene editing in tobacco. The results showed that the vector significantly improved the efficiency of transient expression and stable editing of the tobacco genome.

[0052] In order to further confirm that the LRR-RLK kinase intron designed in the present disclosure has an effect on improving the editing efficiency of Cas nuclease, this embodiment tests the V-type Cas12 nuclease Cas12i3 with independent intellectual property rights. Cas12i3 nuclease can achieve relatively efficient gene editing in rice (Ping Lv et al., 2024; Zhiqiang Duan et al., 2024). This embodiment uses tobacco codon preference to optimize the sequence in the document to synthesize a new Cas12i3 (nCas12i3), and the sequence is shown in SEQ ID NO.22. In addition, the 15th to 23rd intron sequences are uniformly inserted into the nCas12i3 gene in sequence, so that the original nCas12i3 gene is divided into small fragments of 180-430bp interval size, and iCas12i3 (as shown in SEQID NO.12) is designed. The iCas12i3 sequence is synthesized by a commercial synthesis company (HuaDa Liuhe) and stored for standby.

[0053] A homologous recombination linker was designed, and a forward primer (5'-3'): Atctcacaacagtggccatggggccaaagaagaagcg (SEQ ID NO.34) and a reverse primer (5'-3'): ttgataagagtctctggatccttaacctcttgcacgtt (SEQ ID NO.35) containing a linker were synthesized. The synthesized iCas12i3 template was amplified, and the recovered fragment was inserted into the NcoI and BamHI double-enzyme linearized vector of the pDC45 vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Norwegian, C112-01). The specific operation is shown in Example 2. The plasmids with correct sequencing were named 1300-nCas12i3 and 1300-iCas12i3. The guide sequence driven by the type III promoter AtU6-26 of iCas12i3 was artificially synthesized (SEQ ID NO.16). The forward primer (5'-3'): gccagtgccaagcttcctaggcattcggagtttttgtatctt (SEQ ID NO.36) and the reverse primer (5'-3'): Aacaatgaatctattcctgcagggtcacgctgcactcaaaaa (SEQ ID NO.37) containing a linker were synthesized. The above synthetic fragments were amplified, and the fragments after fusion were inserted into 1300-nCas12i3 using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Norwegian, C112-01). The nCas12i3 and 1300-iCas12i3 vectors were linearized by double enzyme digestion with AvrII and SbfI, and finally the pDC-nCas12i3 and pDC-iCas12i3 vectors were constructed. In order to clarify the improvement of the editing efficiency of introns in Cas12i3 nuclease, this example uses the Nicotiana benthamiana transient expression system. First, the Nicotiana benthamiana NbPDS target sequence is designed, the target forward primer (5'-3'): acacgtagtagcgactccatgggg (SEQ ID NO.38) and the reverse primer (5'-3'): ggccccccatggagtcgctactac (SEQ ID NO.39), 5 μL of 10 μM NbPDS forward primer and reverse primer are taken respectively, 40 μL of 0.5 x TE buffer is added, the mixture is placed in a PCR instrument, heated at 98 ° C for 4 min, and then the PCR tube is directly taken out and cooled to room temperature to obtain the double-stranded DNA of the target site with sticky ends.At the same time, pDC-nCas12i3 and pDC-iCas12i3 were linearized by BsaI, and the linearized vectors were connected with double-stranded NbPDS-gRNA by T4 to finally form nCas12i3-PDS_sg and iCas12i3-PDS_sg. The three binary vectors of pDC-nCas12i3 (empty), nCas12i3-PDS_sg and iCas12i3-PDS_sg with correct sequencing were transformed into Agrobacterium EH105. Single clones were picked from the Agrobacterium containing the above EH105 and cultured overnight in the corresponding antibiotics. 1 ml of the small shake culture was inoculated into 50 ml of LB medium containing the corresponding antibiotics for overnight shaking growth. Agrobacterium was precipitated by centrifugation at 5000 rpm and the OD value of the enriched Agrobacterium was adjusted to 0.5 with a resuspension solution (100 mM magnesium chloride, 10 mM morpholineethanesulfonic acid, 0.1 mM acetosyringone). The back leaves of Nicotiana benthamiana were injected using a 1 ml syringe. Leaves from the injection area about 3 days after the injection were taken, and every 3-5 leaves injected with the same vector were mixed into one tube. The DNA of the edited material was extracted using the genome extraction kit EasyPure® Plant Genomic DNA Kit (Quanshijin, EE111-12). The editing status of different vectors was determined by high-throughput sequencing, wherein the forward primer was ggagtgagtacggtgtgctgggaactgaaagtcaagatg (SEQ ID NO.40), and the reverse primer was gagttggatgctggatggcctccaaatagttaactgtattgtc (SEQ ID NO.41); the amplified fragment was sent to the Hitom high-throughput sequencing platform of the Rice Research Institute for sequencing analysis, and the results are as follows. Figure 4 shown.

[0054] The stable transformation efficiency of iCas12i3 includes transferring the iCas12i3 vector containing a specific plant intron into Agrobacterium, and infecting it into tobacco (such as Honghua Dajinyuan) leaves through the optimized leaf disc transformation method. After editing, the albino seedlings of the regenerated buds in the S2 period were counted. The results showed that iCas12i3 can significantly improve the knockout efficiency of the target gene compared with Cas12 without introns. No albino / chimeric tobacco edited seedlings were found in nCas12i3, but a higher rate of albino / chimeric edited seedlings were found in S2 using iCas12i3. The results are as follows Figure 5 As shown, the intron-optimized iCas12i3 vector has a higher stable expression efficiency in gene editing. This improvement makes iCas12i3 an effective tool for plant functional gene research and crop breeding.

[0055] Example 4 This example is used to determine whether iCas nuclease has strong gRNA and crRNA compatibility.

[0056] The above-mentioned iCas nucleases disclosed in the present invention all use type III promoter as the driving promoter of gRNA or crRNA to obtain better editing effects. In order to further confirm the compatibility of iCas nuclease with type II promoter, whether the editing efficiency is affected by the presence of two type II promoters (iCas nuclease is driven by type II promoter).

[0057] In this example, the following vector, pDC45A-iCas9, was constructed. Figure 1 As shown, the specific operation is as follows: the company synthesized the tRNA-sgRNA-EU terminator driven by the 35S promoter, and added SpeI and SbfI restriction endonuclease sites at the 5' and 3' ends, respectively. The above sequence was introduced between the SpeI and SbfI sites of pDC40-iCas9 by enzyme ligation method, and finally the pDC45A-iCas9 vector was formed. The sgRNA sequence GAGGCAAGAGATGTCCTAGG (SEQ ID NO.42) targeting the tobacco gene PDS was designed and inserted into the pDC45A-iCas9 vector linearized by BsaI to form pDC45A-iCas9-PDS_sg. The leaf disc method was used to transform into HD leaves, and the number of albino seedlings was counted to evaluate the compatibility and editing efficiency of gRNA. It was found that the type II promoter driving gRNA and iCas9 respectively could obtain a more efficient editing efficiency than the type III promoter.

[0058] In order to further explore the compatibility of iCas12i3 with type II promoter-driven crRNA, this example synthesizes 2X35S promoter-driven tRNA, named 35S::tRNA-DR-HDV-EU (SEQ ID NO.45). Using a forward primer (5'-3') with a linker: gccagtgccaagcttactagttacggaggtcaaa (SEQ ID NO.43) and a reverse primer (5'-3'): aacaatgaatctattcctgcagtcataactgtagaaa (SEQ ID NO.44), the above-mentioned template synthesized was amplified, and the recovered fragment was inserted into the AvrII and SbfI double-enzyme linearized vector of the iCas12i3-PDS_sg vector using a homologous recombination kit (ClonExpress II One Step Cloning Kit, Norwegian, C112-01), and the final vector was named pDC65-iCas12i3-PDS_sg.

[0059] In the subsequent leaf disc transformation experiment, the number of albino seedlings on HD tobacco leaves was counted to evaluate the editing efficiency of iCas12i3. Figure 6 As shown in the results, iCas12i3 maintained a high editing efficiency under the 35S drive system crRNA and exhibited extremely strong crRNA compatibility, enabling it to still have efficient editing capabilities under different promoter systems. This achievement further established the wide adaptability of iCas12i3 in plant genome editing and provided a reliable and efficient tool for complex genome editing.

[0060] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0061] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0062] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A vector for plant gene editing, characterized in that: The vector comprises a Cas gene inserted with an exogenous intron, wherein the exogenous intron is at least one of the introns whose nucleotide sequences are shown in SEQ ID NO.1-9.

2. The carrier according to claim 1, wherein The Cas gene includes at least one of Cas9, Cas12a and Cas12i3.

3. The carrier according to claim 2, wherein When the Cas gene is the Cas9 gene, the nucleotide sequence of the Cas gene with the exogenous intron inserted is shown in SEQ ID NO.

10.

4. The carrier according to claim 2, wherein When the Cas gene is a Cas12a gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown in SEQ ID NO.

11.

5. The carrier according to claim 2, wherein When the Cas gene is the Cas12i3 gene, the nucleotide sequence of the Cas gene inserted with an exogenous intron is shown in SEQ ID NO.

12.

6. The carrier according to claim 1, wherein The vector is sequentially inserted with a promoter, a guide RNA insertion region, a Cas gene promoter, an NLS, the Cas gene with an exogenous intron inserted therein, an NLS and a UBQ terminator.

7. The carrier according to claim 6, wherein The promoter includes a type II promoter and / or a type III promoter; the nucleotide sequence of the type II promoter is shown in SEQ ID NO.13; the nucleotide sequence of the type III promoter is shown in SEQ ID NO.14; The guide RNA insertion region includes a gRNA insertion region and / or a crRNA insertion region; When the Cas gene is a Cas9 gene, the guide RNA insertion region is a gRNA insertion region, and the nucleotide sequence of the gRNA insertion region is shown in SEQ ID NO.15; When the Cas gene is a Cas12a gene, the guide RNA insertion region is a CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.16; When the Cas gene is a Cas12i3 gene, the guide RNA insertion region is a CrRNA insertion region, and the nucleotide sequence of the CrRNA insertion region is shown in SEQ ID NO.17; The nucleotide sequence of the UBQ terminator is shown in SEQ ID NO.

18.

8. A method for gene editing in plants, characterized in that: The method comprises the following steps: (1) inserting a guide RNA coding sequence targeting a gene to be edited into the guide RNA insertion region of the vector according to any one of claims 1 to 7 to obtain a gene editing vector; (2) introducing the gene editing vector into Agrobacterium to obtain a transformant; (3) Infecting the pre-cultured plant leaves with the transformant, and culturing the infected plant leaves in a culture medium containing hygromycin.

9. The method according to claim 8, wherein: When the Cas gene in the vector is the Cas9 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 19; When the Cas gene in the vector is the Cas12a gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO. 20; When the Cas gene in the vector is the Cas12i3 gene, the nucleotide sequence of the guide RNA targeting the gene to be edited is shown in SEQ ID NO.

21.

10. The method according to claim 8, wherein: The plant comprises at least one of a monocot, a dicot, an algae and a moss; The dicotyledonous plant includes at least one of tobacco, tomato, soybean, cotton, pepper, rape, eggplant, cabbage, lettuce, kale, potato, peanut, cucumber, watermelon, sunflower, strawberry, radish, citrus, alfalfa, poplar, Arabidopsis, sesame, quinoa, sesbania, grape, apple, pear, kiwi, chrysanthemum, dandelion, winter grass, Phalaenopsis and Dendrobium officinale; The monocotyledonous plant includes at least one of rice, wheat, corn, sorghum, wild rice, millet, sugarcane, bamboo, onion, leek, ginger, banana and lily; The algae and bryophytes include at least one of green algae, blue algae, euglena, golden algae, dinoflagellates, brown algae, red algae, liverwort, gourd moss, fine-leaved feather moss, golden moss, large gray moss and true moss; Preferably, the plant is tobacco.

Images