AS01 derivative adjuvant, preparation method thereof and application of AS01 derivative adjuvant in preparation of vaccines or antitumor drugs
By adding or replacing ingredients in AS01 adjuvant, a variety of AS01-derived adjuvants were formed, which solved the problem of poor immunogenicity and anti-tumor effects in HPV vaccines, and achieved significant immune enhancement and anti-tumor effects.
Patent Information
- Application Number
- CN202510559330.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-06-13
AI Technical Summary
The existing AS01 adjuvant is not ideal in improving the immunogenicity and anti-tumor effects of HPV vaccines, and its mechanism of action is unclear.
By adding or replacing ingredients on the basis of AS01 adjuvant, a variety of AS01-derived adjuvants are formed, including cholesterol, dioleoyl lecithin, monophosphoryl lipid A, QS-21, 3M-052, murayl dipeptide and oligodeoxynucleotides, etc., forming the synergistic effects of a variety of immunomodulatory agents to enhance the immunogenicity and anti-tumor performance of the vaccine.
It significantly enhances the cellular and humoral immune response of HPV vaccines, improves anti-tumor activity, and especially through regulating TLR pathway activation and improving the immunosuppressive microenvironment, achieving effective treatment of HPV-related tumors.
Smart Images

Figure CN120131935A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biopharmaceuticals or products, and particularly relates to an AS01-derived adjuvant, a preparation method thereof, and an application thereof in the preparation of vaccines or anti-tumor drugs. Background Art
[0002] Human papillomavirus (HPV) infection can cause various types of tumors, the most common of which is cervical cancer. Most HPV-infected individuals have no symptoms or very mild symptoms, but some HPV types can persist in the body for many years and gradually develop into cancer. The process of HPV infection leading to cancer is a long-term and multi-stage process. The treatment of HPV-related tumors still faces major challenges, and the development of new therapeutic vaccine strategies is of great significance.
[0003] AS01 is a liposomal adjuvant containing monophosphoryl lipid A (3-O-desacyl-4’-monophosphoryllipid A, MPL) and saponin QS-21. The AS01 adjuvant can stimulate stromal cells to produce cytokines, recruit monocytes and neutrophils, promote the differentiation of monocytes into dendritic cells, improve the antigen presentation ability of dendritic cells at the injection site and draining lymph nodes, and assist the vaccine to produce a higher adaptive immune response. Currently, the AS01 adjuvant is not ideal in terms of immune enhancement effect, and its anti-tumor effect on improving vaccines is not clear. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide an AS01-derived adjuvant, which can effectively improve the immunogenicity of HPV immunogens and enhance anti-tumor performance.
[0005] The present invention provides an AS01-derived adjuvant, comprising 0.5 to 1.0 part by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, and at least one of the following components in parts by mass: 0.1 to 0.2 part of monophosphoryl lipid A, 0.1 to 0.2 part of QS-21, 0.36 to 0.72 part of 3M-052, 0.4 to 0.8 part of muramyl dipeptide, and 0.2 to 0.4 part of oligodeoxynucleotide.
[0006] Preferably, it includes the first AS01-derived adjuvant, the second AS01-derived adjuvant, the third AS01-derived adjuvant, the fourth AS01-derived adjuvant, the fifth AS01-derived adjuvant, the sixth AS01-derived adjuvant, the seventh AS01-derived adjuvant, the eighth AS01-derived adjuvant, the ninth AS01-derived adjuvant, and the tenth AS01-derived adjuvant;
[0007] The first AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, and 0.1 to 0.2 parts of QS-21;
[0008] The second AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, and 0.36 to 0.72 parts of 3M-052;
[0009] The third AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, and 0.4 to 0.8 parts of muramyl dipeptide;
[0010] The fourth AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.36 to 0.72 parts of 3M-052, and 0.4 to 0.8 parts of muramyl dipeptide;
[0011] The fifth AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.36 to 0.72 parts of 3M-052, and 0.4 to 0.8 parts of muramyl dipeptide;
[0012] The sixth AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.36 to 0.72 parts of 3M-052, and 0.2 to 0.4 parts of oligodeoxynucleotide;
[0013] The seventh AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.36 to 0.72 parts of 3M-052, 0.4 to 0.8 parts of muramyl dipeptide, and 0.2 to 0.4 parts of oligodeoxynucleotide;
[0014] The eighth AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.4 to 0.8 parts of muramyl dipeptide, and 0.2 to 0.4 parts of oligodeoxynucleotide;
[0015] The ninth AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, and 0.2 to 0.4 parts of oligodeoxynucleotide;
[0016] The tenth AS01-derived adjuvant comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, and 0.2 to 0.4 parts of oligodeoxynucleotide.
[0017] Preferably, it further comprises a solvent;
[0018] The solvent comprises a phosphate buffer solution with a pH value of 6 to 6.2;
[0019] In the AS01-derived adjuvant, the concentration of cholesterol is 0.5 to 1.0 mg / mL.
[0020] The present invention provides a method for preparing the AS01-derived adjuvant as claimed, comprising the following steps:
[0021] Dissolve cholesterol, dioleoylphosphatidylcholine, and 0 to 2 components selected from monophosphoryl lipid A and 3M-052 to form a film, obtaining a lipid film;
[0022] Dissolve at least one component selected from muramyl dipeptide, QS-21, and oligodeoxynucleotide, and then mix and emulsify it with the lipid film to obtain the AS01-derived adjuvant.
[0023] Preferably, the solvent used for dissolution in the dissolution and film formation includes absolute ethanol;
[0024] For the method of film formation in the dissolution and film formation, when the dissolved oil-phase mixture removes absolute ethanol by rotary evaporation, the oil-phase mixture forms a thin film; the temperature of the rotary evaporation is lower than 37°C.
[0025] Preferably, the solvent used for dissolving at least one component selected from muramyl dipeptide, QS-21, and oligodeoxynucleotide includes a phosphate buffer solution with a pH value of 6 to 6.2.
[0026] The present invention provides a vaccine or a drug, wherein the adjuvant in the vaccine or the drug is the AS01-derived adjuvant or the AS01-derived adjuvant prepared by the preparation method.
[0027] Preferably, the vaccine is an HPV vaccine;
[0028] The immunogen in the HPV vaccine includes HBcAg-E7 virus-like particles.
[0029] The present invention provides the application of the AS01-derived adjuvant or the AS01-derived adjuvant prepared by the preparation method in the preparation of an anti-tumor drug or vaccine.
[0030] Preferably, the tumors in the anti-tumor treatment include cancers caused by human papillomavirus infection;
[0031] The cancers include at least one of the following: cervical cancer, anal cancer, penile cancer, oral cancer, and throat cancer.
[0032] The present invention provides an AS01-derived adjuvant, comprising 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, and at least one of the following components in parts by mass: 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.36 to 0.72 parts of 3M-052, 0.4 to 0.8 parts of muramyl dipeptide, and 0.2 to 0.4 parts of oligodeoxynucleotide. Based on the mechanism of action of AS01, the present invention has developed an adjuvant system in which multiple immunomodulators produce a synergistic effect by integrating multiple immunomodulators and modifying them by means of adding components and / or replacing components. It has the effects of enhancing the immunogenicity of vaccines, improving cellular immunity and humoral immunity in vivo, and achieving tumor immunotherapy effects by enhancing the function of effector T cells and promoting the activation and expansion of immune cells in lymphoid tissues.
[0033] The present invention further defines that the AS01-derived adjuvant includes a first AS01-derived adjuvant (A1), a second AS01-derived adjuvant (A2), a third AS01-derived adjuvant (A3), a fourth AS01-derived adjuvant (A4), a fifth AS01-derived adjuvant (A5), a sixth AS01-derived adjuvant (A6), a seventh AS01-derived adjuvant (A7), an eighth AS01-derived adjuvant (A8), a ninth AS01-derived adjuvant (A9), and a tenth AS01-derived adjuvant (A10). A1 to A4 are co-delivered with HBcAg-E7, wherein A2 to A4 can significantly enhance the CTL response level and improve the cellular immune response of the body. In the evaluation of the TC-1 tumor-bearing mouse model, the AS01-derived adjuvant exhibits varying degrees of anti-tumor activity. Compared with the antigen immunization group, with the increase in the type of immunomodulator from A1 to A4, the T cell-mediated immune response gradually enhances, and this changing trend of cellular immune response is highly consistent with the anti-tumor effect. At the same time, A1 to A4 can all significantly increase the level of HBcAg-specific antibodies and show certain potential in enhancing the humoral immune response of the body; in addition, among the component-replaced derived adjuvants (A5 to A10), each group exhibits varying degrees of anti-tumor activity. Among them, the A6 group shows unique advantages, and the proportion of tumor-infiltrating CTL cells in it is significantly higher than that of other groups. In the adjuvant combinations containing CpG (groups A6-A10), the proportion of Treg cells in the tumor microenvironment is significantly reduced. At the same time, groups A6-A9 perform excellently in reducing the level of MDSC in the tumor microenvironment, while groups A7-A9 are significant in reducing the MDSC in the spleen. After A6 and A8 replace QS-21, they still show an antibody response level comparable to that of group A1 containing QS-21, indicating that some alternative components may achieve similar humoral immune enhancement effects through different mechanisms; the humoral immune responses of other adjuvant groups without QS-21 (A5, A7, A9, and A10) are relatively weak. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] Figure 1 For the expression of recombinant plasmids pHBcAg and pHBcAg-E7 in Escherichia coli BL21 strain. Results; wherein A is the SDS-PAGE verification result of the expression of HBcAg and HBcAg-E7; B is the Western Blot verification result of the expression of HBcAg and HBcAg-E7;
[0035] Figure 2 For the results of purifying HBcAg-E7 VLPs by ammonium sulfate salting-out method and density gradient centrifugation. Among them, A is the SDS-PAGE verification of the supernatant and precipitate obtained after diluting the ultrasonic supernatant treated by ammonium sulfate salting-out method with PBS gradient; B-D are the SDS-PAGE verifications of the ammonium sulfate salting-out samples after density gradient centrifugation; E-G are the electron microscope observations of the ammonium sulfate salting-out samples after density gradient centrifugation;
[0036] Figure 3 Results of purifying VLPs by ultrafiltration concentration method and gel chromatography. A shows the expression result of recombinant plasmid pHBcAg in Escherichia coli BL21 strain verified by SDS-PAGE; B shows the expression result of recombinant plasmid pHBcAg-E7 in Escherichia coli BL21 strain verified by SDS-PAGE; C shows the picture of HBcAg VLPs observed by electron microscopy, and D shows the picture of HBcAg-E7 VLPs observed by electron microscopy.
[0037] Figure 4 Results of physicochemical characterization of AS01-derived adjuvant. A shows the DLS particle size distribution result of AS01-derived adjuvant; B shows the distribution result of AS01-derived adjuvant observed by electron microscopy; C shows the distribution result of AS01-derived adjuvant stored for 2 months observed by electron microscopy.
[0038] Figure 5 Results of HBcAg-E7 VLPs significantly upregulating the expression of co-stimulatory molecules and major histocompatibility complex on the surface of BMDCs. A shows the schematic diagram of in vitro isolation, culture and stimulation process of BMDCs; B-E show the results of detecting the expression of co-stimulatory molecules on the surface of BMDCs by flow cytometry. Among them, B is the expression level of CD80, C is the expression level of CD86, D is the expression level of CD40, and E is the expression level of CD83; F and G show the results of detecting the major histocompatibility complex on the surface of BMDCS by flow cytometry. Among them, F is the expression of MHCⅠ, and G is the expression of MHCⅡ.
[0039] Figure 6 Results of cellular immune response induced by AS01-derived adjuvant vaccine combined with HBcAg-E7 VLPs. A shows the schematic diagram of mouse immunization program and grouping; B shows the percentage of cells expressing IFN-γ in CD3 + , CD8 + cells in mouse lymph nodes; C shows the representative images of cells expressing IFN-γ in CD3 + CD8 + cells in mouse lymph nodes analyzed by flow cytometry; + cells in mouse lymph nodes analyzed by flow cytometry; + cells in mouse lymph nodes analyzed by flow cytometry;
[0040] Figure 7 Results of AS01 component-supplemented derivative adjuvant combined with HBcAg-E7 VLPs significantly inhibiting the growth of established TC-1 tumors with a diameter of 4-5 mm. A shows the schematic diagram of mouse TC-1 model establishment, immunization program and grouping; B shows the dynamic monitoring chart of tumor volume of each group of mice (n = 6); C shows the pictures of tumor samples of each group (n = 6), D shows the results of ex vivo tumor weights of each group; E shows the weights of spleen tissues of each group.
[0041] Figure 8 Results of cellular immune responses induced by AS01 component-supplemented derivative adjuvant combined with HBcAg-E7 VLPs. Among them, A is a representative image of CD3 + , CD8 + cells in the spleen analyzed by flow cytometry; B is the percentage results of CD3 + , CD8 + cells in the lymph nodes of mice; C is a representative image of CD8 + , IFN-γ + cells in the spleen analyzed by flow cytometry; D is the percentage results of CD8 + , IFN-γ + cells in the spleen of mice; E is a representative image of CD4 + , IFN-γ + cells in the spleen analyzed by flow cytometry; F is the percentage results of CD4 + , IFN-γ + cells in the spleen of mice;
[0042] Figure 9 Results of the effect of AS01 component-supplemented derivative adjuvant vaccine on the level of HBcAg-specific antibodies detected by ELISA;
[0043] Figure 10 Results of significant inhibition of the growth of established TC-1 tumors with a diameter of 4-5 mm by AS01 component-replaced derivative adjuvant combined with HBcAg-E7 VLPs. Among them, A is a schematic diagram of the establishment, immunization program and grouping of the mouse TC-1 model; B is a dynamic monitoring chart of the tumor volume of each group of mice (n = 8); C is a picture of tumor samples taken from each group (n = 8); D is the result of the weight of excised tumors in each group; E is the result of the weight of spleen tissues in each group;
[0044] Figure 11 Results of AS01 component-replaced derivative adjuvant combined with HBcAg-E7 VLPs regulating inhibitory immune cells in the body. Among them, A is a representative image of CD25 + , FoxP3 + cells in the proportion of CD4 + cells analyzed by flow cytometry in tumors; B is the percentage of CD25 + , FoxP3 + cells in CD4 + cells in mice; C is a representative image of CD11b + , Gr-1 + cells in the proportion of CD3 + cells analyzed by flow cytometry in tumors; D is the proportion of CD11b + , Gr-1 +Percentage of cells; E shows the percentage of CD11b + , Gr-1 + cells in the spleen analyzed by flow cytometry; F shows the percentage of CD11b + , Gr-1 + cells in the mouse spleen;
[0045] Figure 12 show the results of CTL / Th1 cell immune response induced by AS01 component-replaced derivative adjuvant combined with HBcAg-E7 VLPs. Among them, A shows the percentage of CD8 + , IFN-γ + cells in T cells in mouse tumors; B shows a representative image of the percentage of CD8 + , IFN-γ + cells in T cells analyzed by flow cytometry in tumors; C shows the percentage of CD4 + , IFN-γ + cells in T cells in mouse tumors; D shows a representative image of the percentage of CD4 + , IFN-γ + cells in T cells analyzed by flow cytometry in tumors; E shows a statistical chart of ELISpot results; F shows a representative image of ELISpot analysis of IFN-γ-secreting cells in the tumor microenvironment;
[0046] Figure 13 show the results of ELISA detection of the effect of AS01 component-replaced derivative adjuvant vaccine on the level of HBcAg-specific antibodies. Detailed implementation methods
[0047] The present invention provides an AS01-derived adjuvant, which includes 0.5-1.0 parts by mass of cholesterol, 2.0-4.0 parts by mass of dioleoylphosphatidylcholine, and at least one of the following components by mass: 0.1-0.2 parts of monophosphoryl lipid A, 0.1-0.2 parts of QS-21, 0.36-0.72 parts of 3M-052, 0.4-0.8 parts of muramyl dipeptide, and 0.2-0.4 parts of oligodeoxynucleotide.
[0048] In the present invention, the AS01-derived adjuvant is a component-supplemented derivative adjuvant formed by supplementing components on the basis of the AS01 adjuvant, including the first AS01-derived adjuvant, the second AS01-derived adjuvant, the third AS01-derived adjuvant, and the fourth AS01-derived adjuvant. In addition, the AS01-derived adjuvant is a replacement-type derivative adjuvant formed by replacing components on the basis of the AS01 adjuvant, including the fifth AS01-derived adjuvant, the sixth AS01-derived adjuvant, the seventh AS01-derived adjuvant, the eighth AS01-derived adjuvant, the ninth AS01-derived adjuvant, and the tenth AS01-derived adjuvant.
[0049] In the present invention, the first AS01-derived adjuvant preferably comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, and may be 0.5 to 0.8 parts by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21. The second AS01-derived adjuvant preferably comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.36 to 0.72 parts of 3M-052; and may be 0.5 to 0.8 parts by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.36 to 54 parts of 3M-052. The third AS01-derived adjuvant preferably comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.4 to 0.8 parts of muramyl dipeptide; and may be 0.5 to 0.8 parts by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.4 to 0.8 parts of muramyl dipeptide. The fourth AS01-derived adjuvant preferably comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.36 to 0.72 parts of 3M-052 and 0.4 to 0.8 parts of muramyl dipeptide; and may be 0.5 to 0.8 parts by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 parts of monophosphoryl lipid A, 0.1 to 0.2 parts of QS-21, 0.36 to 0.54 parts of 3M-052 and 0.4 to 0.8 parts of muramyl dipeptide. The fifth AS01-derived adjuvant preferably comprises 0.5 to 1.0 parts by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 parts of monophosphoryl lipid A, 0.36 to 0.72 parts of 3M-052 and 0.4 to 0.8 parts of muramyl dipeptide; and may be 0.5 to 0.8 parts by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 parts of monophosphoryl lipid A, 0.36 to 0.54 parts of 3M-052 and 0.4 to 0.8 parts of muramyl dipeptide. The sixth AS01-derived adjuvant preferably comprises 0.5 to 0.8 parts by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 parts of monophosphoryl lipid A, 0.36 to 0.54 parts of 3M-052, 0.2 to 0.4 parts of oligodeoxynucleotide.The seventh AS01-derived adjuvant preferably comprises 0.5 to 1.0 part by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 part of monophosphoryl lipid A, 0.36 to 0.72 part of 3M-052, 0.4 to 0.8 part of muramyl dipeptide, and 0.2 to 0.4 part of oligodeoxynucleotide; it may be 0.5 to 0.8 part by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 part of monophosphoryl lipid A, 0.36 to 0.54 part of 3M-052, 0.4 to 0.8 part of muramyl dipeptide, and 0.2 to 0.4 part of oligodeoxynucleotide. The eighth AS01-derived adjuvant preferably comprises 0.5 to 1.0 part by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 part of monophosphoryl lipid A, 0.4 to 0.8 part of muramyl dipeptide, and 0.2 to 0.4 part of oligodeoxynucleotide; 0.5 to 1.0 part by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 part of monophosphoryl lipid A, 0.4 to 0.8 part of muramyl dipeptide, and 0.2 to 0.4 part of oligodeoxynucleotide. The ninth AS01-derived adjuvant preferably comprises 0.5 to 1.0 part by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.2 part of monophosphoryl lipid A, and 0.2 to 0.4 part of oligodeoxynucleotide; it may be 0.5 to 0.8 part by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, 0.1 to 0.15 part of monophosphoryl lipid A, and 0.2 to 0.4 part of oligodeoxynucleotide. The tenth AS01-derived adjuvant preferably comprises 0.5 to 1.0 part by mass of cholesterol, 2.0 to 4.0 parts by mass of dioleoylphosphatidylcholine, and 0.2 to 0.4 part of oligodeoxynucleotide; it may be 0.5 to 0.8 part by mass of cholesterol, 2.0 to 3.0 parts by mass of dioleoylphosphatidylcholine, and 0.2 to 0.4 part of oligodeoxynucleotide.
[0050] In the present invention, in the AS01-derived adjuvant, cholesterol and dioleoylphosphatidylcholine are the main components for forming liposomes. Monophosphoryl lipid A is an oil-phase component, which plays a core role as a TLR4 agonist in the whole adjuvant system. Almost all combinations with significant effects contain MPL, indicating that it may be the basis for constructing an effective adjuvant system. MPL provides a good immune microenvironment for other adjuvants to play their roles by promoting the maturation of antigen-presenting cells and the production of cytokines. 3M-052 belongs to the oil-phase component, which, as a TLR7 / 8 agonist, further enhances the immune effect of the vaccine. Combinations containing 3M-052 (A4 - A7) generally show a strong systemic immune response and a stronger IFN-γ secretion ability, which may be related to the activation of the TLR7 / 8 pathway promoting Th1-type immune response.
[0051] In the present invention, among the AS01-derived adjuvants, QS-21, muramyl dipeptide, and oligodeoxynucleotide all belong to the aqueous phase components. Experiments have shown that the role of QS-21 appears to be rather special. In combinations containing multiple TLR agonists, some combinations (such as A5 and A8) after removing QS-21 instead show better effects, which implies that in the presence of multiple TLR agonists, the role of QS-21 may not be essential. As a NOD2 agonist, muramyl dipeptide exhibits a rather complex mode of action, and its effect seems to highly depend on the cooperation with other adjuvants, which is reflected in the potent tumor suppression effect of groups A5 and A8. As a TLR9 agonist, oligodeoxynucleotide brings unique advantages to the adjuvant system, significantly improving the immunosuppressive microenvironment, especially in reducing the levels of Treg and MDSC in the tumor microenvironment. The excellent performance of group A6 (MPL + 3M-052 + CpG) in T cell activation suggests that CpG may have produced a significant synergistic effect with other TLR agonists. The AS01-derived adjuvant takes into account the co-activation of multiple immune pathways, the improvement of the immunosuppressive microenvironment, and the balance of systemic and local immune responses, which explains why adjuvant formulations such as A5, A6, and A8 show different performances in different immune indices but can all achieve significant anti-tumor effects. It can be seen that the present invention can produce a synergistic effect through the combined use of multiple immunomodulators, which not only provides an important theoretical basis for optimizing the combination of tumor vaccine adjuvants but also offers new ideas for the personalized design of immunotherapy strategies.
[0052] In the present invention, the AS01-derived adjuvant preferably further includes a solvent. The solvent preferably includes a phosphate buffer solution with a pH value of 6 to 6.2; it can be a phosphate buffer solution with a pH value of 61. In the AS01-derived adjuvant, the concentration of cholesterol is preferably 0.5 to 1.0 mg / mL, and it can be 0.8 mg / mL. The concentrations of other components are determined according to the relative proportion relationship with the mass fraction of cholesterol.
[0053] The present invention provides a preparation method of the AS01-derived adjuvant, which is prepared by a liposome encapsulation method and specifically includes the following steps: dissolving cholesterol, dioleoylphosphatidylcholine, and 0 to 2 components selected from monophosphoryl lipid A and 3M-052 to form a film, obtaining a lipid film;
[0054] Dissolving at least one component of muramyl dipeptide, QS-21, and oligodeoxynucleotide and then mixing and emulsifying it with the lipid film to obtain the AS01-derived adjuvant.
[0055] In the present invention, the solvent for dissolution in the dissolution and film formation preferably includes absolute ethanol. The method for film formation in the dissolution and film formation preferably forms a thin film of the oil-phase mixture when removing absolute ethanol by rotary evaporation, achieving the effect of encapsulating the immunomodulator with liposomes. The temperature of the rotary evaporation is lower than 37°C to prevent oxidation of the liposomes. The solvent for dissolving at least one component of muramyl dipeptide, QS-21, and oligodeoxynucleotide preferably includes a phosphate buffer solution with a pH value of 6 to 6.2. The preparation methods of AS01-derived adjuvants with different formulations are the same, and can be adjusted and prepared according to the components involved.
[0056] In the embodiments of the present invention, the preparation method further includes a preparation scheme of direct mixing of components. Specifically, when the AS01-derived adjuvant contains monophosphoryl lipid A and / or 3M-052, the monophosphoryl lipid A and / or 3M-052 is mixed with the mixed emulsification product; or when it contains at least one of muramyl dipeptide, QS-21, and oligodeoxynucleotide, at least one of muramyl dipeptide, QS-21, and oligodeoxynucleotide is mixed with the mixed emulsification product.
[0057] In the present invention, the preparation method of encapsulating the immunomodulator with liposomes and the preparation method of direct mixing are compared respectively. The immune response effect shows that the derived adjuvant prepared by the preparation method of encapsulating the immunomodulator exhibits smaller individual differences, indicating that this preparation method may have better stability and reproducibility.
[0058] The present invention provides a vaccine or a drug, wherein the adjuvant in the vaccine or the drug is the AS01-derived adjuvant or the AS01-derived adjuvant prepared by the preparation method.
[0059] In the present invention, the AS01-derived adjuvant and the immunogen are mixed in a volume ratio of 1:1. The final concentration of the immunogen is 0.4 to 0.8 mg / mL, and can be 0.6 mg / mL. The present invention has no special limitation on the preparation method of the vaccine or the drug, and the well-known preparation methods in the art can be used, such as mixed emulsification. The volume concentration of the AS01-derived adjuvant in the drug is preferably 48% to 52%, and can be 50%. The concentration of the immunogen is preferably 0.4 to 0.8 mg / mL, and can be 0.6 mg / mL. The dosage form of the drug includes an injection powder or an injection solution. The preparation method of the drug in the present invention has no special limitation, and the well-known preparation methods of injection-type drugs in the art can be used. The usage method of the vaccine is to immunize once every 4 days, for a total of 3 immunizations, and the immunization dose each time is 100 μL.
[0060] In the present invention, the vaccine is preferably an HPV vaccine. The drug is preferably a drug for treating HPV infection. The immunogen in the HPV vaccine preferably includes HBcAg-E7 virus-like particles. The preparation method of HBcAg-E7 virus-like particles is preferably to insert the HPV-E7 full-length protein into the HBcAg sequence, construct a recombinant plasmid with the obtained chimeric protein sequence, use a prokaryotic expression system for recombinant expression, and then self-assemble the recombinant protein to construct chimeric VLPs to achieve efficient delivery and display of antigens. The nucleotide sequence of the chimeric protein sequence is shown in SEQ ID NO: 3. In view of the fact that the ammonium sulfate salting-out method may affect the interaction between virus-like particles, the ultrafiltration concentration method is used for differentiation, which is conducive to maintaining the dispersibility of VLPs while concentrating the volume of the sample. According to electron microscopy, the diameter of the HBcAg-E7 virus-like particles is preferably 20-30nm, and the fusion expression of the E7 full-length protein makes the surface of the virus-like particles relatively rough. The HBcAg-E7 virus-like particles achieve orderly display and efficient delivery of antigens. Compared with monomeric Trx-E7, self-assembled HBcAg / E7 can more significantly upregulate the co-stimulatory molecules CD40, CD83, CD80 and CD86 on the surface of BMDCs ( Figure 5 BE) and the expression of antigen presenting molecules (MHC-Ⅰ and MHC-Ⅱ). The HBcAg-E7VLPs group alone can induce a certain level of HBcAg-specific antibodies, but the use of AS01-derived adjuvants in the preparation of vaccines to immunize animals can enhance the body's cellular and humoral immune responses to varying degrees.
[0061] The present invention provides use of the AS01-derived adjuvant or the AS01-derived adjuvant prepared by the preparation method in preparing anti-tumor drugs or vaccines.
[0062] In the present invention, the tumor in the anti-tumor agent preferably includes cancer caused by human papillomavirus infection. The cancer preferably includes at least one of the following: cervical cancer, anal cancer, penile cancer, oral cancer and pharyngeal cancer.
[0063] In one embodiment of the present invention, the vaccine has good in vivo immune response capabilities, including cellular immune response and humoral immune response. In terms of cellular immune response, A1 adjuvant and A3 adjuvant are comparable in enhancing cellular immune enhancement effects, which are significantly different from the PBS group; A2 and A4 adjuvants show stronger cellular immune effects. In terms of humoral immune response, the expression level of HBcAg / E7-specific antibodies was used as an evaluation index. When the immunogen was combined with AS01-derived adjuvant (A1) for immunization, the antibody level detected was significantly higher than that of the VLPs group alone. The antibody level induced by the A1 adjuvant group was comparable to that of the Freund's adjuvant (FA) positive control group, and there was no significant difference between the two groups.
[0064] In another embodiment of the present invention, an evaluation experiment of the HPV vaccine prepared with the AS01-derived adjuvant was also carried out in tumor model animals. From the perspective of the therapeutic effect on tumors, the effect of using the adjuvant (A1) or HBcAg-E7 VLPs alone is relatively limited, while when the two are used in combination, the anti-tumor effect is significantly improved. At the same time, the A2, A3, and A4 adjuvant groups all showed stronger anti-tumor activity than the A1 adjuvant group. Considering the cellular immune response, from adjuvants A1 to A4, as the types of immunomodulators increase, the T cell-mediated immune response gradually enhances, which is highly consistent with the anti-tumor effect, and the A4 adjuvant has the best effect. Considering the humoral immune response, the levels of HBcAg-specific antibodies induced by A1, A2, A3, and A4 adjuvants are comparable, and are all significantly higher than those of the immunogen group (HBcAg-E7 VLPs);
[0065] In another embodiment of the present invention, in order to explore the influence of adjuvant components on the therapeutic effect, the anti-tumor effect and immune response effect of adjuvant formulations A5 - A10 were verified respectively. The immune enhancement effects of different adjuvant combinations on the HBcAg-E7 vaccine showed a complex pattern. In terms of tumor growth inhibition, the HBcAg-E7 combined with A5 (MPL + 3M-052 + MDP) and A8 (MPL + MDP + CpG) groups showed the most significant anti-tumor effect. The anti-tumor effects of the A6 (MPL + 3M-052 + CpG), A7, and A9 groups were comparable to or slightly better than those of the A4 group, while the effect of using CpG alone (A10 group) was similar to that of the basic adjuvant A1 group. In the cellular immune response, the A6 group showed unique advantages: the proportions of tumor-infiltrating CTL and Th1 cells in it were significantly higher than those of other groups. It is worth noting that although the A8 group showed a significant tumor suppression effect, the immune cell activation index in its tumor microenvironment was not prominent. The number of IFN-γ-secreting cells evaluated by ELISpot analysis showed that the A4, A5, and A6 groups performed outstandingly, where A4 > A6 > A5, indicating that these adjuvant combinations have advantages in inducing systemic immune responses. In terms of immunosuppressive cells, the adjuvant combinations containing CpG (A6 - A10 groups) significantly reduced the proportion of Treg cells in the tumor microenvironment. At the same time, the A6 - A9 groups showed excellent performance in reducing the MDSC level in the tumor microenvironment, while the A7 - A9 groups were significant in reducing the MDSC in the spleen. In terms of humoral immune response, the A1 adjuvant showed a significant enhancement effect, and A6 and A8 replacing QS-21 showed antibody response levels comparable to those of the A1 group containing QS-21, indicating that some alternative components may achieve similar humoral immune enhancement effects through different mechanisms; while the humoral immune responses of other adjuvant groups without QS-21 (A5, A7, A9, and A10) were relatively weak.
[0066] The following is a detailed description of an AS01-derived adjuvant provided by the present invention, its preparation method, and its application in the preparation of vaccines or anti-tumor drugs in combination with embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0067] Description of the preparation of culture media and solutions and the sources of experimental animals and cells involved in the embodiments of the present invention
[0068] 1. The preparation of experimental solutions is specifically shown in Tables 1 to 4.
[0069] Table 1 Preparation of LB medium
[0070] Component Dosage Yeast extract 5g Tryptone 10g NaCl 10g Water for injection 1L
[0071] After autoclaving at 121 °C for 20 min, it can be used as a liquid medium for subsequent bacterial culture. If it is necessary to prepare LB solid medium, 15 g of agar powder is added on the basis of this formula. After autoclaving, when the temperature drops to 60 °C, the required antibiotics are added, shaken well, and quickly dispensed into bacterial culture dishes. After it solidifies, it is stored at 2 - 8 °C.
[0072] Table 2 Preparation of TBST solution
[0073] Component Dosage NaCl 8g 1M Tris-HCI (pH value - 8.0) 20 mL Tween 20 50 μL Deionized water Volume made up to 1 L
[0074] Table 3 Preparation of SDS-PAGE electrophoresis buffer
[0075] Component Dosage Tris base 15.1g Glycine 94g SDS 5g Deionized water Volume made up to 1 L
[0076] Table 4 Preparation of phosphate buffer (pH 6.1)
[0077] Component Dosage <![CDATA[Sodium 2 Hydrogen Phosphate 4 ·12 Hydrates 2 O]]> 3.22g <![CDATA[KH 2 PO 4 > 5.57g NaCl 5.84g Deionized water Volume made up to 1 L
[0078] 2. Experimental animals
[0079] The experimental animals used in the experiment are 6 - 8-week-old SPF-grade C57BL / 6 female mice, which are sourced from the Institute of Medical Biology, Chinese Academy of Medical Sciences, and are all raised in a specific barrier environment. The use and operation of experimental animals have been approved by the Animal Use and Welfare Ethics Committee of the Institute of Medical Biology, Chinese Academy of Medical Sciences (Ethical number: DWSP202204001)
[0080] 3. Experimental cell lines
[0081] The cell line used in this experiment for tumor model establishment is the TC-1 cell, which is a mouse cervical cancer cell, sourced from the Cell Bank of the Chinese Academy of Sciences and stored in the Molecular Immunology Laboratory of the Institute of Medical Biology, Chinese Academy of Medical Sciences.
[0082] Example 1
[0083] Recombinant expression method of antigen
[0084] 1. Construction of recombinant plasmid
[0085] Using pThioHisA as the backbone vector, plasmids expressing the HBcAg empty gene (pHBcAg) and the HBcAg-E7 plasmid (pHBcAg-E7) were constructed respectively. Among them, pHBcAg contains the gene encoding the truncated hepatitis B virus core antigen, and the corresponding nucleotide sequence is as follows: catatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacggattcggtggcggtggcggaccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgtttaattatcaacacttccggaaactactgttgtttaa(SEQ ID NO:1).
[0086] pHBcAg-E7 contains the gene encoding the truncated hepatitis B virus core antigen and the gene encoding the E7 protein, and the nucleotide sequence encoding the E7 protein is shown as SEQ ID NO:2.
[0087] The nucleotide sequence of the gene after the gene encoding the truncated hepatitis B virus core antigen is linked to the gene encoding the E7 protein:
[0088] catatggacattgacccgtataaagaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacggatCCCATGGAGATACACCTACATTGCATGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACTGTTATGAGCAATTAAATGACAGCTCAGAGGAGGAGGATGAAATAGATGGTCCAGCTGGACAAGCAGAACCGGACAGAGCCCATTACAATATTGTAACCTTTTGTTGCAAGTGTGACTCTACGCTTCGGTTGTGCGTACAAAGCACACACGTAGACATTCGTACTTTGGAAGACCTGTTAATGGGCACACTAGGAATTGTGTGCCCCATCTGTTCTCAGAAACCAGAATtcggtggcggtggcggaccagcatccagggaattagtagtcagctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgtttaa(SEQ ID NO:3).
[0089] 2. Transformation of plasmid
[0090] (1) After thawing 100 μL of Escherichia coli BL21 competent cells, add 10 μL of the recombinant plasmid (pHBcAg or pHBcAg-E7) to it, gently flick to mix evenly, and place it on ice for 30 min.
[0091] (2) Place the Escherichia coli competent cells containing the recombinant DNA in a 42 °C water bath for 90 s, take it out and immediately place it on ice for 2 min.
[0092] (3) Place the BL21 competent cells into the laminar flow hood, add 900 μL of LB medium without antibiotics, and incubate at 37 °C in a shaker at 220 rpm for 45 min.
[0093] (4) Centrifuge at 4000 rpm for 5 min. After removing 800 μL of the supernatant, approximately 200 μL remains. Pipette and mix well, then spread it on an LB solid plate containing ampicillin resistance, and incubate it inverted at 37 °C for 16 h.
[0094] 3. Induced expression of protein
[0095] (1) Pick a single colony and inoculate it into 5 mL of liquid medium containing ampicillin resistance, and culture it at 37 °C and 220 rpm for 16 h.
[0096] (2) Take out the bacterial solution and transfer it to an LB liquid medium containing ampicillin resistance at a volume ratio of 2%, and culture it at 37 °C and 220 rpm for 3 - 4 h. When the OD600 of the bacterial solution reaches 0.4 - 0.6, add 1 mM of IPTG and induce for 4 h.
[0097] (3) Take out all the induced bacterial solutions, centrifuge at 6000 rpm for 15 min, discard the supernatant, and resuspend the bacterial cells with 15 mL of PBS.
[0098] (4) Lyse the bacterial cells with an ultrasonic disruptor. The conditions are: total ultrasonic time is 10 min, stop for 10 s every 10 s of ultrasonic treatment, and the power is 20%.
[0099] (5) Collect the solution after ultrasonic treatment, centrifuge at 13000 rpm at 4 °C for 10 min to remove the bacterial cell debris, and take the supernatant.
[0100] (6) Collect the bacterial cells before induction, the bacterial cells after induction, the supernatant and the precipitate after centrifugation of the ultrasonic-treated solution respectively, resuspend them with an appropriate amount of PBS, add Loading Buffer, and incubate in a metal bath at 95 °C for 15 min for subsequent SDS-page experiment to identify the effect of induced expression.
[0101] 4. Concentration and primary purification of recombinant virus-like particles
[0102] (1) Add ammonium sulfate to the ultrasonic supernatant of the induced bacterial cells to a solubility of 40%, precipitate at room temperature for 30 min, and invert repeatedly to fully mix ammonium sulfate and the protein.
[0103] (2) Centrifuge at 13000 rpm for 10 min, collect the supernatant, and resuspend the precipitate with 20% ammonium sulfate solution.
[0104] (3) Centrifuge the resuspended solution at 13,000 rpm for 10 min, collect the supernatant. Resuspend the precipitate three times in total. After completing the resuspension and centrifugation with 20% ammonium sulfate solution three times, use the precipitate for subsequent experiments. After each centrifugation before this, the supernatant needs to be collected for sample preparation and analyzed by SDS-page to identify whether there is a large amount of target protein in the centrifuged supernatant.
[0105] (4) Resuspend the precipitate obtained in the previous step with 500 μL of PBS, centrifuge at 13,000 rpm for 10 min, collect the supernatant and precipitate, and repeat several times. The purpose of this step is to gradually reduce the concentration of ammonium sulfate so that the target protein can be released from the precipitate into the supernatant at a certain ammonium sulfate concentration.
[0106] (5) Analyze and identify all the centrifuged supernatant samples in step (4) by SDS-page electrophoresis, and perform Western blot detection on the concentrated and initially purified samples.
[0107] 5. Density gradient centrifugation for separating recombinant virus-like particles
[0108] (1) Prepare 27%, 33%, and 39% iodixanol solutions, lay out 3 density gradients, with each layer having a volume of about 3.3 ml. Avoid air bubbles and violent shaking during the preparation process. After laying out, obvious boundaries between different concentration layers should be visible.
[0109] (2) Gently and slowly add the concentrated protein sample to the top layer of the gradient solution, and centrifuge at 40,000 rpm at 4 °C for 4 h.
[0110] (3) After centrifugation, sample layer by layer from top to bottom, taking 1 mL each time. Each layer of the sample needs to be preserved and prepared for samples.
[0111] (4) After identification by SDS-page and electron microscopy analysis, confirm the samples enriched with virus-like particles, collect them and use them for subsequent experiments.
[0112] 6. Gel filtration chromatography for separating recombinant virus-like particles
[0113] (1) Prepare phosphate buffer (pH 6.1) and prepare the packing material Sepharose 6 Fast Flow.
[0114] (2) Subject the concentrated protein sample to gel filtration chromatography. When the peak appears, aliquot 1 mL of each sample and make good marks until the protein peak no longer appears.
[0115] (3) After identification by SDS-page and electron microscopy analysis, confirm the samples enriched with virus-like particles, collect them and use them for subsequent experiments.
[0116] The recombinant plasmids pHBcAg and pHBcAg-E7 were transformed into Escherichia coli BL21 strain. After induction with IPTG, the expression of E7 protein was verified by SDS-PAGE and Western blot. The results are shown in Figure 1 A and B in it. First, the supernatant after ultrasonic treatment of the bacteria was processed by ammonium sulfate precipitation method, which was beneficial for the primary purification and concentration of the sample. It can be verified by SDS-PAGE electrophoresis that the induced expression effect of Escherichia coli BL21 strain transformed with the recombinant plasmid HBcAg-E7 is very good. After treatment by ammonium sulfate precipitation method, the ammonium sulfate concentration was diluted with PBS gradient. The obtained sample was also basically in line with expectations through SDS-PAGE electrophoresis verification. The electrophoresis indicated that when diluting the ammonium sulfate concentration with PBS, the target protein was released into the supernatant for the 3rd to 6th times ( Figure 2 in A). Subsequently, in order to further purify HBcAg-E7 VLPs, the samples obtained by the above ammonium sulfate precipitation method were collected. The supernatant samples 3, 6, supernatant samples 4, 5, and the precipitate were purified by density gradient centrifugation respectively, and the target bands were verified by SDS-PAGE electrophoresis ( Figure 2 in B-D). It can be seen by electron microscopy that the protein self-assembly efficiency of supernatant samples 3, 6 is low ( Figure 2 in E). Although a large number of VLP-like particles can be seen in the supernatant samples 4, 5 and the precipitate sample under the electron microscope, the dispersion is poor and aggregates are formed with impurities ( Figure 2 in F, G).
[0117] The experimental results show that HBcAg-E7 has a very good effect in induced expression, but the ammonium sulfate precipitation method may affect the interaction between particles. Therefore, the ultrafiltration concentration method was used to replace the ammonium sulfate precipitation method to maintain the dispersion of VLPs while concentrating the volume of the sample, and the target VLPs were separated and purified from impurities and unassembled monomer proteins by gel chromatography. The recombinant plasmids HBcAg and HBcAg-E7 were respectively transformed into Escherichia coli BL21 strain. After ultrasonic treatment, the supernatant was collected. After ultrafiltration concentration, the sample was separated by gel chromatography to obtain the target VLPs ( Figure 3 in A, B). A large number of self-assembled virus-like particles with a diameter of 20-30 nm were shown under the electron microscope, and the dispersion was good. Among them, the surface of HBcAg empty particles was relatively smooth, while the surface of HBcAg-E7 particles was relatively rough due to the fusion expression of the full-length E7 protein ( Figure 3 in C, D)
[0118] Example 2
[0119] Preparation and Characterization of AS01-derived Adjuvant
[0120] (1) Adjuvant formulation:
[0121] Oil phase components: monophosphoryl lipid A (MPL) 0.1 mg / mL, dioleoylphosphatidylcholine (DOPC) 2.0 mg / mL, cholesterol 0.5 mg / mL.
[0122] Aqueous phase components: QS-21 0.1 mg / mL.
[0123] (2) Prepare phosphate buffer (pH 6.1), and fully dissolve the oil-phase drug in absolute ethanol.
[0124] (3) Place the solution in a rotary flask, and remove ethanol by rotary evaporation at 37 °C using a rotary evaporator, so that the oil-phase drug forms a uniform thin film on the wall of the rotary flask.
[0125] (4) Dissolve the aqueous-phase drug in phosphate buffer (pH 6.1). After preparation, add it to the rotary flask to fully mix the aqueous-phase drug with the lipid membrane. After repeatedly pipetting until the lipid membrane on the wall of the rotary flask is completely detached, continue to pipette and mix evenly. At this time, it appears as a turbid white emulsion to the naked eye.
[0126] (5) Treat the white emulsion with an ultrasonic crusher. The ultrasonic conditions are 15 min, ultrasonic for 10 s, stop for 10 s, and the power is 20%, until the liquid changes from turbid to clear.
[0127] Further control the particle size of the clear liquid after ultrasonic treatment through a 100 nm extruder to obtain the AS01-derived adjuvant.
[0128] The AS01-derived adjuvant system is a new adjuvant system obtained by optimizing and adjusting the components of the AS01 adjuvant. We used the thin-film hydration method to mix the oil-phase and aqueous-phase components, and controlled the particle size distribution of liposomes through ultrasonic treatment and an extruder. It can be seen that the particle size is about 110 nm ( Figure 4 in A). Transmission electron microscopy observation shows that there are a large number of typical liposome structures in the sample, and characteristic lipid bilayers and membrane perforations can be seen ( Figure 4 in B). Stability studies have shown that the same batch of derived adjuvant still maintains a typical liposome morphological structure after storage at 4 °C for several months ( Figure 4 in C).
[0129] Example 3
[0130] Based on the preparation process of the adjuvant in Example 2, while based on the basic components of AS01, during the preparation of liposomes, immunomodulators 3M-052, MDP, and CpG were encapsulated, and QS-21 was replaced in some groups, forming A1-A10 formulations of the derived adjuvant components. Among them, A1 is a derived adjuvant based on the same components as AS01, A2-A4 are derived adjuvants added based on the components of AS01, and the A5-A10 derived adjuvant groups are those with component replacements based on the AS01 adjuvant system. The component details of the specific derived adjuvant groups are shown in Table 1 below.
[0131] Table 1 Derived Adjuvant Configuration Based on AS01 (Unit: mg / mL)
[0132]
[0133] Example 4
[0134] Effect of HBcAg-E7 VLPs on the Maturation of BMDCs
[0135] 1. Isolation and Culture of Mouse BMDCs
[0136] After anesthesia, the mice were sacrificed by cervical dislocation and immersed in alcohol for 5 min. The intact femurs and tibias were taken out, and the surrounding muscle tissues were trimmed as much as possible and then immersed in alcohol for 2 min.
[0137] Transferred to sterile and enzyme-free PBS and washed 3 times. The two ends were cut open with scissors to expose the bone marrow.
[0138] A 1 mL syringe was used to aspirate sterile RPMI-1640 medium to rinse the bone marrow cells in the femurs and tibias until they became white to the naked eye. The cell suspension was collected after filtration through a 70 μm cell strainer.
[0139] Centrifuged at 300 g for 10 min, and the cells were collected after centrifugation.
[0140] 5 mL of 1× RBC lysate was added to lyse red blood cells for no more than 5 minutes, and then terminated with an equal volume of PBS. Centrifuged at 300 g for 10 min, and the cells were collected after centrifugation.
[0141] The cells were resuspended with RPMI-1640 medium containing 10% FBS and 1% double antibody, plated onto culture dishes, and GM-CSF (recombinant mouse granulocyte-macrophage colony-stimulating factor) was added to a final concentration of 10 ng / mL. Incubated statically in an incubator at 37 °C and 5% CO 2 for culture.
[0142] On the third day, half of the culture medium was replaced and GM-CSF was supplemented at the same time. After 8 days of culture, BMDCs were collected for subsequent experiments.
[0143] 2. In vitro stimulation of BMDCs with HBcAg-E7 VLPs
[0144] Cells were seeded into 96-well cell culture plates at a concentration of 10 7 cells / mL, 100 μL per well. Trx-E7 and HBcAg-E7 were added. PBS was used as the negative control group, and 1 ng / mL of LPS was used as the positive control group. The cells were statically cultured in an incubator at 37 °C with 5% CO 2 for 24 h, and the cells were collected for subsequent detection.
[0145] 3. Flow cytometry and surface molecule detection
[0146] Plating: The obtained lymphocyte suspension was adjusted to a concentration of 1×10 7 cells / mL and seeded into U-shaped 96-well cell culture plates at a volume of 100 μL per well.
[0147] Washing: The cells were centrifuged at 500 g for 5 min and washed with Cell Staining Buffer twice.
[0148] Staining: Calculate the amounts of antibody and buffer. A mixture of Cell Staining Buffer and an appropriate amount of antibody against the surface molecule to be detected was prepared. The sample to be detected was resuspended with this mixture and incubated in the dark for about 30 minutes.
[0149] Washing: The cells were centrifuged at 500 g for 5 min and washed with Cell Staining Buffer three times.
[0150] Detection: The cells were resuspended with 200 μL of Cell Staining Buffer, transferred to a flow tube, and detected by flow cytometry.
[0151] After sensing exogenous stimuli, dendritic cells (DCs) upregulate the expression of co-stimulatory molecules and the secretion of cytokines, and migrate to lymph nodes to interact with T and B cells. To evaluate the stimulatory effect of self-assembled virus-like particle HBcAg-E7 on DCs, bone marrow cells were isolated from C57BL / 6 mice and cultured in a medium containing GM-CSF for 8 days to obtain bone marrow-derived immature dendritic cells (BMDCs). HBcAg-E7 and monomeric protein Trx-E7 were added as stimulants to immature BMDCs, and PBS and LPS were set as negative and positive controls, respectively. After incubation for 24 hours, the effects of different stimulants on the maturation of BMDCs were analyzed by flow cytometry ( Figure 5In A). The results showed that, compared with the monomer Trx-E7, the self-assembled HBcAg / E7 could more significantly up-regulate the expression of co-stimulatory molecules CD40, CD83, CD80 and CD86 on the surface of BMDCs ( Figure 5 in B-E) and antigen-presenting molecules (MHC-I and MHC-II) ( Figure 5 in F-G).
[0152] Example 5
[0153] A preparation method of HBcAg-E7 VLPs vaccine
[0154] Mix the AS01-derived adjuvants with different formulations in Table 1 in Example 3 and HBcAg-E7 VLPs at a volume ratio of 1:1 to obtain the HBcAg-E7 VLPs vaccine.
[0155] Example 6
[0156] Cellular immune responses induced by AS01-derived adjuvant vaccines
[0157] To evaluate the effects of different adjuvant formulations on the immunogenicity of HBcAg-E7, a total of nine immunization protocols were designed. Based on the classical AS01 adjuvant (containing MPL and QS-21) as the basic formulation (A1), a series of derived adjuvants were constructed through two different strategies: (1) directly adding immunomodulators to the prepared A1 (such as denoted as A1+3M-052, A1+MDP, A1+3M-052+MDP); (2) co-encapsulating additional immunomodulators during the liposome preparation process (A1, A2, A3 and A4 prepared in Example 3).
[0158] The immunization procedures and groups used were as Figure 6 shown in A. Each mouse was subcutaneously injected with 100 μL of the mixture (50 μL each of HBcAg-E7 and adjuvant), immunized once every four days for a total of three injections. To evaluate the enhanced antigen-specific immune response effects of different adjuvant formulations, the level of specific cytotoxic T lymphocyte (CTL) response was detected by flow cytometry.
[0159] The results showed that, compared with the PBS control group (G1), co-delivery of HBcAg-E7 and adjuvant A2 could significantly enhance the CTL response level. When 3M-052 and MDP were additionally added to A1 (G7), a significantly enhanced CTL response was also observed compared with the group using only adjuvant A1 (G2). It is worth noting that groups G7 and G8 not only showed significant immune enhancement effects, but also reached an immune response level comparable to that of the Freund's adjuvant group (G9).
[0160] When comparing two adjuvant preparation strategies, we found that there were no statistically significant differences in CTL response levels for the same combination of immunomodulators under different addition methods (G3 vs G4, G5 vs G6, G7 vs G8). However, the groups encapsulating immunomodulators during the preparation process showed smaller individual variations, suggesting that this preparation method may have better stability and reproducibility.
[0161] These results indicate that: (1) additional addition of immunomodulators can significantly enhance the adjuvant effect of the AS01 basic formulation; (2) the combined use of multiple immunomodulators may produce a synergistic effect; (3) encapsulating immunomodulators during liposome preparation may be a more reliable adjuvant optimization strategy ( Figure 6 in B, C).
[0162] Example 7
[0163] Evaluation of Therapeutic HPV Vaccine in TC-1 Tumor-Bearing Mouse Model
[0164] 1. Modification Method of TC-1 Cells
[0165] TC-1 is a mouse tumor cell line widely used in HPV-related tumor research and is specially designed by genetic engineering means. TC-1 cells are derived from primary lung epithelial cells of C57BL / 6 mice. The HPV-16E6 protein gene, HPV-16E7 protein gene (which are the main oncogenic proteins of HPV), and the activated ras gene are introduced. TC-1 is from the Cell Bank of the Chinese Academy of Sciences and is preserved by the Molecular Immunology Laboratory of the Institute of Medical Biology, Chinese Academy of Medical Sciences.
[0166] 2. Resuscitation, Culture, and Subculture of TC-1 Cells
[0167] (1) Take out the previously cryopreserved TC-1 cells and quickly thaw them at 37°C.
[0168] (2) Transfer the thawed cells to 10 mL of complete medium and centrifuge at 300 g for 5 min to remove the cryopreservation solution, and collect the cells.
[0169] (3) Resuspend the cells with complete medium and place them in static culture at 37°C.
[0170] (4) When the cells grow to cover the culture flask, digest them with 0.25% trypsin and subculture them at a ratio of 1:3.
[0171] (5) Before cryopreserving the cells, centrifuge to remove the medium, collect the cells, add 1 mL of cell cryopreservation solution, put them into a programmable cooling box and place them in a -80°C freezer, and transfer them to liquid nitrogen for storage after one week.
[0172] 3. Establishment of TC-1 Tumor Model
[0173] (1) Take out the Matrigel from a -20 °C low-temperature refrigerator and place it on ice to melt overnight.
[0174] (2) Culture the cells to the density required for the experiment and collect the cells by trypsin digestion.
[0175] Adjust the cell concentration to 2×10 6 cells / mL, mix well with an equal volume of Matrigel and place on ice.
[0176] (3) Subcutaneously inoculate the cell suspension into C57BL / 6 mice using a syringe, 100 μL for each mouse, so that the amount of TC-1 cells is 1×10 5 cells / mouse.
[0177] Based on the results of the previous immune efficacy evaluation, four potential adjuvant formulations (A1 - A4) were screened out, and their therapeutic effects on TC-1 tumor-bearing mice were further evaluated. As Figure 7 shown in A, when the tumor diameter of the tumor-bearing mice reached 4 - 5 mm, treatment intervention was started, and the same immunization procedure as before was used (subcutaneous injection of 100 μL of the mixture into each mouse, with 50 μL of antigen and adjuvant each, once every 4 days for a total of three times). After the treatment intervention, tumor tissues were collected from TC-1 tumor-bearing mice, and the tumor volume and weight were measured, the tumor size was observed by photographing, and the spleen weight was measured.
[0178] The results showed that all treatment groups exhibited varying degrees of anti-tumor activity. Among them, the effect of using the adjuvant (A1) or HBcAg-E7 VLPs alone was relatively limited, while when the two were used in combination, the anti-tumor effect was significantly improved. It is worth noting that although the A3 adjuvant group showed relatively mild performance in the CTL response evaluation of healthy mice in the early stage, it showed anti-tumor effects comparable to those of A2 in the tumor treatment model. This finding suggests the complex relationship between different immune indicators and treatment effects. With the optimization of the adjuvant components, the treatment effect showed a progressive improvement, and the A4 adjuvant group containing all immunomodulators showed the strongest anti-tumor activity ( Figure 7 shown in B - E).
[0179] Example 8
[0180] Immune Responses Induced by an AS01 Component-Supplemented Derived Adjuvant Vaccine
[0181] To clarify the immunological mechanism behind the treatment effect, flow cytometry analysis was performed on immune cells in the spleen and lymph nodes. In the lymph nodes, it was observed that all adjuvant treatment groups promoted the expansion of CD8 + T cells, and the increase was well correlated with the anti-tumor effects of each group ( Figure 8In the spleen, the CD8 + T cells in the A4 adjuvant group showed the strongest IFN-γ expression level, indicating that it successfully induced a potent cytotoxic T lymphocyte response ( Figure 8 In C and D). Meanwhile, CD4 + T cell subset analysis showed that all adjuvant-containing treatment groups could significantly enhance the function of helper T cells, especially the A4 adjuvant group was the most prominent ( Figure 8 In E and F). This synergistically enhanced CD8 + and CD4 + T cell response may be the key mechanism for its excellent anti-tumor effect.
[0182] It is worth noting that the immune enhancement effect of the adjuvant showed obvious component synergy. From A1 to A4, as the types of immunomodulators increased, the T cell-mediated immune response gradually enhanced, and this progressive relationship was highly consistent with the tumor suppression effect. This finding not only verified the rationality of the adjuvant optimization strategy but also provided an important basis for subsequent adjuvant improvement.
[0183] Meanwhile, to investigate the effects of different component-supplemented AS01-derived adjuvants on the humoral immune response induced by the HBcAg-E7 VLPs vaccine, the HBcAg-specific antibody levels in each group of mice in Example 8 were measured by ELISA.
[0184] As Figure 9 shown, compared with the PBS control group, the group inoculated with HBcAg-E7 VLPs alone could induce a certain level of HBcAg-specific antibodies. When immunized with the four component-supplemented AS01-derived adjuvants A1, A2, A3, and A4 respectively, the detected antibody levels were all significantly higher than those in the VLPs-alone group. It is worth noting that the antibody levels induced among these four derived adjuvant groups were comparable, and there was no significant difference among the groups.
[0185] In summary, through systematic immunological analysis, it was confirmed that optimizing the adjuvant formulation could significantly enhance the anti-tumor immune response, and its mechanism of action mainly included enhancing the function of effector T cells and promoting the activation and expansion of immune cells in lymphoid tissues. Among them, the A4 adjuvant showed the best immune enhancement effect, laying a foundation for subsequent research.
[0186] Example 9
[0187] Tumor treatment effect of the AS01 component-replaced derived adjuvant vaccine
[0188] Based on the previous research results, the impact of adjuvant component replacement strategies on the treatment effect was further explored. The immunization protocol was the same as in the previous experiment: when the tumor diameter of TC-1 tumor-bearing mice reached 4-5 mm, treatment intervention was initiated. Each mouse was subcutaneously injected with 100 μL of a mixture, with 50 μL each of antigen and adjuvant, once every 4 days for a total of three times ( Figure 10 in A).
[0189] First, the repeatability of the previous experimental results was verified. Compared with the use of HBcAg-E7 (G2) alone, both the combined A1 (G3) and A4 (G4) derivative adjuvant groups showed stronger anti-tumor activity. On this basis, the QS-21 replacement strategy was explored, and A5-A10 prepared in Example 3 were used. The experimental results showed that different adjuvant combinations presented a complex pattern in the immune enhancement effect of the HBcAg-E7 vaccine. In terms of tumor growth inhibition, the HBcAg-E7 combined with A5 (MPL + 3M-052 + MDP) and A8 (MPL + MDP + CpG) groups showed the most significant anti-tumor effect. The anti-tumor effects of the A6 (MPL + 3M-052 + CpG), A7, and A9 groups were equivalent to or slightly better than those of the A4 group, while the effect of using CpG alone (A10 group) was similar to that of the basic adjuvant A1 group ( Figure 10 in B-E).
[0190] Based on the immune responses induced by the AS01 component replacement-derived adjuvant vaccine
[0191] The regulatory effect of different adjuvant combinations on the cellular immune response was further analyzed, and the cellular immune response in the tumor microenvironment was analyzed by flow cytometry gating strategy.
[0192] 1. When performing flow cytometry analysis on MDSC cells (CD11b+Gr-1+), surface staining is required, and the staining process is as follows:
[0193] (1) Plating: Adjust the concentration of the obtained lymphocyte suspension to 1×107 cells / mL, and plate it into a U-shaped 96-well cell culture plate at a volume of 100 μL / well.
[0194] (2) Washing: Centrifuge at 500 g for 5 min, and wash the cells with Cell Staining Buffer, repeating 2 times.
[0195] (3) Staining: Calculate the amounts of antibody and buffer, prepare a mixture of Cell Staining Buffer and an appropriate amount of antibody against the surface molecule to be measured, resuspend the sample to be measured with this mixture, and incubate in the dark for about 30 minutes.
[0196] (4) Washing: Centrifuge at 500 g for 5 min, and wash the cells with Cell Staining Buffer, repeating 3 times.
[0197] (5) Detection: Resuspend the cells in 200 μL of Cell Staining Buffer, transfer them to a flow cytometry tube, and perform detection on the instrument.
[0198] 2. When performing flow cytometry analysis on Treg cells (CD4+CD25+Foxp3+), it is necessary to stain intracellular molecules. Therefore, the staining process is as follows:
[0199] (1) Plating: Adjust the concentration of the obtained lymphocyte suspension to 1×107 cells / mL, and plate it into a U-shaped 96-well cell culture plate at a volume of 100 μL / well.
[0200] (2) Washing: Centrifuge at 500 g for 5 min, and wash the cells with Cell Staining Buffer, repeating 2 times.
[0201] (3) Staining: Calculate the amounts of antibody and buffer, prepare a mixture by mixing Cell Staining Buffer with an appropriate amount of antibody against the surface molecule to be detected, resuspend the sample to be detected with this mixture, and incubate in the dark for about 30 minutes.
[0202] (4) Washing: Centrifuge at 500 g for 5 min, and wash the cells with Cell Staining Buffer, repeating 3 times.
[0203] (5) Fixation: Resuspend the cells in 200 μL of TranscriptionFactor 1×Fix solution per well, and fix them in the dark at room temperature for 20 min.
[0204] (6) Nuclear permeabilization: After centrifuging at 500 g for 5 min to remove the supernatant, directly add Transcription Factor 1×Perm Buffer, centrifuge at 500 g for 5 min, and repeat the nuclear permeabilization step 2 times.
[0205] (7) Intracellular molecule staining: Calculate the amounts of antibody and buffer, prepare a mixture by mixing 200 μL of Transcription Factor l×Perm Buffer with an appropriate amount of antibody against the molecule to be detected, resuspend the sample to be detected with this mixture, and incubate in the dark for about 30 minutes.
[0206] (8) Washing: Centrifuge at 500 g for 5 min, and wash the cells with Transcription Factor l×Perm Buffer, repeating 2 times.
[0207] (9) Detection: Resuspend the cells with 200 μL of Cell Staining Buffer, transfer them into a flow cytometry tube, and perform detection on the instrument.
[0208] 4. When performing flow cytometry analysis on CTL response (CD3+CD8+IFN-γ+) and Th1-type response (CD3+CD4+IFN-γ+), intracellular molecules need to be stained. Therefore, the staining process is as follows:
[0209] (1) Plating: Adjust the concentration of the obtained lymphocyte suspension to 1×107 cells / mL, and plate it into a U-shaped 96-well cell culture plate at a volume of 100 μL / well. If CTL indicators need to be detected, stimulation (step 2) should be completed before detection.
[0210] (2) Stimulation: Dissolve the E749-57 stimulatory peptide to a concentration of 1 mg / mL, add 5 μL to each well of cells, and after 2 hours of stimulation, dilute the 1000×Brefeldin A solution 100-fold, add 10 μL to each well, and stimulate for 5 hours.
[0211] (3) Washing: Centrifuge at 500 g for 5 minutes, and wash the cells with Cell Staining Buffer, repeating 2 times.
[0212] (4) Staining: Calculate the amounts of antibody and buffer, prepare a mixture of Cell Staining Buffer and an appropriate amount of antibody against the surface molecule to be detected, resuspend the sample to be detected with this mixture, and incubate in the dark for about 30 minutes.
[0213] (5) Washing: Centrifuge at 500 g for 5 minutes, and wash the cells with Cell Staining Buffer, repeating 3 times.
[0214] (6) Fixation: Add 200 μL of 1×Fixation Buffer to each well of the sample, resuspend the cells, and fix them in the dark at room temperature for 20 minutes.
[0215] (7) Washing: Centrifuge at 500 g for 5 minutes, and wash the cells with pre-cooled Cell Staining Buffer, repeating 3 times.
[0216] (8) Permeabilization: Dilute 10×Permeabilization Wash Buffer with sterile and enzyme-free water to 1×Permeabilization Wash Buffer, add 200 μL to each well to resuspend the cells, centrifuge at 500 g for 5 minutes, and repeat the permeabilization step 2 times.
[0217] (9) Intracellular molecule staining: Calculate the amounts of antibody and buffer. Prepare a mixture by combining 1×Permeabilization Wash Buffer with an appropriate amount of antibody against the molecule to be tested, and resuspend the sample to be tested with this mixture. Incubate in the dark for about 30 minutes.
[0218] (10) Washing: Centrifuge at 500 g for 5 min, and wash the cells with pre-cooled 1×Permeabilization Wash Buffer. Repeat 3 times.
[0219] Detection: Resuspend the cells with 200 μL of Cell Staining Buffer, transfer them to a flow cytometry tube, and perform detection on the instrument.
[0220] Results showed that group A6 exhibited unique advantages: the proportions of tumor-infiltrating CTL and Th1 cells in it were significantly higher than those in other groups ( Figure 11 in A - D). It is worth noting that although group A8 showed a significant tumor suppression effect, the immune cell activation index in its tumor microenvironment was not prominent. The number of IFN-γ-secreting cells evaluated by ELISpot analysis showed that groups A4, A5, and A6 performed prominently, with A4 > A6 > A5, suggesting that these adjuvant combinations have advantages in inducing systemic immune responses ( Figure 11 in E, F).
[0221] In terms of immunosuppressive cells, the adjuvant combinations containing CpG (groups A6 - A10) significantly reduced the proportion of Treg cells in the tumor microenvironment. Meanwhile, groups A6 - A9 performed excellently in reducing the level of MDSC in the tumor microenvironment, while groups A7 - A9 were significant in reducing MDSC in the spleen ( Figure 12 in A - F).
[0222] In-depth analysis of the synergistic action mechanism of adjuvant components found that MPL, as a TLR4 agonist, plays a core role in the entire adjuvant system. Almost all combinations with significant effects contain MPL, indicating that it may be the basis for constructing an effective adjuvant system. MPL promotes the maturation of antigen-presenting cells and the production of cytokines, providing a good immune microenvironment for other adjuvants to play their roles. The addition of 3M-052 (a TLR7 / 8 agonist) further enhanced the immune effect of the vaccine. Combinations containing 3M-052 (A4 - A7) generally showed stronger systemic immune responses, especially showing stronger IFN-γ secretion ability in ELISpot detection, which may be related to the promotion of Th1-type immune responses by the activation of the TLR7 / 8 pathway.
[0223] The addition of CpG (TLR9 agonist) brings unique advantages to the adjuvant system, significantly improving the immunosuppressive microenvironment, especially in reducing the levels of Treg and MDSC in the tumor microenvironment. The excellent performance of Group A6 (MPL + 3M-052 + CpG) in T cell activation suggests that CpG may have a significant synergistic effect with other TLR agonists. MDP (NOD2 agonist) shows a more complex mode of action, and its effect seems to be highly dependent on the combination with other adjuvants, which is reflected in the potent tumor suppression effect of Groups A5 and A8. The role of QS-21 is rather special. In combinations containing multiple TLR agonists, some combinations (such as A5 and A8) without QS-21 show better effects, suggesting that the role of QS-21 may not be necessary in the presence of multiple TLR agonists.
[0224] While evaluating cellular immunity, we also detected the effects of different component-replaced AS01-derived adjuvants on the immunogenicity of the HBcAg-E7 VLPs vaccine. In this example, the enzyme-linked immunospot assay (ELISpot) was used to detect the levels of HBcAg-specific antibodies in the sera of mice in different immunization groups. The specific steps of the enzyme-linked immunospot assay (ELISpot) are as follows:
[0225] (1) Washing: Wash 4 times with PBS (200 μL / well) in a sterile environment.
[0226] (2) Activation: Activate the plate with RPMI-1640 complete medium containing 10% fetal bovine serum and incubate at room temperature for at least 30 minutes.
[0227] (3) Plating: Adjust the concentration of the cell suspension to 3×10 6 cells / mL, add it to the plate (100 μL / well), set negative and positive controls, and do not add cells to the blank control.
[0228] (4) Stimulation: Dissolve the E749-57 stimulatory peptide to a concentration of 1 mg / mL, add 5 μL to each well of cells (except control wells), add only RPMI-1640 complete medium to the blank and negative controls, and add 10 μL of PMA to the positive control. Place the plate in a 37°C CO 2 incubator and culture for 18 - 48 h without moving the plate during this period.
[0229] (5) Washing: Pour out the medium in the plate, rinse the plate 5 times with PBS, and drain the remaining PBS.
[0230] (6) Incubation: Dilute the detection antibody to 1 μg / mL with PBS containing 0.5% fetal bovine serum and add it to the sample wells (100 μL / well). After incubating at room temperature for 2 h, wash the plate 5 times with PBS and drain the remaining PBS.
[0231] (7) Incubation: Dilute Steptavidin-ALP with PBS containing 0.5% fetal bovine serum at a ratio of 1:1000 and add it to the sample wells (100 μL / well). After incubating at room temperature for 1 h, wash the plate 5 times with PBS and drain the remaining PBS.
[0232] (8) Color development: Filter the substrate solution with a 0.45 μm filter and add it to the sample wells (100 μL / well) until obvious spots appear.
[0233] (9) Termination: Rinse with tap water to terminate the reaction. After air-drying the plate, visualize the spots with an ELISpot reader system.
[0234] As Figure 13 shown, compared with the PBS control group, the group inoculated with HBcAg-E7 VLPs alone could induce a certain level of HBcAg-specific antibodies. Although there is still room for improvement in the anti-tumor effect of the A1 adjuvant based on the classic AS01 formulation, it shows a significant enhancing effect on humoral immunity, and this effect is not significantly improved even in the formulations with subsequent addition of other immunomodulators, indicating that the A1-derived adjuvant based on the AS01 formulation has reached an ideal level in enhancing humoral immunity. Interestingly, although QS-21 has been replaced in groups A6 and A8, they still show an antibody response level comparable to that of group A1 containing QS-21, indicating that some alternative components may achieve similar humoral immunity enhancing effects through different mechanisms. However, the humoral immune responses of other adjuvant groups without QS-21 (A5, A7, A9, and A10) are relatively weak, indicating that QS-21, as one of the core components of the AS01 adjuvant system, plays an important role in coordinating the balance of cellular and humoral immune responses.
[0235] In summary, the optimal adjuvant combination should consider the co-activation of multiple immune pathways, the improvement of the immunosuppressive microenvironment, and the balance of systemic and local immune responses. This explains why some combinations (such as A5, A6, A8) show different performances in different immune indexes but can all achieve significant anti-tumor effects. These findings not only provide an important theoretical basis for optimizing the adjuvant combination of tumor vaccines but also offer new ideas for the personalized design of immunotherapy strategies.
[0236] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. An AS01-derived adjuvant, characterized in that: The invention comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine and at least one of the following components by weight: 0.1-0.2 parts by weight of monophosphoryl lipid A, 0.1-0.2 parts by weight of QS-21, 0.36-0.72 parts by weight of 3M-052, 0.4-0.8 parts by weight of muramyl dipeptide and 0.2-0.4 parts by weight of oligodeoxynucleotide.
2. The AS01-derived adjuvant according to claim 1, characterized in that including a first AS01-derived adjuvant, a second AS01-derived adjuvant, a third AS01-derived adjuvant, a fourth AS01-derived adjuvant, a fifth AS01-derived adjuvant, a sixth AS01-derived adjuvant, a seventh AS01-derived adjuvant, an eighth AS01-derived adjuvant, a ninth AS01-derived adjuvant and a tenth AS01-derived adjuvant; The first AS01-derived adjuvant includes 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts by weight of monophosphoryl lipid A, and 0.1-0.2 parts by weight of QS-21; The second AS01-derived adjuvant includes 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.1-0.2 parts of QS-21, and 0.36-0.72 parts of 3M-052; The third AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.1-0.2 parts of QS-21, and 0.4-0.8 parts of muramyl dipeptide; The fourth AS01-derived adjuvant includes 0.5-1.0 parts by mass of cholesterol, 2.0-4.0 parts by mass of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.1-0.2 parts of QS-21, 0.36-0.72 parts of 3M-052, and 0.4-0.8 parts of muramyl dipeptide; The fifth AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.36-0.72 parts of 3M-052, and 0.4-0.8 parts of muramyl dipeptide; The sixth AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.36-0.72 parts of 3M-052, and 0.2-0.4 parts of oligodeoxynucleotides; The seventh AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.36-0.72 parts of 3M-052, 0.4-0.8 parts of muramyl dipeptide and 0.2-0.4 parts of oligodeoxynucleotide; The eighth AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoyl phosphatidylcholine, 0.1-0.2 parts of monophosphoryl lipid A, 0.4-0.8 parts of muramyl dipeptide and 0.2-0.4 parts of oligodeoxynucleotide; The ninth AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoylphosphatidylcholine, 0.1-0.2 parts by weight of monophosphoryl lipid A and 0.2-0.4 parts by weight of oligodeoxynucleotide; The tenth AS01-derived adjuvant comprises 0.5-1.0 parts by weight of cholesterol, 2.0-4.0 parts by weight of dioleoylphosphatidylcholine and 0.2-0.4 parts by weight of oligodeoxynucleotide.
3. The AS01-derived adjuvant according to claim 1 or 2, characterized in that: Also includes solvents; The solvent includes a phosphate buffer having a pH value of 6 to 6.2; In the AS01-derived adjuvant, the concentration of cholesterol is 0.5-1.0 mg / mL.
4. A method for preparing the AS01-derived adjuvant according to any one of claims 1 to 3, characterized in that: The following steps are involved: Dissolving cholesterol, dioleoylphosphatidylcholine and 0 to 2 components selected from monophosphoryl lipid A and 3M-052 to prepare a membrane to obtain a lipid membrane; At least one of muramyl dipeptide, QS-21 and oligodeoxynucleotide is dissolved and then mixed and emulsified with the lipid membrane to obtain an AS01-derived adjuvant.
5. The preparation method according to claim 4, characterized in that: The dissolving solvent in the dissolving film-forming process includes anhydrous ethanol; In the film-making method of the dissolving film-making, the dissolved oil phase mixture is subjected to rotary evaporation to remove anhydrous ethanol, so that the oil phase mixture forms a thin film; the rotary evaporation temperature is lower than 37°C.
6. The preparation method according to claim 4, characterized in that: The solvent for dissolving at least one of the muramyl dipeptide, QS-21 and oligodeoxynucleotide comprises a phosphate buffer with a pH value of 6 to 6.
2.
7. A vaccine or medicine, characterized in that The adjuvant in the vaccine or drug is the AS01-derived adjuvant described in any one of claims 1 to 3 or the AS01-derived adjuvant prepared by the preparation method described in any one of claims 4 to 6.
8. The vaccine according to claim 7, characterized in that The vaccine is an HPV vaccine; The immunogen in the HPV vaccine includes HBcAg-E7 virus-like particles.
9. Use of the AS01-derived adjuvant according to any one of claims 1 to 3 or the AS01-derived adjuvant prepared by the preparation method according to any one of claims 4 to 6 in the preparation of anti-tumor drugs or vaccines.
10. The use according to claim 9, characterized in that: The tumors in the anti-tumor include cancers caused by human papillomavirus infection; The cancer includes at least one of the following: cervical cancer, anal cancer, penile cancer, oral cancer and throat cancer.
Citation Information
Cited By
Saponin liposome immunologic adjuvant and preparation method thereof
CN121550418A
TLR9+HA201 composite adjuvant as well as preparation method and application thereof
CN121868477A