Molecular marker for identifying genetic sex or / and sex determination system of grass carp and application of molecular marker

Abstract

The invention belongs to the field of fish sex determination system identification, and discloses a molecular marker, a primer pair and a kit for identifying the genetic sex or / and sex determination system of grass carp and application. According to the invention, sex chromosomes of chromosome level genomes published by grass carps are determined on the basis of grass carp whole genome re-sequencing analysis, and molecular markers for identifying the genetic sex and sex determination system of grass carps are developed. The molecular marker can accurately and conveniently determine the genetic sex and sex determination system of the grass carp, also can perform genetic sex identification without being limited by the development time of the grass carp, is used for early breeding of the grass carp, and saves time. The molecular marker and the primer pair provided by the invention have important significance for research on sex control breeding of grass carp.

Description

Technical Field

[0001] The invention relates to identification of fish genetic sex in the technical field of aquatic biology, and in particular to a molecular marker, a primer pair, and a kit for genetic sex or / and sex determination system of grass carp, and genetic sex identification application based on the molecular marker. Background Art

[0002] grass carp( Ctenopharyngodon idella ) is one of the important economic freshwater fish species, widely distributed in Asia, especially in China's aquaculture. As one of China's four major carps, grass carp production accounts for a large proportion of the country's freshwater aquaculture. Due to its high growth rate, good adaptability and wide range of food sources, grass carp has become one of the species with great development potential in the global aquaculture industry. However, in the process of grass carp farming, sex control and sex determination mechanism have become important factors affecting production efficiency. In the grass carp farming industry, uneven sex ratio may have a significant impact on production, reproductive efficiency and economic benefits. Studies have shown that male grass carp usually have faster growth rates and higher feed conversion efficiency, which makes increasing the proportion of male fish through sex control a key technical need in the field of aquaculture.

[0003] With the continuous development of molecular biology technology, molecular marker technology has become an important tool for studying the sex determination mechanism of aquatic animals. Molecular markers can not only be used for early identification of sex, but also help reveal gene loci related to sex determination. By applying molecular marker technology, the genetic sex of individuals can be quickly identified in the embryonic or early juvenile stages of grass carp, thus providing effective support for selective breeding and sex control. At present, commonly used molecular marker technologies include microsatellite markers (SSR), single nucleotide polymorphisms (SNPs) and restriction fragment length polymorphisms (RFLPs). These markers can not only be used for genomic research, but also help to accurately locate genes related to sex determination.

[0004] Sex identification research based on molecular markers can not only improve breeding efficiency, but also provide a basis for in-depth analysis of the sex determination mechanism of grass carp. However, the application of existing molecular marker technology in grass carp still faces challenges. Therefore, in order to meet the needs of sex control in grass carp farming, it is urgent to develop stable, efficient and highly specific genetic sex molecular markers. These molecular markers can not only be used for sex identification of grass carp, but also provide a solid foundation for the development of breeding and sex control technology. In addition, sex control technology based on molecular markers also has broad application prospects. It can not only increase the aquaculture yield of grass carp, but also effectively reduce aquaculture costs and promote the sustainable development of the grass carp industry. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a molecular marker, primer pair, kit and application that can quickly, easily and accurately identify the genetic sex and / or sex determination system of common grass carp.

[0006] In order to solve the above technical problems, the technical solution proposed by the present invention is: In a first aspect, to achieve the above-mentioned purpose, the present invention provides a molecular marker for identifying the genetic sex and / or sex determination system of grass carp, wherein the molecular marker is a 30 bp insertion sequence present in the genome of male grass carp individuals, and the nucleotide sequence thereof is TTTTTATTTATTTATTTTTTTTGTGTGTGTG, as shown in SEE ID NO: 1.

[0007] In a second aspect, the present invention provides a primer pair for amplifying the above-mentioned molecular marker, wherein the primer pair comprises an upstream forward primer CY-F and a downstream reverse primer CY-R, and the nucleotide sequence thereof is as follows: CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5' (SEQ ID NO.2), CY-R: 3'-CATCGGTCCTGTCTTGTT-5' (SEQ ID NO. 3).

[0008] In a third aspect, the present invention provides a kit for identifying the genetic sex and / or sex determination system of grass carp, comprising the primer pair.

[0009] The above-mentioned kit, preferably, further comprises Tag DNA Polymerase, an extension promoting factor, dNTP, a buffer system and ddH 2 One or more of O.

[0010] In a fourth aspect, the present invention provides an application of the molecular marker, the primer pair or the kit in identifying the genetic sex and / or sex determination system of grass carp.

[0011] In a fifth aspect, the present invention provides a method for identifying the genetic sex and / or sex determination system of grass carp, comprising the following steps: (1) Extracting DNA samples from grass carp to be tested; (2) using the DNA sample extracted in step (1) as a template, performing PCR amplification using the primer pair described in claim 2, and subjecting the PCR amplification product to agarose gel electrophoresis; (3) If the result of the agarose gel electrophoresis shows a single specific band, it means that the grass carp individual to be tested is genetically a female fish with a sex chromosome genotype of XX; if the result of the agarose gel electrophoresis shows two bands of different sizes, it means that the grass carp individual to be tested is genetically a male fish with a sex chromosome genotype of XY; thus, it is determined that the sex determination system of grass carp is XX / XY type.

[0012] In the above method for identifying the genetic sex of grass carp, preferably, the reaction system of the PCR amplification is: 1 μL of DNA template, 5 μL of Rapid Taq Master Mix, 0.4 μL of each of the forward and reverse primers, and finally adding ddH 2 O 3.2 μL to make up the total volume to 10 μL; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoting factor, dNTP and buffer system.

[0013] Preferably, the conditions for PCR amplification are: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 46.5°C for 15 s, extension at 72°C for 15 s, 35 cycles, and then final extension at 72°C for 5 min, and finally storage at 4°C.

[0014] Preferably, the agarose gel electrophoresis is 3.0-3.5% agarose gel electrophoresis.

[0015] Compared with the prior art, the present invention has the following beneficial effects: (1) The molecular markers and primer pairs provided by the present invention that can be used to distinguish the genetic sex and sex determination system of grass carp can be used to identify the genetic sex and sex determination system of grass carp without being restricted by the development time of grass carp, and can be used for early breeding of grass carp, saving time.

[0016] (2) The molecular marker and identification method provided by the present invention is accurate, reliable, easy to operate and low-cost; it is of great significance for the research on sex-controlled breeding of grass carp. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 This is a map of the sex determination region on chromosome 3 of grass carp.

[0019] Figure 2 Design diagram of molecular markers for identifying the genetic sex of grass carp.

[0020] Figure 3 This is a PCR agarose gel electrophoresis diagram of using the molecular markers of Example 1 to identify the genetic sex and sex determination system of grass carp. DETAILED DESCRIPTION

[0021] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0022] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0023] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0024] Embodiment 1: A molecular marker for identifying the genetic sex and sex determination system of grass carp, the method for obtaining the molecular marker is as follows: 1. Sample DNA extraction First, the sex of grass carp is determined by dissecting and observing the gonadal tissue. After determination, muscle tissue is collected and preserved and fixed with anhydrous ethanol. The grass carp samples of determined sex are accurately numbered to facilitate subsequent whole genome resequencing analysis.

[0025] The genomic DNA of grass carp samples was extracted using the Qingke DNA extraction kit. After the extraction, the purity, concentration and quality of the DNA were tested. First, the purity of the extracted DNA was tested using NanoDrop 2000&8000 and a micro-spectrophotometer; then the DNA concentration was tested using a Qubit fluorescence photometer; finally, the integrity of the DNA was tested using agarose gel electrophoresis, and the high-throughput sequencing library was constructed for the qualified DNA; then individual genome resequencing was performed separately; after sequencing, the total clean reads of the original data obtained from ten males and ten females were 1016.33 M and 1059.56 M, respectively.

[0026] 2. Determination of sex chromosomes of grass carp The raw data obtained by sequencing was quality controlled and analyzed using the software fastp to obtain high-quality cleanreads; then the clean reads were compared with the reference genome of grass carp (NCBI has published the complete genome sequence of grass carp, and its NCBI accession number is: GCF_019924925.1) using the software BWA. The software parameters analyzed here are the default parameters; the compared sam files were further converted into bam files using samtools; the bam files generated after comparison were further removed using picard software to remove PCR duplicate sequences during sequencing; and gatk4 software was used to perform variation detection on individual samples and merge SNP sites after detection. Use vcftools to calculate the Fst (i.e., the average inbreeding coefficient between related local populations) index of SNPs between groups. Use the --freq function in vcftools to calculate the SNP frequencies between groups, calculate the differences in SNP frequencies between groups, and use the ED value calculation in BSA (bulk segregant analysis) to calculate the Euclidean distance between groups, and calculate the total number of SNPs with abs (ΔSNP frequency) greater than 0.5 between groups. Then combine these three results to further determine the sex chromosomes and sex determination candidate regions of grass carp. The results show that chromosome 3 of grass carp is its sex chromosome and Chr3: 11,000,000-11,300,000 is the sex determination region of grass carp ( Figure 1 ).

[0027] 3. Gender-specific regional screening According to the determined candidate sex determination region, the generated bam file was viewed using the visualization software IGV. Finally, at Chr3: 11122641-11122741 of grass carp chromosome, there was a 30 bp sequence difference between the genomes of male and female individuals, that is, there was a 30 bp insertion sequence (TTTTTATTTATTTATTTTTTTTGTGTGTGTG, the nucleotide sequence of which is shown in SEQ ID NO.1) in the genome of the grass carp individual with molecular marker as male. Primers were further designed upstream and downstream of this difference, and finally the upstream primer CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5' (the nucleotide sequence of which is shown in SEQ ID NO.2) and the downstream primer CY-R: 3'-CATCGGTCCTGTCTTGTT-5' (the nucleotide sequence of which is shown in SEQ ID NO.3) were designed.

[0028] Embodiment 2: The application of the molecular markers of Example 1 in identifying the genetic sex and sex determination system of grass carp comprises the following steps: 1. PCR amplification: Cut the muscle tissue of the grass carp to be tested, use a genomic DNA extraction kit or a conventional phenol-chloroform method to extract the genomic DNA. After extraction, use agarose gel electrophoresis to test the integrity of the extracted genomic DNA and whether the extraction is successful; 2. Synthesize forward and reverse primers. The forward primer is named CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5' (SEQ ID NO.2), and the downstream primer is named CY-R: 3'-CATCGGTCCTGTCTTGTT-5' (SEQ ID NO.3). The primers were synthesized by Qingke Biotechnology Co., Ltd. ( Figure 2 ); 3. Using the extracted genomic DNA as a template, perform PCR amplification experiments. The total PCR reaction system is 10 μL, including the following components: 1 μL DNA template, 5 μL Rapid Taq Master Mix (containing Tag DNA Polymerase, extension promoter, dNTP and optimized buffer system), 0.4 μL forward and reverse primers, and finally ddH 2 Add 3.2 μL of O to a total volume of 10 μL, mix by pipetting, and centrifuge briefly; 4. Perform PCR amplification on the machine. The PCR amplification program is set as follows: Pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 46.5 °C for 15 s, extension at 72 °C for 15 s, 35 cycles, and final extension at 72 °C for 5 min, and finally storage at 4 °C; 5. The PCR amplification product was tested by agarose gel electrophoresis. First, 3.5% agarose gel was prepared. After the preparation was completed, the electrophoresis experiment was performed. The voltage was set to 220 V, the current was set to 100 mA, and the running time was set to 15 min. After the electrophoresis was completed, the agarose gel was taken out of the electrophoresis tank and placed in a gel imager for imaging analysis. 6. Result judgment and analysis, the results are as follows Figure 3 As shown, the result of agarose gel electrophoresis showed a single specific band of 159 bp in length, indicating that the grass carp individual to be tested is genetically female, and the sex chromosome genotype is XX. The result of agarose gel electrophoresis showed two bands of different sizes (159 bp and 188 bp), indicating that the grass carp individual to be tested is genetically male, and the sex chromosome genotype is XY. It is thus determined that the sex determination system of grass carp is XX / XY.

Claims

1. A molecular marker for identifying the genetic sex and / or sex determination system of grass carp, characterized in that: The molecular marker is a 30 bp insertion sequence in the genome of the male grass carp individual, and its nucleotide sequence is TTTTTATTTATTTATTTTTTTTGTGTGTGTG.

2. A primer pair for amplifying the molecular marker described in claim 1, characterized in that: The primer pair includes an upstream forward primer CY-F and a downstream reverse primer CY-R, and the nucleotide sequence thereof is as follows: CY-F: 3'-ATAGTTGTGCTTGGAGTCA-5', CY-R: 3'-CATCGGTCCTGTCTTGTT-5'.

3. A kit for identifying the genetic sex and / or sex determination system of grass carp, characterized in that: Comprising the primer pair described in claim 2.

4. The kit according to claim 3, characterized in that The kit further comprises one or more of Tag DNA Polymerase, an extension promoting factor, dNTP, a buffer system and ddH2O.

5. Use of the molecular marker according to claim 1, the primer pair according to claim 2 or the kit according to any one of claims 3 to 4 in identifying the genetic sex and / or sex determination system of grass carp.

6. A method for identifying the genetic sex and / or sex determination system of grass carp, characterized in that: The steps include: (1) Extracting DNA samples from grass carp to be tested; (2) using the DNA sample extracted in step (1) as a template, performing PCR amplification using the primer pair described in claim 2, and subjecting the PCR amplification product to agarose gel electrophoresis; (3) If the result of the agarose gel electrophoresis shows a single specific band, it means that the grass carp individual to be tested is genetically a female fish with a sex chromosome genotype of XX; if the result of the agarose gel electrophoresis shows two bands of different sizes, it means that the grass carp individual to be tested is genetically a male fish with a sex chromosome genotype of XY; thus, it is determined that the sex determination system of grass carp is XX / XY type.

7. The method according to claim 6, characterized in that The reaction system of the PCR amplification is: 1 μL of DNA template, 5 μL of Rapid Taq Master Mix, 0.4 μL of each forward and reverse primer, and finally 3.2 μL of ddH2O is added to make the total volume 10 μL; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoting factor, dNTP and buffer system.

8. The method according to claim 6, characterized in that The conditions for the PCR amplification were as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 46.5°C for 15 s, extension at 72°C for 15 s, 35 cycles, and final extension at 72°C for 5 min, followed by storage at 4°C.

9. The method according to claim 6, characterized in that The agarose gel electrophoresis is 3.0-3.5% agarose gel electrophoresis.

Images