Midnolin fusion protein plasmid as well as preparation method and application thereof

Abstract

The invention relates to the technical field of biology, in particular to midnolin fusion protein plasmids as well as a preparation method and application thereof. The midnolin fusion protein plasmid comprises a midnolin protein and a human papilloma virus E6 gene, the midnolin protein comprises a Catch1 structural domain located at the N end and a Catch2 structural domain located at the C end, and the human papilloma virus E6 protein is located between the Catch1 structural domain and the Catch2 structural domain. It is found that in cells, no matter endogenous E6 protein or overexpressed E6 protein cannot achieve autonomous efficient degradation and is difficult to become a target spot, fusion protein plasmids formed by the E6 gene and Midnolin protein can enhance the degradation efficiency of the E6 protein through proteasome and independent of ubiquitination, and therefore the immunogenicity of the E6 protein can be possibly enhanced.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a midnolin fusion protein particle and a preparation method and application thereof. Background Art

[0003] When stimulated by external factors, some proteins are expressed inside the cell. These proteins are expressed in a short period of time and degraded in a short period of time. The genes encoding such proteins are called immediate early genes. Midnolin protein is a key molecule that is widely present in eukaryotic cells and mediates the degradation of immediate early genes. The role of midnolin protein is to directly grab these proteins and pull them into the cellular waste disposal system called proteasome, where they are destroyed. Studies have shown that the N-terminal Catch1 and C-terminal Catch2 domains that fold together to form the Catch domain (i.e., the part of midnolin protein that effectively captures other proteins and sends them directly to the proteasome) recognize and bind to this folded region, further guiding the immediate early genes to the proteasome for degradation. This efficient degradation via the proteasome that is independent of ubiquitination has a unique application value. If Midnolin protein can be linked to certain proteins that need to be efficiently degraded, new application directions and new degradation strategies for Midnolin protein can be developed.

[0004] Human papillomavirus (HPV) can cause malignant tumors such as cervical cancer, which is currently a type of malignant tumor with extremely high morbidity and mortality in the female population. HPV is a DNA virus whose genome expresses multiple proteins, including L1 and L2 that constitute the viral capsid, as well as cytotoxic proteins such as E6 and E7. A series of vaccines have been produced for the prevention and treatment of HPV, including preventive vaccines and therapeutic vaccines. Preventive vaccines usually use L1 and L2 as their recognized antigens, while therapeutic vaccines usually use E7 protein as a target because E7 protein is an HPV oncogenic protein and can be rapidly degraded and presented.

[0005] Tumor immunity is currently a hot topic in tumor treatment methods, and HPV therapeutic vaccines use cellular immunity. In cellular immunity, antigen proteins need to be degraded in cells first, and then presented to the MHC complex on the cell surface through the endoplasmic reticulum, so that they can recognize each other with T cells and activate downstream immune responses. E7 protein can be rapidly degraded in cells, so the immune response produced by therapeutic vaccines with E7 as the target protein is more obvious, but the immune response produced by therapeutic vaccines with E6 protein as the target protein is often not as obvious as that of E7 protein, which may be because the degradation efficiency of E6 in cells is lower than that of E7 protein.

[0006] To solve the above problems, people try to connect ubiquitin molecules to E6 proteins to achieve rapid degradation of E6 proteins in cells. The ubiquitination degradation pathway is the main pathway for protein degradation in cells. Through the cooperation of E1 protein, E2 protein and E3 protein, multiple ubiquitin molecules are connected to the protein to be degraded to form a chain, and are guided to the proteasome or lysosome to achieve the degradation of the protein to be degraded. Although the efficient degradation of E6 protein can be achieved by forming a fusion protein particle using ubiquitin molecules and E6 proteins, the ubiquitin molecule itself is also a hot target for treatment and is prone to interfere with other drugs. Summary of the invention

[0007] In view of the above-mentioned shortcomings of the prior art, the present invention provides a midnolin fusion protein particle and a preparation method and application thereof to improve immunogenicity.

[0008] To achieve the above objectives, the scheme of this application is as follows: In a first aspect, the present invention provides a fusion protein plasmid, which includes a midbrain nucleolar protein and a human papillomavirus E6 gene, wherein the midbrain nucleolar protein includes a Catch1 domain located at the N-terminus and a Catch2 domain located at the C-terminus, and the human papillomavirus E6 protein is located between the Catch1 domain and the Catch2 domain.

[0009] Optionally, the fusion protein plasmid includes midbrain nucleolar protein and a human papillomavirus E6 gene inserted between alanine 216 and alanine 217 between the Catch1 domain and the Catch2 domain and / or a human papillomavirus E6 gene inserted between serine 281 and serine 282 between the Catch1 domain and the Catch2 domain.

[0010] In a second aspect, the present application also provides a method for preparing the fusion protein plasmid as described above, comprising the following steps: inserting the human papillomavirus E6 protein between the Catch1 domain and the Catch2 domain to obtain the fusion protein plasmid.

[0011] In a third aspect, the present application also provides the use of the fusion protein particle as described above or the fusion protein particle prepared according to the method as described above in the preparation of an anti-human papillomavirus vaccine.

[0012] In the present application, anti-human papillomavirus vaccine refers to a vaccine used to prevent or treat human papillomavirus.

[0013] Optionally, the fusion protein plasmid is degraded via the proteasome pathway.

[0014] Optionally, the fusion protein interacts with the proteolytic protein PSMD2.

[0015] In a fourth aspect, the present application also provides an anti-human papillomavirus vaccine, which includes the fusion protein particle as described above or the fusion protein particle prepared according to the method as described above.

[0016] Optionally, the anti-human papillomavirus vaccine further comprises a pharmaceutically acceptable carrier.

[0017] Optionally, the pharmaceutically acceptable carrier comprises at least one of liposomes, nanoparticles, microspheres, polymers and lipid nanoparticles.

[0018] In a fifth aspect, the present application also provides a pharmaceutical composition, which comprises the fusion protein particle as described above, or the fusion protein particle prepared according to the method as described above, or the anti-human papillomavirus vaccine as described above.

[0019] Beneficial effects of the present invention: The present application found that, within the cell, both endogenous and overexpressed E6 proteins cannot achieve autonomous and efficient degradation and are difficult to become targets. However, the fusion protein particle formed by the E6 gene and the Midnolin protein can enhance the degradation efficiency of the E6 protein via the proteasome and is independent of ubiquitination, thereby potentially enhancing its immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the structures shown in these drawings without paying creative work.

[0021] Figure 1 This is a graph showing the WT detection results in the intracellular proteasome degradation efficiency test; Figure 2 This is a diagram showing the results of Co-IP detection in the intracellular proteasome degradation efficiency test; Figure 3 This is a graph showing the results of the endogenous proteasome degradation efficiency test; Figure 4 This is the result of the 293T overexpression test; Figure 5 This is a diagram of the construction and verification of the Ub-E6 fusion protein plasmid; Figure 6It is a schematic diagram of the structure of Midnolin protein, ME62 fusion protein plasmid, and ME62 fusion protein plasmid; Figure 7 This is the predicted result diagram of the structure of the ME61 fusion protein particle; Figure 8 This is a diagram showing the detection results of ME61 fusion protein plasmid and ME62 fusion protein plasmid in the degradation pathway test of midnolin fusion protein plasmid; Fig. 9 This is a diagram showing the detection results of ME61 fusion protein plasmid and Bb-E6 fusion protein plasmid in the degradation pathway test of midnolin fusion protein plasmid; Fig.10 This is a diagram showing the results of an interaction test with the proteasome protein PSMDS2. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] In the following description, numerous details are discussed to provide a more thorough explanation of embodiments of the present invention; however, it is apparent to one skilled in the art that embodiments of the present invention may be practiced without these specific details.

[0024] 1. Proteasome degradation efficiency test in cells In order to evaluate the proteasome degradation efficiency of E6 and E7 in cells, the present application conducted a proteasome degradation efficiency test in cells, and the specific steps are as follows: S1.1 Construct pcDNA3.1-FLAG overexpression plasmids carrying E6 and E7 respectively. The specific steps are as follows: Using plasmids containing E6 and E7 (purchased from Jiutian Gene Technology (Tianjin) Co., Ltd.) as templates, PCR primers were designed (primers were synthesized by a biological company). The specific sequences are as follows: Forward amplification primer for E6 gene: GGTACCGAGCTCGGATCCATGATGCACCAGAAACGGACC; Reverse amplification primer for E6 gene: CTTGTAGTCCATCTCGAGAAGTTGTGTCTCTCTTCTGGTCC; Forward amplification primer for E7 gene: CTTGGTACCGAGCTCGGATCCATGCACGGCGATACCCCTA; Reverse amplification primer for E7 gene: ATCCTTGTAGTCCATCTCGAGGGGCTTCTGAGAACAGATAGGG; Among them, the plasmid construction steps of pcDNA3.1-E6-FLAG are as follows: The PCR amplification system was as follows: 1 μL of plasmid template, 1.25 μL of upstream amplification primer and downstream amplification primer (concentration 10 nM), 9 μL of ddH2O, and 12.5 μL of PrimeStar 2*Max; The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual to obtain the E6 gene amplification product for future use; BamH1 and Xho1 (both purchased from NEB) were used to digest the empty pcDNA3.1 plasmid. The system was as follows: 2 μg of plasmid, 2 μL of BamH1 enzyme, 2 μL of Xho1 enzyme, 5 μL of 10* SmartCut Buffer for digestion, and ddH2O was used to make up to 50 μL. The digestion was carried out at 37°C for 2 h to obtain the empty pcDNA3.1 digestion product, which was then separated by agarose electrophoresis. The specific steps were as follows: 0.4 g of agarose (commercially available) was used, 242 g of 1*TAE (Tris (Solarbio), 37.2 g of Na2EDTA·2H2O, 600 mL of ddH2O and 57.1 mL of glacial acetic acid were added, mixed, and fixed to 1 L with ddH2O to obtain 50* TAE; 50* TAE was diluted fifty times with ddH2O to obtain 1*TAE), heated in a microwave oven for 1 min, poured into a mold, cooled for 30 min, and the empty pcDNA3.1 digestion product sample was added with 10 μL 5* DNA Loading Buffer, and the E6 gene PCR product was added with 5 μL 5* DNA Loading Buffer and mixed evenly; Electrophoresis was performed using an electrophoresis apparatus, and the Marker (Biosharp) bands were aligned using an ultraviolet irradiator to cut the empty pcDNA3.1 digestion product and the E6 amplification product from the gel, and the gel recovery kit was used for recovery, and the steps were carried out according to the instructions of the commercially available gel recovery kit; the empty pcDNA3.1 digestion product and the E6 amplification product were obtained.

[0025] After the concentrations of the empty pcDNA3.1 digestion product and the E6 amplification product were determined using Nanodrop (Thermo Fisher), the empty pcDNA3.1 digestion product and the E6 amplification product were enzymatically linked using a one-step enzyme-linked kit according to the instructions; The enzyme-linked product of E6 and empty pcDNA3.1 digestion product was transformed into E. coli DH5α. The specific steps were as follows: take out the E. coli DH5α strain (commercially available) stored at -80°C, thaw on ice for 5 minutes, add all the enzyme-linked products to the bacterial solution, place on ice for 30 minutes, then heat shock at 42°C for 45 seconds, put back on ice for 1 minute, add 200 μL of antibiotic-free LB (the preparation method of antibiotic-free LB is: 10g tryptone, 10g sodium chloride and 5g yeast extract are fixed with pure water) The culture medium was diluted to 1L and sterilized by high pressure for later use), shaken at 220rpm and 37℃ for 1h, and all the bacterial solution was transferred to Amp+LB plate (the formula of Amp+LB plate is: 10g tryptone, 10g sodium chloride, 5g yeast extract and 15g agar are diluted to 1L with pure water, and 1mL ampicillin sodium stock solution is added after cooling slightly after high pressure sterilization. The preparation method of ampicillin sodium stock solution is: 5g ampicillin sodium is diluted to 50mL with pure water) and spread evenly, and cultured at 37℃ overnight; Pour LB with antibiotics into a 6 cm bacterial culture dish, store it after cooling, pick out bacterial single clones after overnight growth, shake the bacteria in an EP tube for 4 hours, and entrust a biological company to sequence it.

[0026] The sequencing results showed that the CGTA peaks of each base could completely match the DNA CGTA sequence of the target sequence. This result indicated that the pcDNA3.1-E6-FLAG plasmid was successfully constructed.

[0027] The steps for constructing the plasmid of pcDNA3.1-E7-FLAG are as follows: The PCR amplification system was as follows: 1 μL of plasmid template, 1.25 μL of upstream amplification primer and downstream amplification primer (concentration 10 nM), 9 μL of ddH2O, and 12.5 μL of PrimeStar 2*Max; The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual to obtain the E7 amplification product for use; Add 5 μL 5* DNA Loading Buffer to the E7 gene PCR product and mix well; Perform electrophoresis using an electrophoresis apparatus, align the Marker (Biosharp) band using an ultraviolet irradiator to cut the E7 amplification product from the gel, and recover it using a gel recovery kit in accordance with the instructions of a commercially available gel recovery kit; and the E7 amplification product can be obtained.

[0028] After the concentration of E7 amplification product was determined using Nanodrop (Thermo Fisher), the enzyme-linked reaction of empty pcDNA3.1 digestion product and E7 amplification product was performed using a one-step enzyme-linked reaction kit according to the instructions; The enzyme conjugate of E7 and empty pcDNA3.1 digestion product was transformed into E. coli DH5α, following the same steps as above. The sequencing steps were the same as before, and the sequencing results showed that the CGTA corresponding peaks of each base could completely match the DNA CGTA sequence of the target sequence. This result indicated that the pcDNA3.1-E7-FLAG plasmid was successfully constructed.

[0029] The shaken samples were shaken in 50 mL centrifuge tubes, and after 16 hours, plasmids were extracted using a commercially available plasmid extraction kit according to the product instructions and stored as plasmids to be used; Then the overexpression cell culture experiment was carried out, and the specific steps were as follows: 293T cells were plated into the required 6-well plate wells, and complete DMEM medium (complete DMEM formula: containing 500mL DMEM (Gibco), 50mL FBS (Gibco) and 5mL Pen-Strep dual antibody (Gibco)) was added at 37°C and 5% CO2. 200μL of blank DMEM medium was taken per well, 1μg of the plasmid to be transfected (i.e., the plasmid to be used) was taken per well, 3μL of PEI was taken per well, mixed and placed at room temperature for 30min, the medium was removed from the 293T to be transfected, and WB experiment and Co-IP experiment were performed. The specific steps are as follows: WB experiment: Prepare a protein loading buffer containing 4% SDS, 10% 2-mercaptoethanol, 20% glycerol, 0.004% bromophenol blue (BBI) and 0.125M Tris-HCl with a pH of 6.8. Place the cell culture dish on ice and wash the cells with ice-cold PBS buffer. Aspirate the PBS buffer and then add 100μL of cold lysis buffer (the cell lysis buffer needs to be added with PMSF (BBI) at a final concentration of 100mM in advance). Lyse on a shaker at 4°C for 10min. Gently transfer the cell suspension to a pre-cooled small centrifuge tube and place it in a centrifuge. Centrifuge at 13000rpm and 4°C for 10min. Gently remove the centrifuge tube from the centrifuge and place it on ice. Aspirate the supernatant and transfer it to a new tube pre-cooled on ice. Discard the precipitate. Take a small amount of lysate and add a quarter volume of 5* Protein Loading Buffer, heat the prepared sample at 100℃ for 10min and set aside, prepare SDS-PAGE electrophoresis gel according to the instructions using the SDS-PAGE electrophoresis gel rapid preparation kit and fix the gel in the electrophoresis tank, add 1* Running Buffer, the formula of Running Buffer is: 30.3g Tris, 144.4g glycine (Solarbio), 10g SDS, and dilute to 1L with pure water, which is 10* Running Buffer. Dilute it tenfold when using it as 1* Running Buffer. Use a pipette to add 15 μL of the sample to the sample well, use protein markers on both sides, and the electrophoresis conditions are 80V, 20min, then 170V, 45min. Then take out the gel and use a transfer rack and transfer tank for transfer. The specific steps are: transfer buffer, the buffer formula is: Tris 5.8g, glycine 2.9g, SDS 0.37g, methanol 200mL, V=1L, PVDF membrane (Biorad). Before transfer, the PVDF membrane should be soaked in methanol solution for 10s until it is soaked. Take out the SDS-PAGE gel, gently scrape off the concentrated gel, and make a notch in the upper left corner of the gel as a mark to distinguish the loading order.Open the clamp and lay the bottom black electrode (cathode) flat, put a sponge gasket, put a filter paper soaked in transfer buffer on the sponge gasket, align, squeeze out all bubbles, take out the gel immersed in the transfer buffer and lay it flat on the filter paper, remove all bubbles, place the PVDF membrane on the polyacrylamide gel, remove all bubbles, cover the membrane with a filter paper soaked in transfer buffer, and also make sure there are no bubbles, cover with another sponge pad, cover with the anode plate (white), clamp, put the clamp into the transfer tank, transfer the membrane at a constant voltage of 110V for 60min, after completion, move the PVDF membrane into 5% skim milk (BBI), seal it on a shaker at room temperature for 1h, prepare TBST, the formula of TBST is: 9g sodium chloride, 12.114g Tris, dilute to 1L with pure water, add 1mL Tween20 (Chuandong Chemical), mix well and set aside. After blocking, the PVDF membrane was taken out and washed three times at room temperature with a TBST shaker at 200 rpm, each time for 5 minutes. After the washing, GAPDH primary antibody and FLAG primary antibody were added. The antibodies were diluted with primary antibody diluent according to the ratio indicated in the instruction manual, incubated overnight on a shaker at 4°C, and the primary antibody was recovered after overnight. The membrane was washed with TBST and the operation was the same as before. After washing, the secondary antibody was added. The FLAG primary antibody carries HRP and does not require a secondary antibody. Mouse secondary antibody (ABclonal) was used for GAPDH, which was diluted with TBST according to the instruction manual. The membrane was incubated at room temperature and 100 rpm for 1 hour, the secondary antibody was recovered, washed with TBST, and the operation was the same as before. The membrane was exposed using an exposure instrument with a commercially available exposure solution to obtain bands. The results are as follows. Figure 1 As shown; Co-IP experiment: Add 500μL cell lysis buffer with PMSF to a 6cm cell culture dish with cells. Follow the same digestion steps as before. Take out 40μL supernatant and add 10μL 5* protein loading buffer. Cook the sample as before. Store the sample at -80℃ for later use. Add 15μL anti-FLAG beads to the remaining supernatant. Rotate at 4℃ for binding overnight. After overnight, use a magnetic stand for adsorption. Remove the supernatant. Resuspend with PBST (1L PBS + 1mL Tween20). Rotate and wash at 4℃ for 10min. Repeat three times. Add 50μL 1*protein loading buffer, the sample cooking steps are the same as before, the antibodies used include: PSMD primary antibody (ABclonal), rabbit secondary antibody (ABclonal), the protein synthesis inhibitor CHX (actinomycin, MCE) is used to treat E6 protein and E7 protein overexpressing 293T cells, the steps are: 293T cells are plated into eight six-well plates, the E6 protein and E7 protein plasmids are transfected in the same way as before, and a final concentration of 10μM CHX is added at time nodes 0, 0.5h, 1h, 2h and 4h, and the samples are collected for WB detection. When the synthesis of new proteins is inhibited, E6 will degrade slowly, while E7 will degrade very quickly, which further proves that the degradation rate of E6 protein in cells is lower than that of E7 protein.

[0030] like Figure 1 and Figure 2 As shown, there is a difference in degradation between E6-FLAG and E7-FLAG. When proteasome inhibitors are added to 293T cells overexpressing E7 protein, the level of E7 increases, and PSMD2 cannot obviously bind to E6; PSMD2, as an important 26s subunit component protein of the proteasome, can show obvious binding with the E7 protein. This result shows that the E7 protein can interact with the proteasome in the cell and degrade efficiently to produce the corresponding short peptide, which produces sufficient immunogenicity; while the degradation efficiency of E6-FLAG in 293T cells is low, and it cannot be effectively degraded through the proteasome pathway.

[0031] 2. Endogenous proteasome degradation efficiency test In order to further study the difference between the degradation efficiency of endogenous E6 and E7 by the proteasome pathway, the present application uses the HPV16-positive cervical cancer cell line Ca Ski as an experimental group to study the degradation difference between endogenous E6 and E7. The specific steps are as follows: 2.1 WT Ca Ski was plated into 16 wells of a six-well plate. After overnight, CHX (cycloheximide, also known as actinomycin, is a protein synthesis inhibitor purchased from MCE) with a final concentration of 10 μM was added at time points 0h, 1h, 2h and 4h for treatment. Then WB test was performed with the same steps as before. The antibodies used were E6 (GeneTex) and E7 (Santa). The results are shown in the figure. Figure 3 As shown in the left picture; 2.2 The cells were treated in the same manner as in 2.1 except that BTZ (bortezomib, a proteasome inhibitor) was added at a final concentration of 10 μM. Figure 3 As shown in the picture on the right.

[0032] like Figure 3 As shown, endogenous E7 in cells is rapidly degraded (left), and the degradation slows down after treatment with the proteasome inhibitor BTZ (right); endogenous E6 cannot be degraded under normal conditions (left), and there is no increase trend after treatment with the proteasome inhibitor BTZ. This result shows that endogenous E7 in Ca Ski is rapidly degraded through the proteasome pathway, while endogenous E6 in Ca Ski is not degraded through the proteasome pathway, or even basically not degraded.

[0033] 293T overexpression experiment The present application conducted a 293T overexpression experiment, i.e., using two protease inhibitors, E64 and ALLM, to treat E6-overexpressing 293T cells, and the specific steps were as follows: 293T cells were plated into four wells of a six-well plate, and all four wells were transfected with E6-FLAG overnight. Subsequently, the cells were divided into four groups, namely, the E6-FLAG group, the E6-FLAG-BTZ group, the E6-FLAG-PI group, and the E6-FLAG-LEU group, that is, all four groups were transfected; Among them, the E6-FLAG group did not receive any treatment after transfection; In the BTZ group, BTZ (bortezomib, MCE) was added at a final concentration of 1 μM after transfection; In the PI group, E64 at a final concentration of 1 μM and ALLM at a final concentration of 100 nM were added after transfection; LEU group was added with a final concentration of 10 mμM LEU (leupeptin, MCE) after transfection; Then WB test was performed with the same steps as before, and the results were as follows Figure 4 shown.

[0034] like Figure 4 As shown, the results indicate that E6 protein can be degraded through pathways other than proteasome, that is, E6 protein can be degraded through the protease pathway.

[0035] (IV) Construction and verification of Ub-E6 fusion protein plasmid The present application constructs a Ub-E6 fusion protein plasmid, i.e., a pcDNA3.1-FLAG overexpression plasmid of a ubiquitin molecule and an E6 fusion protein plasmid, and the specific steps are as follows: The DNA sequence of the ubiquitin molecule (i.e., ubiquitin molecule) was spliced ​​with E6 into a continuous DNA, and the FLAG tag (which comes with the pcDNA3.1 plasmid) was connected to the end, and E6-FLAG (the plasmid constructed previously) was used as a negative control. The primer sequences used in the construction of Ub-E6 plasmid are: F1: CTTGGTACCGAGCTCGGATCCATGCAGATCTTCGTCAAGACG; R1: GGTTTAAACGGGCCCTCTAGATTATTTGTCATCGTCATCCTTGTAGTCT; According to the instructions of the kit (commercially available), cDNA was obtained from HEK293. The DNA sequence corresponding to Ubiquitin was obtained from the cDNA using primers F1 and R1. The PCR amplification system was: 1 μL of cDNA template, 1.25 μL of F1 and R1 (concentration 10 nM), 9 μL of ddH2O, and 12.5 μL of PrimeStar 2*Max. The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual, and the amplified products were set aside; The second pair of primers are: F2: CTTGGTACCGAGCTCGGATCCATGCAGATCTTCGTCAAGACG; R2: GGTTTAAACGGGCCCTCTAGATTATTTGTCATCGTCATCCTTGTAGTCT; Using primers F2 and R2, obtain the DNA sequence corresponding to E6 from pcDNA3.1-E6-FLAG. The PCR amplification system is: pcDNA3.1-E6-FLAG template 1 μL, F2 and R2 1.25 μL each (concentration 10 nM), ddH2O 9 μL, PrimeStar 2*Max 12.5 μL; The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual, and the amplified products were set aside; The two amplified products of Ubiquitin and E6 were electrophoresed, cut from the gel, recovered, and linked to the previously obtained enzyme-cut empty pcDNA3.1 plasmid in one step, transformed, and sequenced, and the sequencing results showed that the CGTA corresponding peaks of each base can completely match the DNA CGTA sequence of the target sequence. This result shows that the pcDNA3.1-Ub-E6-FLAG plasmid was successfully constructed.

[0036] 293T cells overexpressing ubiquitin E6 fusion protein plasmid (UbE6) were treated with BTZ inhibitor. The specific steps were as follows: 293T cells were plated into two wells of a 6-well plate overnight, pcDNA3.1-Ub-E6-FLAG was transfected into 293T cells, the steps were the same as before, after overnight, BTZ inhibitor was added for treatment, the steps were the same as before, and the samples were collected and detected by WB, the steps were the same as before; Western blot was used to verify whether the Ub-E6 fusion protein could be degraded by the proteasome.

[0037] like Figure 5 As shown, Ub-E6 fusion protein plasmids can be efficiently degraded by proteasomes.

[0038] (V) Construction and verification of midnolin fusion protein plasmid This application constructs a pcDNA3.1-FLAG overexpression plasmid of two midnolin proteins and E6 fusion protein plasmids, and the specific steps are as follows: The primers used are as follows: R1: GGCCGCAGCGGCCAGCACAT; F1: GCCGCCGCTGCTGCGCGG; Using the midnolin DNA sequence as a template, using primers F1 and R1, the DNA sequence corresponding to Ubiquitin was obtained from cDNA. The PCR amplification system was: 1 μL of cDNA template, 1.25 μL of F1 and R1 (concentration 10 nM), 9 μL of ddH2O, and 12.5 μL of PrimeStar 2*Max; The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual, and the amplified products were set aside; The primers used are as follows: F2: CTTGGTACCGAGCTCGGATCCATGGAGCCGCAGCCCGGC; R2: ATCCTTGTAGTCCATCTCGAGAGCCACCACGAACTCTGAC; The obtained amplified product was subjected to PCR amplification. Since the amplified product was the same Midnolin band, the condition system was the same as before, and amplified product 2 was obtained for later use; The amplified product 2 was connected to the previously obtained empty pcDNA3.1 digestion product using a one-step enzyme-linked kit, and the transformation and sequencing steps were the same as before. The sequencing results showed that the CGTA peak was completely consistent with the CGTA peak of the target sequence, indicating that the plasmid was successfully constructed and named pcDNA3.1-Midnolin.

[0039] A group of people inserted the human papillomavirus E6 gene between the 216th and 217th alanines between the Catch1 domain and the Catch2 domain of the midnolin protein (the midnolin protein has four domains, namely the Ub-like Domain (UBL), the Catch1 domain, the Catch2 domain and the α-Helix domain). The specific steps are as follows: The primers used are as follows: F3: CATGTGCTGGCCGCTGCGGCCATGCACCAGAAACGGACC; R3: CCCCCGCGCAGCAGCGGCGGCAAGTTGTGTCTCTCTTCTGGTCC; Perform PCR on the plasmid carrying E6 (i.e., the plasmid synthesized nine days ago). Since the amplified band is the same E6 band, the condition system is the same as before, and amplification product 3 is obtained for future use; The following primers were used: R4: GGCCGCAGCGGCCAGCAC; F4: GCCGCCGCTGCTGCGCGG.

[0040] PCR was performed on pcDNA3.1-Midnolin. The PCR amplification system was: 1 μL cDNA template, 1.25 μL each of F4 and R4 (concentration 10 nM), 9 μL ddH2O, and 12.5 μL PrimeSTar 2*Max; The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual, and the amplified product 4 was reserved; Amplified product 3 and amplified product 4 were recovered using a PCR recovery kit, and the operation was carried out according to the instructions to obtain recovered product 3 and recovered product 4 respectively. The recovered product 3 and recovered product 4 were enzyme-linked using a one-step enzyme-linked kit, and the conversion steps and sequencing steps were the same as before.

[0041] The sequencing results showed that the CGTA peak was completely consistent with the target sequence CGTA peak, indicating that the plasmid was successfully constructed and named pcDNA3.1-ME61, i.e., ME61 fusion protein plasmid (e.g. Figure 6 shown); The other group inserted the human papillomavirus E6 gene between the 281st and 282nd serines between the Catch1 and Catch2 domains of the midnolin protein. The specific steps were: The primers used are as follows: F5: TGCTCCCCCACGGCCAGCAGCATGCACCAGAAACGGACC; R5: GCTGGCACCAGGACTGGCACTAAGTTGTGTCTCTCTTCTGGTCC; Perform PCR on the plasmid carrying E6 (i.e., the plasmid synthesized nine days ago). Since the amplified band is the same E6 band, the condition system is the same as before, and the amplified product 5 is obtained for future use; The following primers were used: R6: GCTGCTGGCCGTGGGGGA; F6: AGTGCCAGTCCTGGTGCCAGC.

[0042] PCR was performed on pcDNA3.1-Midnolin. The PCR amplification system was: 1 μL cDNA template, 1.25 μL each of F4 and R4 (storage concentration 10 nM), 9 μL ddH2O, and 12.5 μL PrimeStar 2*Max; The PCR amplification reaction conditions were carried out according to the PrimeStar instruction manual, and the amplified product 6 was reserved; Amplified product 5 and amplified product 6 were recovered using a PCR recovery kit, and the operation was carried out according to the instructions to obtain recovered product 5 and recovered product 6, respectively. The recovered product 5 and recovered product 6 were enzyme-linked using a one-step enzyme-linked kit, and the conversion steps and sequencing steps were the same as before. The sequencing results showed that the CGTA peak was completely consistent with the CGTA peak of the target sequence, indicating that the plasmid was successfully constructed and named pcDNA3.1-ME62 to obtain the ME62 fusion protein plasmid (structure as shown in Figure 6 shown); The structure of the ME61 fusion protein was predicted by the AlphaFold artificial intelligence system and compared with the structure of midnolin to verify whether the structure of midnolin was disrupted by the insertion of E6. The specific steps are as follows: using the AlphaFold website, input the sequence of the ME61 fusion protein, automatically derive the predicted structure, and then compare it with the sequence of midnolin to confirm whether the structure of midnolin was disrupted by the insertion of E6. The results are as follows: Figure 7 shown.

[0043] like Figure 7 As shown, the ME61 fusion protein particle still maintains its original structure (left).

[0044] This application uses the same method to predict the structure of the ME62 fusion protein particle and compares it with the structure of midnolin. The results show that the ME62 fusion protein particle still maintains the original structure.

[0045] (VI) Degradation pathway of midnolin fusion protein particles The present application uses proteasome inhibitors BTZ and MG132 to treat ME61-overexpressing 293T cells and ME62-overexpressing 293T cells, and the specific steps are as follows: Two fusion protein plasmids (ME61, ME62) were transfected into HEK293T cells respectively, and the steps were the same as before. Then, ME61-overexpressing HEK293T cells and ME62-overexpressing HEK293T cells were treated with BTZ alone (upper left figure) and MG132 (MCE) alone (right figure). That is, ME61-overexpressing HEK293T cells and ME62-overexpressing HEK293T cells were treated with BTZ alone, and the final concentration of BTZ in the system was the same as above. Then, CHX was treated, and the final concentration of CHX in the system was the same as above. WB was used for verification, and the steps were the same as above. The results are as shown Figure 8 As shown; Two fusion protein plasmids (ME61, ME62) were transfected into HEK293T cells respectively, and the steps were the same as before. Then, ME61-overexpressing HEK293T cells and ME62-overexpressing HEK293T cells were treated with separate MG132 (MCE) (right figure). The final concentration of MG132 in the system was the same as above, and then CHX was treated. The final concentration of CHX in the system was the same as above, and WB was used for verification. The steps were the same as above. The results are as shown Figure 8 shown.

[0046] ME61 overexpression HEK293T cells and Ub-E6 overexpression HEK293T cells were treated with BTZ alone, with the final concentration of BTZ in the system being the same as above. The cells were treated with the ubiquitin activating enzyme inhibitor TAK243 alone as a control (i.e., the ubiquitin activating enzyme inhibitor was used instead of BTZ), and WB was used for verification, with the same steps as above. The results are shown in Fig. 9 shown.

[0047] Depend on Fig. 9 It can be seen that after the addition of BTZ and TAK243, the level of Ub-E6 fusion protein particles showed an upward trend, while the level of ME61 fusion protein particles only showed an upward trend after the addition of BTZ and was not affected by TAK243. This result shows that the degradation of Ub-E6 fusion protein particles depends on proteasomes and ubiquitination, while the degradation of ME61 fusion protein particles does not depend on ubiquitination but only on proteasomes.

[0048] (VI) Interaction test with proteasome protein PSMDS2 This application conducts further Co-IP experiments, the specific steps are: The ME61 fusion protein plasmid was transfected into 293T cells, and then the Co-IP experiment was performed with the same steps as before. The results are shown in Fig.10 shown.

[0049] Depend on Fig.10 It can be seen that the ME61 fusion protein can interact with the proteasome protein PSMD2. This result shows that the degradation of the ME61 fusion protein is related to the proteasome.

[0050] In summary, in cells, both endogenous and overexpressed E6 proteins cannot achieve autonomous and efficient degradation and are difficult to become targets. The fusion protein particle formed by the E6 gene and Midnolin protein can enhance the degradation efficiency of E6 protein through the proteasome and is independent of ubiquitination, thereby potentially enhancing its immunogenicity.

[0051] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the technology may modify or change the above embodiments without violating the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by a person of ordinary skill in the art without departing from the spirit and technical ideas disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A fusion protein particle, characterized in that: The fusion protein plasmid includes midbrain nucleolar protein and human papillomavirus E6 gene, the midbrain nucleolar protein includes a Catch1 domain located at the N-terminus and a Catch2 domain located at the C-terminus, and the human papillomavirus E6 protein is located between the Catch1 domain and the Catch2 domain.

2. The fusion protein particle according to claim 1, characterized in that The fusion protein plasmid comprises midbrain nucleolar protein and a human papillomavirus E6 gene inserted between alanine 216 and alanine 217 between the Catch1 domain and the Catch2 domain and / or a human papillomavirus E6 gene inserted between serine 281 and serine 282 between the Catch1 domain and the Catch2 domain.

3. The method for preparing the fusion protein particle according to claim 1 or 2, characterized in that: The method comprises the following steps: inserting the human papillomavirus E6 protein between the Catch1 structural domain and the Catch2 structural domain to prepare the fusion protein particle.

4. Use of the fusion protein particle as claimed in claim 1 or 2 or the fusion protein particle prepared according to the method as claimed in claim 3 in the preparation of an anti-human papillomavirus vaccine.

5. The use according to claim 4, characterized in that The fusion protein plasmid is degraded via the proteasome pathway.

6. The use according to claim 5, characterized in that The fusion protein interacts with the proteolytic protein PSMD2.

7. An anti-human papillomavirus vaccine, characterized in that: The anti-human papillomavirus vaccine comprises the fusion protein particle as claimed in claim 1 or 2 or the fusion protein particle prepared according to the method as claimed in claim 3.

8. The anti-human papillomavirus vaccine according to claim 7, characterized in that The anti-human papillomavirus vaccine also includes a pharmaceutically acceptable carrier.

9. The anti-human papillomavirus vaccine according to claim 8, characterized in that The pharmaceutically acceptable carrier includes at least one of liposomes, nanoparticles, microspheres, polymers and lipid nanoparticles.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the fusion protein particle as described in claim 1 or 2, or the fusion protein particle prepared according to the method as described in claim 3, or the anti-human papillomavirus vaccine as described in any one of claims 7-9.

Images