Application of OsSCL28 gene in regulating and controlling phosphorus deficiency stress tolerance of rice

Abstract

The invention belongs to the technical field of biological gene engineering, and particularly relates to application of an OsSCL28 gene in regulating and controlling phosphorus deficiency stress resistance of rice. According to the invention, the rice gene OsSCL28 is knocked out from target rice, so that the obtained transgenic rice has higher tolerance in a low-phosphorus state, and a guarantee is provided for improving the tolerance of plants to phosphorus deficiency and cultivating a new rice variety suitable for phosphorus-depleted soil. Meanwhile, the morphological characteristics of the rice can be regulated and controlled by knocking out the OsSCL28 gene. According to the method for preparing the phosphorus deficiency resistant rice based on the gene editing technology, a foundation is laid for regulation and control of agronomic characters of the rice and rice phosphorus absorption stress breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, and particularly relates to application of OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress. Background Art

[0002] During the growth of rice, rice can absorb and utilize a variety of nutrients, among which phosphorus is an indispensable and important nutrient. For plants, phosphate (Pi) is a major participant in many metabolic processes of plants, including photosynthesis, respiration, energy transfer, signal transduction, macromolecular biosynthesis, etc., so phosphorus is one of the necessary nutrients required by plants. Phosphorus mainly exists in the form of inorganic phosphates and is distributed in the root system and leaves of rice, helping to promote the development of the root system, enhance the ability to resist pests and diseases, and improve the tolerance of rice to adversity (such as drought, salinity, etc.). Phosphorus is easily fixed in the soil, relatively difficult to move, and has low effectiveness, so it is necessary to apply phosphorus fertilizer in production to increase crop yield. Since plants have low access to effective phosphorus in the soil, plants have already obtained absorbable phosphates through morphological, physiological, chemical and molecular adaptability.

[0003] When phosphate is used as fertilizer, it is easy to form insoluble complexes with oxides and hydroxides of calcium, aluminum and iron, and it is also fixed by microbial activities. Plant roots can only absorb 20% to 30% of the applied phosphorus fertilizer, and the rest is lost, eventually leading to environmental problems such as eutrophication of water bodies. Therefore, it is crucial to discover the relevant genes in rice that can promote phosphorus absorption and ensure that rice can absorb sufficient phosphorus during its growth period to increase rice yield and improve food quality. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress. By knocking out the rice gene OsSCL28 from the target rice, the obtained transgenic rice has higher tolerance under low phosphorus conditions, which provides a guarantee for improving the plant's tolerance to phosphorus deficiency and cultivating new rice varieties suitable for phosphorus-poor soils.

[0005] The present invention provides an application of an OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress. The nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1.

[0006] As a preferred embodiment, the regulation is to improve the rice's tolerance to phosphorus deficiency stress after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

[0007] As a preferred embodiment, the rice includes Nipponbare.

[0008] The present invention also provides a method for improving the tolerance of rice to phosphorus deficiency stress, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome;

[0009] The nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1; the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO.2.

[0010] As a preferred embodiment, the knockout method comprises transforming a gene editing vector into rice to obtain rice with improved tolerance to phosphorus deficiency stress;

[0011] The gene editing vector includes the OsSCL28 gene or the CDS sequence of the OsSCL28 gene.

[0012] The present invention also provides a gene editing vector for knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene, wherein the basic skeleton of the gene editing vector comprises a Cas9Pubi-H vector.

[0013] As a preferred embodiment, the gene editing vector includes a sgRNA sequence;

[0014] The sgRNA sequence includes the sgRNA sequence of target 1 and the sgRNA sequence of target 2;

[0015] The nucleotide sequence of the sgRNA of target 1 is shown in SEQ ID NO.3;

[0016] The nucleotide sequence of the sgRNA of target 2 is shown in SEQ ID NO.4.

[0017] The present invention also provides a method for creating a rice variety tolerant to phosphorus stress, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

[0018] The present invention also provides the use of the OsSCL28 gene in regulating rice morphology, wherein the nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1;

[0019] The regulation is to promote the growth of rice plant height and root length after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

[0020] The present invention also provides a method for promoting the growth of rice plant height and root length, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

[0021] Beneficial effects: The present invention provides an application of the OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress. The present invention knocks out the rice gene OsSCL28 from the target rice, and the resulting transgenic rice has higher tolerance under low-phosphorus conditions, which provides a guarantee for improving the plant's tolerance to phosphorus deficiency and cultivating new rice varieties suitable for phosphorus-poor soils. At the same time, knocking out the OsSCL28 gene can regulate the morphological characteristics of rice. The method for preparing phosphorus-deficiency-tolerant rice based on gene editing technology disclosed in the present invention lays a foundation for the regulation of rice agronomic traits and rice phosphorus absorption adversity breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0023] Figure 1 This is a schematic diagram of constructing the gene editing vector in Example 1;

[0024] Figure 2 It is the positive detection of the scl28 gene editing system and the sequence mutation of the knockout mutant in Example 1; wherein A is the positive detection of the scl28 gene editing system, P is the constructed vector bacterial solution as a positive control, N is the DNA of Nipponbare as a negative control, scl28T0 is the T0 plant of the scl28 gene editing system, and DL2000 is a 2000bp DNA marker; B is the mutation site information of the gene editing systems scl28#1 and scl28#2, the solid inverted triangle indicates the relative position of the ATG start, the arrow indicates the insertion and deletion position of the base, - indicates base deletion, + indicates base insertion, and the scale is 200bp;

[0025] Figure 3 Schematic diagram of the structure of OsSCL28 gene isoforms and alternative splicing detection in Example 2; wherein A is a schematic diagram of the structure of different splicing isoforms of the OsSCL28 gene, filled rectangles represent exons, thin lines represent introns, and unfilled rectangles represent 5'-UTR and 3'-UTR. The vertical arrows and "*" indicate the start codon and the stop codon, respectively, and the scale is 200 bp; BC is the verification of the alternative splicing of OsSCL28, Figure B is spliceosome 1, and the amplified length is 732 bp; Figure C is spliceosome 2, and the amplified length is 717 bp; the sampling sites and periods include R, S, L, Inode, DBF, DF, DAF1, DAF3, DAF5, DAF7, DAF9, DAF15, DAF25, from left to right are roots, stems, leaves, internodes, spikelets before flowering, spikelets at flowering, and spikelets on the 1st, 3rd, 5th, 7th, 9th, 15th and 25th days after flowering, N is the negative control with ddH2O as the template, and DL5000 is a 5000 bp molecular marker;

[0026] Figure 4 The positive detection and expression analysis of the OsSCL28 gene overexpression line plants in Example 2; wherein Figure A is the positive detection of the overexpression lines OE#1 and OE#2, P is the constructed vector bacterial solution as a positive control, N is the DNA of Nipponbare as a negative control, OE#1 and OE#2 are respectively OsSCL28 overexpression lines, and DL2000 is a 2000bp molecular marker; Figure B is the relative expression level determination of the OsSCL28 gene overexpression line, the expression method is mean ± standard deviation, each group of data has three biological replicates, "*" indicates the significance of the difference, "***" <0.001; "**" <0.01;

[0027] Figure 5 The morphological characteristics of the plants under normal conditions and phosphorus deficiency treatment in Example 3; wherein Figure AB is the morphological characteristics of the plants under normal conditions and phosphorus deficiency treatment, Nip is the wild type, the gene editing lines are scl28#1 and scl28#2, the overexpression lines are OE#1 and OE#2, Figures A and B are the morphological characteristics of the plants after 21 days of growth under normal phosphorus (200 μM) or phosphorus deficiency (0 μM), respectively, and the scale is 10 cm; Figures CD are root system scans under normal conditions and phosphorus deficiency treatment, respectively, and Figures EF are plant height and root length data of the plants under normal conditions and phosphorus deficiency treatment, respectively, and the representation method is mean ± standard deviation, and each group of data has three biological replicates, and lowercase letters indicate the significance of the expression difference between the experimental group and the control, and different letters indicate that there is a significant difference in expression between the experimental group and the control;

[0028] Figure 6 The physiological and biochemical indexes of the plants under normal conditions and phosphorus deficiency treatment in Example 4 are measured; Figure A is the root activity measurement of the plants under normal conditions and phosphorus deficiency treatment, Figure B is the acid phosphatase activity measurement of the plants under normal conditions and phosphorus deficiency treatment, Figure C is the total phosphorus content measurement of the roots of the plants under normal conditions and phosphorus deficiency treatment, and Figure D is the total phosphorus content measurement of the stems and leaves of the plants under normal conditions and phosphorus deficiency treatment. Nip is the wild type, the gene editing lines are scl28#1 and scl28#2, and the overexpression lines are OE#1 and OE#2. After growing for 21 days under normal phosphorus (200 μM) or phosphorus deficiency (0 μM) conditions, the physiological and biochemical indexes of the plants are measured, and the expression method is mean ± standard deviation. There are three biological replicates for each group of data. Lowercase letters indicate the significance of the expression difference between the experimental group and the control, and different letters indicate that there is a significant difference in expression between the experimental group and the control. DETAILED DESCRIPTION

[0029] The present invention provides an application of an OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress, wherein the regulation is to improve the phosphorus deficiency stress tolerance of rice after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in a target rice genome; the rice includes Nipponbare.

[0030]

[0031] As a specific embodiment, the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO. 2: 5'-ATGGCCGGGTACCGGAGCCGGAGCCGGAGCTACAGCCCGCAGCCGCGCCGGAGGTA -3'.

[0032] The present invention also provides a method for improving the tolerance of rice to phosphorus deficiency stress, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome; the nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1; the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO.2.

[0033] As a specific embodiment, the method of improving the phosphorus deficiency tolerance of rice of the present invention comprises: transferring a gene editing vector containing the OsSCL28 gene or the CDS sequence of the OsSCL28 gene into Agrobacterium EHA105, and transforming the overexpression vector into the target rice genome by an Agrobacterium-mediated transgenic method to obtain rice with improved phosphorus deficiency tolerance. As a specific embodiment, the basic skeleton of the recombinant vector can be a Cas9Pubi-H vector.

[0034] As a specific embodiment, the gene editing vector includes an sgRNA sequence; the sgRNA sequence includes an sgRNA sequence of target 1 and an sgRNA sequence of target 2;

[0035] As a specific embodiment, the sgRNA nucleotide sequence of target 1 is shown in SEQ ID NO.3: 5'-CGCGGTACAAGCGGTACGA-3';

[0036] As a specific embodiment, the sgRNA nucleotide sequence of target 2 is shown in SEQ ID NO.4: 5'-GCTAGACGTGACTACAGGTA-3'.

[0037] As a specific embodiment, the root activity of the gene-edited plants scl28#1 and scl28#2 was higher than that of the wild type Nip under both normal conditions and phosphorus-deficient conditions. Under normal conditions, the scl28#1 line was 47.13% higher than the wild type and the scl28#2 line was 22.26% higher than the wild type. Under phosphorus-deficient conditions, the scl28#1 line was 161.96% higher than the wild type and the scl28#2 line was 38.39% higher than the wild type. The measured values ​​of the overexpression lines OE#1 and OE#2 were lower than those of the wild type Nip.

[0038] As a specific embodiment, the acid phosphatase activity of gene-edited plants scl28#1 and scl28#2 is significantly higher than that of wild-type Nip, with the activity increased by about 3 times. The total phosphorus content of the roots of gene-edited plants scl28#1 and scl28#2 is higher than that of wild-type Nip under normal conditions or phosphorus-deficient conditions, and the total phosphorus content of the roots of overexpression lines OE#1 and OE#2 is lower than that of wild-type Nip under both culture conditions.

[0039] The present invention also provides a method for creating a rice variety tolerant to phosphorus stress, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

[0040] The present invention also provides an application of the OsSCL28 gene in regulating rice morphology, wherein the regulation is to promote the growth of rice plant height and root length after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome; the nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1.

[0041] The present invention also provides a method for promoting the growth of rice plant height and root length, comprising the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

[0042] As a specific embodiment, after culturing for 21 days under normal culture conditions, the plant heights of the gene-edited plants scl28#1 and scl28#2 were higher than those of the wild-type Nip, and the root lengths were longer than those of the wild-type Nip; the plant heights of the overexpression lines OE#1 and OE#2 were lower than those of the wild-type Nip, and the root lengths were shorter than those of the wild-type Nip. After culturing for 21 days under phosphorus-deficient culture conditions, the root lengths of the gene-edited plants scl28#1 and scl28#2 were significantly longer than those of the wild-type Nip.

[0043] To further illustrate the present invention, the application of the OsSCL28 gene provided by the present invention in regulating the tolerance of rice to phosphorus deficiency stress is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0044] Unless otherwise specified, the present invention has no special requirements for the preparation raw materials, and commercially available products known to those skilled in the art can be used.

[0045] Example 1 Construction of OsSCL28 gene editing vector, genetic transformation, and acquisition and identification of editing lines

[0046] The gene knockout vector was constructed using CRISPR / Cas9 technology to obtain the OsSCL28 gene editing vector, which was then transformed into the rice variety Nipponbare (Rice variety "Nipponbare" [J]. Agricultural Science and Technology Communications, 1973, (02): 31.) to obtain a gene editing line.

[0047] The steps include:

[0048] 1. Construction of OsSCL28 gene editing vector

[0049] Target design: Use the online target design tool (http: / / skl.scau.edu.cn / targetdesign / ) to design targets and select two targets located in the exon region of the target gene.

[0050] Target 1 sequence: 5'-CGCGGTACAAGCGGTACGA-3' (as shown in SEQ ID NO. 3);

[0051] The sequence of target 2: 5'-GCTAGACGTGACTACAGGTA-3' (as shown in SEQ ID NO. 4).

[0052] Vector construction: Cas9Pubi-H vector (Ma Convenient,High-EfficiencyMultiplex Genome Editing in Monocot and Dicot Plants.Mol Plant.2015Aug;8(8):1274-84.doi:10.1016 / j.molp.2015.04.007.Epub 2015Apr 24.PMID:25917172.). The vector was constructed according to the method reported by the team of Academician Liu Yaoguang ([1] MaX, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants [J]. Mol Plant, 2015, 8(8): 1274-1284. [2] Lei Y, Lu L, Liu HY, et al. CRISPR-P: a web tool for synthetic single-guide RNA design of CRISPR-system in plants [J]. Mol Plant, 2014, 7(9): 1494-1496.). Figure 1 As shown, gRNA is connected to the vector to obtain a gene editing vector.

[0053] 2. Genetic transformation of gene editing vectors

[0054] The constructed gene editing vector was transformed into EHA105 competent cells. The competent cells were purchased from Weidi Biotechnology Co., Ltd., catalog number: AC1010S.

[0055] Transform the constructed and sequenced vector plasmid into Agrobacterium competent cells for subsequent infection experiments. The specific steps are as follows:

[0056] (1) Take out 100 μL of Agrobacterium competent cells from the -80°C refrigerator, thaw on ice until it is in an ice-water mixture, add 10 μL of gene editing vector, pipette and mix, then freeze in liquid nitrogen for 5 min, bath in 37°C water for 5 min, and then bath on ice for 5 min;

[0057] (2) The product was transferred to a clean bench, 600 μL of LB liquid medium without antibiotics was added, and then the product was revived in a shaking incubator at 28°C and 200 rpm for 2 h;

[0058] (3) 100 μL of the revived Agrobacterium culture solution was applied to a solid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin resistance, the plate was inverted, and cultured at 28°C for 3 days;

[0059] (4) Pick a single clone from the plate and culture it in a liquid LB medium containing 50 mg / L kanamycin and 50 mg / L rifampicin resistance, and then perform bacterial liquid PCR to screen positive clones to obtain Agrobacterium containing the gene editing vector.

[0060] Rice genetic transformation using Agrobacterium containing gene editing vectors, rice genetic transformation reagent preparation:

[0061] 20×N6 macroelement mother solution: 56.6gKNO3, 3.32g CaCl2·2H2O, 3.7gMgSO4·7H2O, 8gK2HPO4, 9.26g(NH4)2SO4, make up to 1L with water.

[0062] 100×N6 trace element mother solution: 0.08gKI, 0.16g H3BO3, 0.44gMnSO4·4H2O, 0.15gZnSO4·7H2O, make up to 1L with water.

[0063] 100× iron salt mother solution: 2.78g FeSO4·7H2O, 3.73g Na2·EDTA·2H2O, make up to 1L with water.

[0064] 20×RFIII / HF macro-element mother solution: 33g NH4NO3, 38g KNO3, 8.8g CaCl2·2H2O, 7.4g MgSO4·7H2O, 3.4g KH2PO4, make up to 1L with water.

[0065] 100×RFIII / HF trace element mother solution: 2.23g MnSO4·4H2O, 0.86g ZnSO4·7H2O, 0.0025g CuSO4·5H2O, 0.0025g CoCl2·6H2O, 0.083g KI, 0.62g H3BO3, 0.025g NaMoO4·2H2O, make up to 1L with water.

[0066] 20×AA macro-element mother solution: 6g KCl, 0.3g CaCl2·2H2O, 0.5g MgSO4·7H2O, 0.3g NaH2PO4, make up to 1L with water.

[0067] 100×B5 trace element mother solution: 0.075g KI, 0.3g H3BO3, 1g MnSO4·4H2O, 0.2g ZnSO4·7H2O, 0.025g NaMoO4·2H2O, 0.0025g CuSO4·5H2O, 0.0025g CoCl2·6H2O, make up to 1L with water.

[0068] Organic mother solution: inositol: 10 mg / mL, glycine: 2 mg / mL, nicotinic acid (VB3): 1 mg / mL, pyridoxine hydrochloride (VB6): 1 mg / mL, thiamine hydrochloride (VB1): 10 mg / mL.

[0069] 20×AB Buffer: 60gK2HPO4, 20gNaH2PO4, dilute to 1L with water, adjust pH=7.2, sterilize at high temperature and high pressure, and store at room temperature.

[0070] 20×AB Salt: 20g NH4Cl, 6g MgSO4·7H2O, 3g KCl, 0.24g CaCl2·2H2O, 0.05g FeSO4·7H2O, make up to 1L with water, sterilize at high temperature and high pressure, and store at room temperature.

[0071] Plant growth hormone mother solution: 2,4-D: 5 mg / mL, KT: 1 mg / mL, 6-BA: 1 mg / mL, NAA: 1 mg / mL. Other mother solutions: Kanamycin sulfate (Kan): 50 mg / mL, Rifampicin (Rif): 25 mg / mL, Acetosyringone (AS): 100 mM, Timitin: 300 mg / mL, Hygromycin (Hyg): 50 mg / mL.

[0072] Preparation of rice genetic transformation medium:

[0073] AB medium: 5g glucose, 15g agar powder, dilute to 900mL, sterilize at high temperature and high pressure, add 50mL AB Buffer, 50mL AB Salt, 1mL 50mg / mL Kan and 1mL 50mg / mL Rif, pour into a plate for later use.

[0074] N6D solid culture medium: 50mL20×N6 macroelement stock solution, 10mL100×N6 trace element stock solution, 10mL100×iron salt stock solution, 10mL10mg / mL inositol, 1mL2mg / mL glycine, 0.5mL1mg / mLVB3, 0.5mL1mg / mLVB6, 0.1mL10mg / mLVB1, 0.45mL0.25mg / mL 2,4-D, 0.3g hydrolyzed casein, 2.878g proline, 30g sucrose, make up to 1L with water, adjust pH=5.8, add 7g agar powder, sterilize at high temperature and high pressure, pour into plates for later use.

[0075] AAM liquid culture medium: 50mL20×AA macroelement stock solution, 10mL 100×B5 trace element stock solution, 10mL100×iron salt stock solution, 10mL 10mg / mL inositol, 3.75mL2mg / mL glycine, 1mL 1mg / mLVB3, 1mL 1mg / mLVB6, 1mL 10mg / mLVB1, 0.9g glutamine, 0.177g arginine, 0.3g aspartic acid, 0.5g hydrolyzed casein, 18g glucose, 20g sucrose, make up to 1L with water, adjust pH=5.2, sterilize at high temperature and high pressure, and store at room temperature.

[0076] 2N6-AS solid culture medium: 50mL20×N6 macroelement mother solution, 10mL100×N6 trace element mother solution, 10mL100×iron salt mother solution, 10mL10mg / mL inositol, 1mL2mg / mL glycine, 0.5mL1mg / mLVB3, 0.5mL1mg / mLVB6, 0.1mL10mg / mLVB1, 0.45mL0.25mg / mL2,4-D, 0.3g hydrolyzed casein, 10g glucose, 30g sucrose, make up to 1L with water, adjust pH=5.2, add 7g agar powder, sterilize at high temperature and high pressure, cool and add 1mL100mMAS under sterile conditions and pour into plates for use.

[0077] N6DS solid culture medium: After N6D solid culture medium is sterilized by high temperature and high pressure, add 0.4 mL 5 mg / mL 2,4-D, 1 mL 300 mg / mL Timitin and 1 mL 50 mg / mL Hyg under sterile conditions after cooling, and pour into a plate for later use.

[0078] Preparation of REIII solid culture medium: 50mL 20×RFIII / HF macroelement stock solution, 10mL 100×RFIII / HF trace element stock solution, 10mL 100×iron salt stock solution, 10mL 10mg / mL inositol, 1mL2mg / mL glycine, 0.5mL 1mg / mLVB3, 0.5mL 1mg / mLVB6, 0.01mL 10mg / mLVB1, 30g sucrose, make up to 1L with water, adjust pH=5.8, add 7g agar powder, sterilize at high temperature and high pressure, add 2mL 1mg / mLKT and 0.2mL 1mg / mLNAA after cooling, pour into plates for later use.

[0079] Preparation of HF solid culture medium: 50mL20×RFIII / HF macroelement stock solution, 10mL 100×RFIII / HF trace element stock solution, 10mL 100×iron salt stock solution, 10mL 10mg / mL inositol, 1mL2mg / mL glycine, 0.5mL 1mg / mLVB3, 0.5mL 1mg / mLVB6, 0.01mL 10mg / mLVB1, 30g sucrose, make up to 1L with water, adjust pH=5.8, add 7g agar powder, sterilize at high temperature and high pressure, pour into plates for later use.

[0080] Rice genetic transformation steps:

[0081] (1) Callus induction: Rice grains were shelled, and clean and plump seeds were selected and placed in a conical bottle. They were disinfected with 70% ethanol for 1 min, the ethanol was discarded, and the seeds were washed twice with ddH2O. 50 mL of 25% NaClO was added for disinfection for 20 min. The NaClO was discarded and the seeds were washed six times with ddH2O. The seeds were placed on sterile filter paper to absorb surface moisture and allowed to stand for 20 min until the surface of the seeds was slightly dry. The rice seeds were placed on N6D solid culture medium, 30 seeds per dish, and exposed to continuous light at 28°C for 9 days.

[0082] (2) Activation of Agrobacterium: Streak the Agrobacterium culture containing the gene editing vector onto LB solid medium (containing 50 mg / L Kan + 50 mg / L R-Rif) and culture at 28°C for 3 days; pick 7 monoclonal colonies, resuspend the culture solution in 500 μL LB, aspirate 100 μL of the suspension and evenly spread it onto AB solid medium (containing 50 mg / L Kan + 50 mg / L R-Rif) and culture at 28°C for 72 h to obtain activated Agrobacterium.

[0083] (3) Callus infection: Use AAM medium to wash the activated Agrobacterium off the AB solid medium, fully suspend the bacterial solution and add it to 20 mL of AAM liquid medium. Adjust the bacterial solution concentration to OD 680=0.10, add 20 μL 100 mM acetosyringone, 28°C, 60 rpm, 1 h. Pick out callus tissue with good growth status and place it in a sterile flask, pour the activated Agrobacterium into the flask, shake the flask gently for 5 min; remove the bacterial solution, and place the callus tissue in a culture dish covered with sterile filter paper.

[0084] (4) Co-cultivation: Place a piece of filter paper on 2N6-AS solid culture medium and soak the filter paper evenly with 1 mL AAM + 20 μL 100 mM AS solution; place the infected callus on the filter paper and co-cultivate at 25°C in the dark for 3 days.

[0085] (5) Screening: The callus tissue after co-cultivation was collected into a sterile Erlenmeyer flask, rinsed with ddH2O for 7 times, and rinsed with ddH2O containing 300 mg / L Timitin for 3 times, each time standing for 5 min; the ddH2O was removed, the callus tissue was placed on sterile filter paper to fully absorb the water, and then placed on N6DS solid culture medium and exposed to light at 28°C for 2 weeks.

[0086] (6) Inducing differentiation: The resistant callus was transferred to REIII solid medium at 32°C under light. Green seedlings were differentiated after 2 weeks.

[0087] (7) Root induction: After the seedlings grow out, they are transferred to HF solid culture medium. When the seedlings grow to about the height of the bottle cap, ddH2O is added to train the seedlings, and positive detection and transplanting are performed.

[0088] 3. Acquisition and identification of editorial lines

[0089] Take the young leaves of the plant obtained in step 2., extract DNA (Lv Yaci. Research Progress of Plant DNA Extraction Methods [J]. Examination Weekly, 2011, (57): 176-177.), and perform positive detection and identification by PCR. The rice with Cas9 gene is positive rice. Named as gene editing line scl28T0.

[0090] The primers used for PCR identification are:

[0091] Forward primer Cas9-F1: 5'-TATCCCTCACCAGATCCACC-3' (as shown in SEQ ID NO.5);

[0092] Reverse primer Cas9-R1: 5′-AGCACCCTTGTCAACAACCT-3′ (as shown in SEQ ID NO.6).

[0093] The PCR reaction system is: 2 μL of the plant DNA sample to be tested, 0.5 μL of primers Cas9-F1 and 0.5 μL of Cas9-R1, 10 μL of PCR Master Mix, and the volume is made up to 20 μL with ddH2O.

[0094] The amplification enzyme used in PCR was PCR Master Mix, purchased from Yisheng Biotechnology Co., Ltd., catalog number: 10102ES03.

[0095] The PCR reaction program was as follows: pre-denaturation at 98°C for 5 min; 30 cycles of 98°C for 30 s, 55°C for 30 s, and 72°C for 30 s; final extension at 72°C for 5 min, and storage at 4°C.

[0096] Screening of positive plants of scl28T0 gene-edited transgenic rice ( Figure 2 The positive scl28T0 gene-edited transgenic rice was planted for generations to obtain T1 transgenic rice, which was sequenced and analyzed to obtain the gene-edited lines scl28#1 and scl28#2 ( Figure 2 In the gene editing line scl28#1, the 75th base G starting with ATG was deleted, and T was inserted between the 2596-2597th bases; in the gene editing line scl28#2, the six bases (CGCGGT) starting with ATG were deleted between the 71st and 76th bases, and the 16 bases (CTAGACGTGACTACAG) between the 2594th and 2610th bases (as shown in SEQ ID NO.7) were deleted. The insertion or deletion of these bases caused a frameshift mutation in the open reading frame, making OsSCL28 unable to be translated into a normal protein sequence, and thus unable to perform the original protein function.

[0097] Example 2 Construction of OsSCL28 gene overexpression vector, genetic transformation and acquisition of editing line

[0098] Through the integration of the National Rice Data Center, RAP and NCBI website analysis, it was found that the OsSCL28 gene may have two splice isoform sequences, splice 1 (as shown in SEQ ID NO.8) and splice 2 (as shown in SEQ ID NO.9). Figure 3 In order to verify whether the two spliceosomes are real, cDNA of tissue samples from various growth stages of Nipponbare was used as template for amplification, and the primer sequences were:

[0099] CDS.1 / 2-F: 5'-ATGGCCGGGTACCGGA-3' (shown in SEQ ID NO.10);

[0100] CDS.1-R: 5'-TCAGCTTTTCCCATCAACTGG-3' (as shown in SEQ ID NO.11);

[0101] CDS.2-R: 5'-TCAACGGCGTATCAGGATATG-3' (as shown in SEQ ID NO.12).

[0102] The nucleotide sequence of spliceosome 1 is as shown in SEQ ID NO.8: 5'-ATGGCCGGGTACCGGAGCCGGAGC CGGAGCTACAGCCCGCAGCCGCGCCGGAGGTACAGCCGGAGCCCCCCGCGGTACAAGCGGTACGATGACCCGCGCGACCGCTATCCTCGCGGCGGAGGTGGAGGTGGAGGTGGAGGCGAAGGGCCCCGCCGCGGGTATGGCCGGCCGCCTGCGCCGACCGGGCTCCTCGTCCGCAACATCTCGCTCACCGCAAGGCCTGAAGATATTCGTATTCCGTTTGAGCAATTTGGCCCT GTAAAGGATGTCTACCTTCCAAGAAATTTCCATACAAGGGAATTACGTGGCTTTGGGTTTGTAAAATTCCGCTATCCAGAAGATGCTGCAGTGGCCAAGCAAGAATTGAATCATCAAGTTATTGGTGGACGAGAGATTTCAATAGTTTTTGCCGAGGAGAACAGAAAAACCCCACAAGAAATGCGGATGAGGACAAGAACAAGTGGAAGATACATGGATGGTAGCCACAGAAGGCGGTCAGTATCAAGATCTCCAAGGTCTCGTTACCATTCTTATTCACCTTCACCCTCTCCAGCTAGACGTGACTACAGGGATCACCGTGATGATTATTCACCTGGGGAATCACTCTCTCCACATGGTCAGGACAAGCGGCACCACAGATCAAATGGTCGATCTGCTAGCCCAGATGAGCTCGAGCGTCATGTATCTCCATCCAATAATGGACATGGTCCTCCAGTTGATGGGAAAAGCTGA-3';

[0103] The nucleotide sequence of spliceosome 2 is shown in SEQ ID NO.9: 5'-ATGGCCGGGTACCGGAGCCGGAGC -3'.

[0104] Successfully amplified spliceosome 1 ( Figure 3 B), but spliceosome 2 could not be amplified in any tissue ( Figure 3 The above results indicate that in the real Nipponbare rice, only splicing isoform 1 exists.

[0105] In order to study whether the expression level of OsSCL28 will affect the morphological characteristics of rice, the overexpression binary vector pUN1301 was used to overexpress the spliceosome OsSCL28.1 (spliceosome 1 of the OsSCL28 gene), and the spliceosome OsSCL28.1 fragment was inserted between the EcoRI restriction sites to obtain the plasmid pUN1301-OsSCL28. Through plant tissue culture (see Example 1 for specific steps), an overexpression strain of the OsSCL28.1 spliceosome with a Nipponbare background was obtained (OE#1 and OE#2 in the figure). The plant tissue culture steps are the same as in Example 1. Positive T0 overexpression plants were identified by PCR, and their seeds were harvested and planted to obtain T1 plants, and then qRT-PCR was further used to screen plants with relatively high expression levels from the T1 strains ( Figure 4 ). The amplification enzyme used for fluorescent quantitative PCR was SYBR Green qPCR Master Mix, purchased from Yisheng Biotechnology Co., Ltd., catalog number: 11201ES08. The primer sequences used were:

[0106] qRT-PCR-OsSCL28-F: 5'-GAATCACTCTCTCCACATGGTCA-3' (as shown in SEQ ID NO. 13); qRT-PCR-OsSCL28-R: 5'-GATGGAGATACATGACGCTCG-3' (as shown in SEQ ID NO. 14).

[0107] The fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; amplification reaction phase at 95°C for 15 s, 55°C for 30 s, and 72°C for 45 s, with 40 amplification cycles; and melting curve at 95°C for 15 s, 65°C for 60 s, and 95°C for 15 s.

[0108] Example 3 OsSCL28 gene regulates rice morphological characteristics and morphological characteristics in response to phosphorus deficiency stress

[0109] The wild type (Nip), gene-edited lines (scl28#1 and scl28#2) and overexpression lines (OE#1 and OE#2) were cultured using complete rice culture medium.

[0110] The specific steps are as follows:

[0111] 1. Seed germination treatment:

[0112] Select rice seeds with full grains, immerse them in 10% H2O2 solution for disinfection for 30 minutes, rinse them repeatedly with deionized water, and then put them in a glass bottle and soak them in ddH2O for 24 hours.

[0113] When the seeds turn white, they are germinated in a constant temperature incubator at 37°C for 48 hours and then placed in an artificial climate chamber for growth.

[0114] Seeds with consistent germination potential were selected and placed in a 96-well hydroponic box and cultured using the complete culture medium of the International Rice Research Institute.

[0115] 2. Cultivation Methods

[0116] The experiment adopted the hydroponic culture method.

[0117] The complete nutrient solution for culture (using the complete culture solution formula of the International Rice Research Institute) consists of: 1.43mmol / LNH4NO3, 0.32mmol / LNaH2PO4 (200μM), 0.34mmol / LK2SO4, 1.00mmol / L CaCl2, 1.70mmol / LMgSO4, 9.10μmol / LMnCl2, 0.52μmol / L(NH4)6MoO4, 18.00μmol / LH3BO3, 0.15μmol / LZnSO4, 0.16μmol / L CuSO4, 36.00μmol / LFeCl3 and 70.00μmol / L citric acid.

[0118] After culturing in 1 / 2 concentration nutrient solution for 3 days, complete nutrient solution was used for culturing.

[0119] After 7 days of continuous cultivation, when the seedlings grew to the 3-leaf stage, normal treatment (phosphorus concentration in the nutrient solution was 200 μM) and phosphorus deficiency (phosphorus concentration in the nutrient solution was 0 μM) stress treatment were carried out in a 15 L hydroponic box.

[0120] Fourteen plants of each material were planted, and the rice seedlings were fixed with sponges, with three biological replicates.

[0121] The rice seedlings were placed in an artificial climate chamber with a temperature of 28°C / 23°C during the day and night and a light quantum flux density of 600 μmol / (m 2 ·s), photoperiod of 14h.

[0122] The nutrient solution was changed every 7 days, and the pH of the nutrient solution was 5.50. The positions of the pots were swapped each time the nutrient solution was changed to eliminate the marginal effect.

[0123] 3. Determination of morphological characteristics

[0124] After 21 days of stress treatment (normal treatment (phosphorus concentration in nutrient solution 200 μM) as control group, phosphorus deficiency treatment (phosphorus concentration in nutrient solution 0 μM) as stress treatment group), plant traits were investigated, and the investigation indicators were aboveground plant height and underground root length. The root system of the plant was scanned using a scanner.

[0125] The results are as follows Figure 5As shown in Table 1, after 21 days of cultivation under normal culture conditions, the plant heights of the gene-edited lines scl28#1 and scl28#2 were higher than those of the wild-type Nip, and the root lengths were longer than those of the wild-type Nip; in contrast, the plant heights of the overexpression lines OE#1 and OE#2 were lower than those of the wild-type Nip, and the root lengths were shorter than those of the wild-type Nip. In particular, after 21 days of cultivation under phosphorus-deficient culture conditions, the root lengths of the gene-edited lines scl28#1 and scl28#2 were significantly longer than those of the wild-type Nip.

[0126] Table 1 Plant height and root length under normal conditions and phosphorus deficiency treatment

[0127]

[0128]

[0129] Example 4 Determination of Physiological and Biochemical Indexes of OsSCL28 Gene Under Phosphorus Deficiency Induction

[0130] The wild type (Nip), gene-edited lines (scl28#1 and scl28#2) and overexpression lines (OE#1 and OE#2) were cultured according to the culture method used in Example 3 (normal treatment (phosphorus concentration in the nutrient solution 200 μM) as the control group, phosphorus deficiency treatment (phosphorus concentration in the nutrient solution 0 μM) as the stress treatment group). Samples were taken 21 days after the stress treatment, and the physiological and biochemical indicators of the plants were measured.

[0131] The root activity was determined using the TTC reduction method. (YAMAUCHIT. WATANABE K. FUKAZAWAA, et al. Ethylene and reactive oxygen species are involved in root aerenchymaformation and adaptation of wheat seedlings to oxygen-deficient conditions [J]. Journal of Experimental Botany, 2014. 65 (1): 261-273.)

[0132] The acid phosphatase activity was determined by the disodium p-nitrophenyl phosphate method. (Yan Kuan, Wang Changquan, Li Huanxiu, et al. Effect of phosphorus level on the acid phosphatase activity of hybrid rice and its parent roots [J]. Chinese Journal of Rice Science, 2010, 24(1): 43-48)

[0133] The total phosphorus content in the aboveground part and root of rice was determined by molybdenum antimony colorimetry. (She Bingyu, Xing Ai, Wang Zegang, et al. Study on the role of OsGRF1 gene in rice morphological and physiological response to low phosphorus stress [J]. Journal of Yangzhou University (Agriculture and Life Sciences Edition). 2023, 44(01): 8-20, 28)

[0134] Results Figure 6 As shown in Table 2, after culturing for 21 days under normal (200 μM phosphorus concentration in the nutrient solution) and phosphorus-deficient (0 μM phosphorus concentration in the nutrient solution) conditions, the root activity of all strains under phosphorus-deficient conditions was much lower than that under normal culture conditions, and the overall decrease was about 50%. The root activity of the gene-edited lines scl28#1 and scl28#2 was higher than that of the wild type Nip under both normal and phosphorus-deficient conditions. Under normal conditions, the scl28#1 line was 47.13% higher than the wild type, and the scl28#2 line was 22.26% higher than the wild type. Under phosphorus-deficient conditions, the scl28#1 line was 161.96% higher than the wild type, and the scl28#2 line was 38.39% higher than the wild type. The measured values ​​of the overexpression lines OE#1 and OE#2 were lower than those of the wild type Nip. After 21 days of cultivation under normal and phosphorus-deficient conditions, the acid phosphatase activity of all strains under phosphorus-deficient conditions was much higher than that under normal cultivation conditions. In particular, after 21 days of cultivation under phosphorus-deficient conditions, the acid phosphatase activity of gene-edited plants scl28#1 and scl28#2 was significantly higher than that of wild-type Nip, with an activity increase of about 3 times. In addition, in terms of total phosphorus content, after 21 days of cultivation under normal and phosphorus-deficient conditions, the total phosphorus content of all strains under phosphorus-deficient conditions was much lower than that under normal cultivation conditions, only about 1g / kg. The total phosphorus content of the roots of gene-edited plants scl28#1 and scl28#2 was higher than that of wild-type Nip under both cultivation conditions, but there was no difference in the total phosphorus content of stems and leaves under low phosphorus conditions; the total phosphorus content of the roots of overexpression strains OE#1 and OE#2 was lower than that of wild-type Nip under both cultivation conditions, but there was no difference in the total phosphorus content of stems and leaves.

[0135] Table 2 Physiological and biochemical indexes of plants under normal conditions and phosphorus deficiency treatment

[0136]

[0137]

[0138] It can be seen that the present invention knocks out the rice gene OsSCL28 from the target rice, and the resulting transgenic rice has a higher tolerance under low-phosphorus conditions, which provides a guarantee for improving the plant's tolerance to phosphorus deficiency and cultivating new rice varieties suitable for phosphorus-poor soils. At the same time, knocking out the OsSCL28 gene can regulate the morphological characteristics of rice. The method for preparing phosphorus-deficiency-tolerant rice based on gene editing technology disclosed in the present invention lays a foundation for the regulation of rice agronomic traits and rice phosphorus absorption adversity breeding.

[0139] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of OsSCL28 gene in regulating rice tolerance to phosphorus deficiency stress, characterized in that: The nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The regulation is to improve the rice's tolerance to phosphorus deficiency stress after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

3. The use according to claim 1, characterized in that: The rice includes Nipponbare.

4. A method for improving rice tolerance to phosphorus deficiency stress, characterized in that: The method comprises the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome; The nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1; the nucleotide sequence of the CDS of the OsSCL28 gene is shown in SEQ ID NO.

2.

5. The method according to claim 4, characterized in that The knockout method comprises transforming a gene editing vector into rice to obtain rice with improved tolerance to phosphorus deficiency stress; The gene editing vector includes the OsSCL28 gene or the CDS sequence of the OsSCL28 gene.

6. A gene editing vector for knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene, characterized in that: The basic framework of the gene editing vector includes a Cas9Pubi-H vector.

7. The gene editing vector according to claim 6, characterized in that The gene editing vector includes an sgRNA sequence; The sgRNA sequence includes the sgRNA sequence of target 1 and the sgRNA sequence of target 2; The nucleotide sequence of the sgRNA of target 1 is shown in SEQ ID NO.3; The nucleotide sequence of the sgRNA of target 2 is shown in SEQ ID NO.

4.

8. A method for creating a rice variety tolerant to phosphorus stress, characterized in that: The method comprises the following steps: knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

9. Application of OsSCL28 gene in regulating rice morphology, characterized in that: The nucleotide sequence of the OsSCL28 gene is shown in SEQ ID NO.1; The regulation is to promote the growth of rice plant height and root length after knocking out the OsSCL28 gene or the CDS sequence of the OsSCL28 gene in the target rice genome.

10. A method for promoting the growth of rice plant height and root length, characterized in that: The following steps are involved: The OsSCL28 gene or the CDS sequence of the OsSCL28 gene is knocked out in the target rice genome.

Images