Application of DHRS4 as biomarker in diagnosis of preeclampsia

Abstract

The invention discloses a preeclampsia diagnosis and treatment biological marker and application thereof. The mechanism that high-expression DHRS4 induces PE generation by inhibiting invasiveness of trophoblasts is deeply demonstrated from clinical samples, cells and in-vivo levels, and the mechanism that overexpression DHRS4 binds and up-regulates LONP2 and degrades TFAM protein through ubiquitination to cause mitochondrial dysfunction, weaken migration and invasion ability of trophoblasts and participate in PE generation is used for preventing and treating PE generation. The method is a new mechanism clue obtained according to a pre-experiment result and informatics analysis and is a new target for deeply exploring PE clinical diagnosis and treatment, and research results can provide a theoretical basis for guiding PE early prediction and intervention in the future.

Description

Technical Field

[0001] The present invention belongs to the field of clinical medicine, and specifically relates to the application of DHRS4 as a biomarker in diagnosing preeclampsia. Background Art

[0002] Preeclampsia (PE) is a serious complication of pregnancy, mainly manifested by new hypertension after 20 weeks of pregnancy accompanied by symptoms such as proteinuria or edema; severe PE can lead to hemolysis, elevated liver enzymes, thrombocytopenia, and even damage to multiple systemic organs, seriously affecting the health of mothers and children. At the same time, the risk of major chronic diseases in PE patients and their children in the future is also significantly increased. According to statistics, the global incidence of PE is 5% to 10%, and about 63,000 pregnant women die from PE each year, of which about 10% to 15% are in my country (Kong Beihua Ma, Duan Tao. Obstetrics and Gynecology (10th Edition) [M]. People's Medical Publishing House, 2024.; Gestational Hypertension and Preeclampsia: ACOG Practice Bulletin, Number 222 [J]. Obstet Gynecol, 2020, 135 (6): e237-e60). At present, there is still a lack of effective clinical treatment for PE, and early termination of pregnancy is often the only effective means. Therefore, it is of great significance to actively carry out research on the pathogenesis of PE and seek more effective diagnosis and treatment methods.

[0003] The function and mechanism of DHRS4 in the occurrence of PE have not been reported. Therefore, the present invention provides new theoretical support for understanding the pathogenesis of PE and may be a potential target for clinical prediction, diagnosis and even treatment of PE. Summary of the invention

[0004] To solve the above problems, the present invention discloses the application of DHRS4 as a biomarker in the diagnosis of preeclampsia. DHRS4 binds to and upregulates the expression of LONP2, ubiquitin-degrades TFAM protein, leads to mitochondrial dysfunction, reduces oxidative phosphorylation, thereby promoting EVT apoptosis and reducing invasive ability, affecting the remodeling process of uterine spiral arteries, and then triggering the occurrence and development of PE.

[0005] To achieve the above object, the technical solution of the present invention is as follows:

[0006] The present invention provides use of a reagent for detecting the expression level of DHRS4 in preparing a preeclampsia diagnostic kit, wherein the sequence of the DHRS4 is shown in SEQ ID NO.1.

[0007] Furthermore, the reagent for detecting DHRS4 includes a primer pair for specifically detecting DHRS4 expression.

[0008] Furthermore, the upstream primer sequence of the primer pair is shown as SEQ ID NO.2, and the downstream primer sequence of the primer pair is shown as SEQ ID NO.3.

[0009] Furthermore, DHRS4 was highly expressed in patients with preeclampsia.

[0010] The present invention also provides use of a DHRS4 low expression reagent in preparing a drug for treating preeclampsia, wherein the sequence of the DHRS4 is shown in SEQ ID NO.1.

[0011] Furthermore, the low expression reagent includes shDHRS4-1#, shDHRS4-2#, and shDHRS4-3#; the sequence of the shDHRS4-1# is shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the shDHRS4-2# is shown in SEQ ID NO.6 and SEQ ID NO.7; the sequence of the shDHRS4-3# is shown in SEQ ID NO.8 and SEQ ID NO.9.

[0012] SEQ ID NO.8

[0013] 5'-3'CCGGGGCTTGGAATTCGGTGCGGATCTCGAGATCCGCACCGAATTCCAAGCCT TTTTG;

[0014] SEQ ID NO.9

[0015] 5'-3'AATTCAAAAAGGCTTGGAATTCGGTGCGGATCTCGAGATCCGCACCGAATTCC AAGCC.

[0016] The present invention also provides a kit for diagnosing preeclampsia, wherein the kit comprises the primer pair described above.

[0017] The present invention also provides a medicine for treating preeclampsia, wherein the medicine comprises a DHRS4 low expression reagent, and the sequence of the DHRS4 is shown in SEQ ID NO.1.

[0018] The beneficial effects of the present invention are:

[0019] The present invention discovered for the first time that DHRS4 is significantly highly expressed in PE placental tissue, and DHRS4 can be used as a biological marker for the diagnosis and treatment of preeclampsia.

[0020] The present invention further verifies that changes in mitochondrial structure and function are related to mtDNA abnormalities. The ratio of mtDNA / nDNA was calculated by RT-qPCR experiments. The results show that high expression of DHRS4 may lead to mitochondrial morphological structure disorder and functional abnormalities by affecting abnormal mtDNA synthesis.

[0021] The present invention finds that DHRS4 accelerates TFAM degradation by binding to and upregulating the expression of LONP2, thereby affecting mitochondrial biological functions and participating in regulating the occurrence and development of preeclampsia.

[0022] The present invention reveals a new regulatory network mediated by DHRS4, which is an important determinant of the pathogenesis of PE, helps to predict and diagnose preeclampsia, and deeply understands the mechanism of embryo implantation, and provides a new theoretical basis for the clinical treatment of preeclampsia targeting DHRS4. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Screening of DHRS4 gene for mass spectrometry analysis of PE placenta and normal placenta tissue;

[0024] Among them, (A) Proteomic analysis of cluster analysis heat map of proteins with differential expression of more than 1.5 times in placental tissue of PE patients compared with placental tissue of normal pregnant women; (B) Venn diagram of samples between PE group and placental tissue of normal pregnant women; (C) Volcano map was drawn based on the two factors of protein expression difference (Fold change) and p value (T-test), in which significantly down-regulated proteins were marked in green (FC<0.63 and p<0.05), significantly up-regulated proteins were marked in red (FC>1.5 and p<0.05), and proteins with no difference were marked in black;

[0025] Figure 2 DHRS4 is significantly highly expressed in PE placenta tissue;

[0026] (A) RT-qPCR was used to detect the expression level of DHRS4 mRNA in normal placenta tissue (n=50) and PE placenta tissue (n=50); (B) Western blotting was used to detect the expression level of DHRS4 protein in 6 pairs of normal placenta and PE placenta tissue; (C) H&E staining was used to analyze the structural changes of PE placenta tissue and normal placenta tissue; (D) Immunohistochemistry (IHC) was used to detect the distribution and expression level of DHRS4 protein in normal placenta and PE placenta; (E) Immunofluorescence (IF) was used to detect the fluorescence intensity of DHRS4 protein in normal placenta and PE placenta. The above experiments were repeated three times; ( * P<0.05, **P<0.01);

[0027] Figure 3 High expression of DHRS4 inhibits the proliferation, migration and invasion of trophoblastic cells HTR-8 / SVneo and BeWo, and increases the proportion of cell apoptosis;

[0028] Among them, (A) After overexpressing DHRS4 in the trophoblast cell lines HTR-8 / SVneo and BeWo, the EDU experiment was used to explore the changes in the proliferation ability of trophoblast cells after overexpressing DHRS4. Scale bar: 50μm; (B) The MTT experiment was used to detect the changes in the proliferation ability of HTR-8 / SVneo and BeWo cells after overexpressing DHRS4; (C) The Transwell experiment was used to detect the changes in the invasion and migration ability of the trophoblast cell lines HTR-8 / SVneo and BeWo cells after overexpressing DHRS4; Scale bar: 100μm; (D) The angiogenesis experiment was used to detect the changes in the angiogenesis ability of the trophoblast cell line after overexpressing DHRS4. The above experiments were repeated three times; (E) The flow cytometer was used to detect the apoptosis ratio of HTR-8 / SVneo and BeWo cells after transfection and overexpression of DHRS4. The above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0029] Figure 4 Analysis of RNA-seq results after overexpression of DHRS4;

[0030] Among them, (A) heat map analysis of differentially expressed gene profiles in the control group and HTR-8 / SVneo trophoblast cells treated with overexpression of DHRS4; (B) heat map (right) analysis of differentially expressed gene profiles in the control group and HTR-8 / SVneo trophoblast cells treated with knockdown of DHRS4; (C) GO analysis of the biological processes involved in differentially expressed genes in HTR-8 / SVneo trophoblast cell lines treated with overexpression of DHRS4; (D) GO analysis of the biological processes involved in differentially expressed genes in HTR-8 / SVneo trophoblast cell lines treated with knockdown of DHRS4; (E) KEGG functional enrichment analysis of the signal pathways involved in differentially expressed genes in HTR-8 / SVneo trophoblast cell lines treated with overexpression of DHRS4; (F) KEGG functional enrichment analysis of the signal pathways involved in differentially expressed genes in HTR-8 / SVneo trophoblast cell lines treated with knockdown of DHRS4; ( * P<0.05, ** P<0.01);

[0031] Figure 5 Phenotypic experiments related to the effect of DHRS4 on mitochondrial morphology;

[0032] Among them, (A) The change in the ratio of mtDNA / nDNA in HTR-8 / SVneo cells after overexpression of DHRS4 was verified by mitochondrial separation experiments and RT-qPCR experiments; (B) The change in the ratio of mtDNA / nDNA in HTR-8 / SVneo cells after knocking down DHRS4 was verified by mitochondrial separation experiments and RT-qPCR experiments; (C) Changes in mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo after overexpression of DHRS4 under confocal microscopy and quantification; scale bar: 20μm; (C) Changes in mitochondrial morphology and fluorescence intensity in HTR-8 / SVneo after overexpression of DHRS4 under confocal microscopy and quantification; scale bar: 20μm; (D) Changes in mitochondrial morphology and fluorescence intensity in BeWo after overexpression of DHRS4 under confocal microscopy and quantification; scale bar: 20μm; The above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0033] Figure 6 DHRS4 affects mitochondrial quality and oxidative phosphorylation;

[0034] Among them, (A) flow cytometry analysis was used to verify the mitochondrial fluorescence intensity of HTR-8 / SVneo trophoblast cell line after overexpression of DHRS4; (B) OCR experiment: HTR-8 / SVneo trophoblast cells were transfected with Vector and OE-DHRS4 overexpression plasmids, and the OCR was quantitatively compared between the two groups for basal respiration, maximum oxygen consumption, proton leakage and ATP synthesis; (C) BeWo trophoblast cells were transfected with Vector and OE-DHRS4 overexpression plasmids, and the OCR was quantitatively compared between the two groups for basal respiration, maximum oxygen consumption, proton leakage and ATP synthesis; (D) OCR changes after knocking down DHRS4 in HTR-8 / SVneo trophoblast cells were quantitatively analyzed; (E) OCR changes after knocking down DHRS4 in BeWo trophoblast cells were quantitatively analyzed; the above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0035] Figure 7 Overexpression of DHRS4 can downregulate the expression of TFAM;

[0036] Among them, (A) RT-qPCR experiment detected the mRNA expression changes of five mitochondrial-related genes after overexpression of DHRS4 in HTR-8 / SVneo (left) and BeWo (right) trophoblast cell lines; (B) RT-qPCR experiment verified the expression of TFAM after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (C) Western blotting experiment verified the expression of TFAM after overexpression of DHRS4 in HTR-8 / SVneo trophoblast cells; (D) Western blotting experiment analyzed the expression of TFAM after overexpression of DHRS4 in BeWo trophoblast cells; (E) RT-qPCR experiment verified the expression of TFAM after overexpression of DHRS4 in BeWo trophoblast cells; (F) RT-qPCR experiment verified the expression of TFAM after knockdown of DHRS4 in HTR-8 / SVneo trophoblast cells; (G) Western Blotting experiments verified the expression of TFAM after knocking down DHRS4 in HTR-8 / SVneo trophoblasts; (H) RT-qPCR experiments verified the expression of TFAM after knocking down DHRS4 in BeWo trophoblasts; (I) Western blotting experiments analyzed the expression of TFAM after knocking down DHRS4 in BeWo trophoblasts. The above experiments were repeated three times; *P<0.05, **P<0.01);

[0037] Figure 8 DHRS4 can bind to LONP2 protein;

[0038] Among them, (A) GO functional enrichment analysis of biological processes in which proteins with the possibility of binding to DHRS4 are involved in mass spectrometry analysis after Co-IP experiment; (B) KEGG map functional enrichment analysis of signal pathways in which proteins with the possibility of binding to DHRS4 are involved in mass spectrometry analysis after Co-IP experiment; (C) PPI diagram of protein-protein interaction after mass spectrometry analysis after Co-IP experiment; (d) Co-IP experiment verifies the relationship between DHRS4 and LONP; (D) PLA experiment verifies the interaction between DHRS4 and LONP2 in trophoblasts, scale: 20μm. The above experiments were repeated three times; *P<0.05, **P<0.01);

[0039] Fig. 9 Because overexpression of DHRS4 can upregulate the expression of LONP2;

[0040] (A) RT-qPCR experiment verified the expression of LONP2 after overexpression of DHRS4 in HTR-8 / SVneo trophoblasts; (B) Western blotting experiment verified the expression of LONP2 after overexpression of DHRS4 in HTR-8 / SVneo trophoblasts; (C) RT-qPCR experiment verified the expression of LONP2 after overexpression of DHRS4 in BeWo trophoblasts; (D) Western blotting experiment verified the expression of LONP2 after overexpression of DHRS4 in HTR-8 / SVneo trophoblasts; (E) Western blotting experiment verified the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblasts; (F) RT-qPCR experiment verified the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblasts; (G) RT-qPCR experiment verified the expression of LONP2 after knockdown of DHRS4 in HTR-8 / SVneo trophoblasts; (H) Western The blotting experiment verified the expression of LONP2 after knocking down DHRS4 in HTR-8 / SVneo trophoblast cells. The above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0041] Fig.10 For RNA-seq analysis and ubiquitination experiments after knocking down LONP2;

[0042] Among them, (A) GO analysis of the biological processes involved in the differentially expressed genes in the HTR-8 / SVneo trophoblast cell line treated with LONP2 knockdown; (B) KEGG functional enrichment analysis and PPI diagram of the signaling pathways involved in the differentially expressed genes in the HTR-8 / SVneo trophoblast cell line treated with LONP2 knockdown; (C) RT-qPCR experiment verified the expression of TFAM after overexpression of LONP2 in HTR-8 / SVneo trophoblast cells; (D) Western blotting experiment verified the expression of TFAM after overexpression of LONP2 in HTR-8 / SVneo trophoblast cells; (E) RT-qPCR experiment verified the expression of TFAM after overexpression of LONP2 in BeWo trophoblast cells; (D) Western Blotting experiment verified the expression of TFAM after overexpression of LONP2 in BeWo trophoblasts; (G) Western blotting experiment verified the expression of TFAM after knocking down LONP2 in HTR-8 / SVneo trophoblasts; (H) RT-qPCR experiment verified the expression of TFAM after knocking down LONP2 in HTR-8 / SVneo trophoblasts; (I) RT-qPCR experiment verified the expression of TFAM after knocking down LONP2 in BeWo trophoblasts; (J) Western blotting experiment verified the expression of TFAM after knocking down LONP2 in BeWo trophoblasts; (K) CHX experiment verified the changes in TFAM expression over time after CHX was added to the control group and the LONP2 overexpression group; (L) MG132 experiment verified the difference in TFAM expression after the addition of MG132 protease inhibitor to the control group and the LONP2 overexpression group. The above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0043] Fig.11 To verify the DHRS4 pathway in L-NAME animal experiments;

[0044] Among them, (A) Simplified diagram of the pregnant mouse model of L-NAME-induced PE and the timeline of drug injection and sampling; (B) Changes in blood pressure (systolic and diastolic) during pregnancy in the control group and L-NAME group. (C) Fetus and placenta of pregnant mice in the control group and L-NAME-induced PE (left); Quantification of fetal weight and placenta weight of pregnant mice in the control group and L-NAME-induced PE (right); (D) Western blotting experiment verified the difference in expression of DHRS4 and its downstream LONP2 and TFAM in the placental tissue of the control group and L-NAME-induced PE rats and quantification diagram; (E) H&E staining of the placenta of the normal rat group and the L-NAME group. Scale bar, 100μm (left), 50μm (right); (F&I) Immunohistochemistry and quantification bar graph of DHRS4 and TFAM in the placenta of the normal rat group and the L-NAME group (I). Scale bar, 100 μm (left), 50 μm (right); (GH&J) DHRS4 and TFAM immunofluorescence and bar quantification of placenta in normal rat group and L-NAME group (J); Scale bar, 100 μm (left), 50 μm (right); The above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0045] Fig.12 To verify the DHRS4 pathway in vivo in mice overexpressing the DHRS4 genome;

[0046] Among them, (A) Schematic diagram of Cas9-constructed placenta-specific overexpression of DHRS4 gene mice; (B) Changes in blood pressure (systolic and diastolic) during pregnancy in the control group and pregnant mice overexpressing the DHRS4 genome; (CD) Fetal and placenta images and weight quantification images of the control group and the DHRS4 genome overexpression group (D); (E) H&E staining of the placenta of the control group and the DHRS4 genome overexpression group; scale bar, 100μm (left), 50μm (right); (FG) DHRS4 and TFAM immunohistochemistry and quantitative bar graphs of the placenta of the control group and the DHRS4 genome overexpression group; scale bar, 100μm (left), 50μm (right); (H) Western blotting experiments verified the expression differences and quantification images of DHRS4 and its downstream LONP2 and TFAM in the placental tissues of the control group and the DHRS4 gene overexpression group of pregnant mice; the above experiments were repeated three times; ( * P<0.05, ** P<0.01);

[0047] Fig.13 Schematic diagram of the DHRS4-LONP2-TFAM regulatory axis;

[0048] The present invention will be further explained below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the following specific embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0049] Example 1

[0050] Detection of DHRS4 RNA expression level in placental tissue

[0051] method

[0052] Sample collection

[0053] Placental tissues were collected from 50 pairs of normal pregnant women and pregnant women with preeclampsia who delivered by cesarean section at the Affiliated Obstetrics and Gynecology Hospital of Nanjing Medical University from January to December 2021. The placental tissue samples were collected on the maternal side of the umbilical cord attachment site, avoiding the placental calcification infarction foci. The samples were 1×1×1cm in size and stored in liquid nitrogen for extraction of tissue RNA and tissue protein. This study was approved by the Ethics Committee of the Affiliated Obstetrics and Gynecology Hospital of Nanjing Medical University, and all patients signed written informed consent.

[0054] LC-MS / MS Proteomics Technology

[0055] Proteins were extracted from placental tissues of PE patients and normal pregnant women, and then broken down into peptides using trypsin. The peptides were passed through a liquid chromatography column and separated according to their physicochemical properties. The separated peptides were sent to a mass spectrometer, where they were ionized and separated and detected according to the mass and charge ratio (m / z). Software tools were used to analyze the mass spectrometry data, identify the peptides and corresponding proteins, and perform relative or absolute quantification.

[0056] Extraction of tissue (cell) RNA and RT-qPCR

[0057] Total RNA was isolated from tissues and cultured cells using Trizol reagent (Invitrogen), and its quality and quantity were assessed using anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA using HIScriptIII All-in-one RT SuperMix Kit (Vazyme). Quantitative PCR was then performed using Taq Prouniversal SYBR qPCR Master Mix Kit (Vazyme) and specific DHRS4 primers, the upstream primer sequence of the DHRS4 primer pair being shown in SEQ ID NO.2, and the downstream primer of the DHRS4 primer pair being shown in SEQ ID NO.3.

[0058] SEQ ID NO.2

[0059] 5′-3′CGTGTGGTCAAAGTGTGGTC;

[0060] SEQ ID NO.3

[0061] 5'-3'TCTCTGTTCAGGTCCGTTCC.

[0062] Western Blotting Experiment

[0063] HTR-8 / SVneo and BeWo cells were harvested after transfection in 6-well plates. Then, total cell protein was extracted using RIPA protein extraction reagent (MCE, USA) and protease inhibitors (MCE, USA). Proteins were separated by 10% SDS-PAGE and transferred to 0.22 μm PVDF membranes (Sigma). The PVDF membranes were blocked in 5% skim milk and then placed on a shaker at 4 °C and infiltrated with diluted DHRS4 primary antibody (dilution ratio: 1:1000, Proteintech, China). The next day, TBST was washed and incubated with secondary antibodies (dilution ratio: 1:10000, Proteintech, China), and images were collected and processed by FusionCaptAdvance Fx5 software (Vilber Lourmat). All experiments were repeated three times independently.

[0064] Statistical analysis

[0065] Normally distributed data are shown as x ± SEM and compared by two-tailed Student's t-test using GraphPad Prism 7.0 (www.GraphPad.com). The number of independent experiments is indicated in the figure legends. P values ​​less than 0.05 were considered statistically significant (*p < 0.05 and **p < 0.01; ns, not statistically significant).

[0066] result

[0067] DHRS4 was significantly overexpressed in PE placenta tissue. Figure 1 and Figure 2 shown.

[0068] The present invention uses LC-MS / MS proteomics technology to analyze 8 pairs of placental tissues of PE patients and normal pregnant women and finds that DRSH4 is significantly overexpressed in placental tissues of PE patients. A total of 3756 proteins were detected, of which 3407 were common to PE and normal placental tissues, and 82 had a difference of more than 1.5 times (p value<0.05). Among them, 28 were upregulated in PE placenta and 54 were downregulated ( Figure 1AC). The present invention further detected the expression level of DHRS4 mRNA in 50 pairs of normal group and PE group placenta tissue by RT-qPCR experiment. The experimental results showed that the expression level of DHRS4 mRNA in PE placenta tissue was significantly increased ( Figure 2 A). Western blotting experiments also confirmed that the expression of DHRS4 protein in placental tissue of PE patients was significantly higher than that in the normal group ( Figure 2 B). In addition, the results of H&E staining of placental tissue confirmed that in the PE group, there was fibrinoid necrosis of the villous blood vessel wall, thickening of the villous duct wall, and dysplasia of the distal villi ( Figure 2 C). Further using IHC and IF experiments, the present invention found that the expression level of DHRS4 was significantly increased in PE placenta tissue ( Figure 2 DE).

[0069] Example 2

[0070] Effects of DHRS4 on proliferation, migration and invasion of trophoblastic cells HTR-8 / SVneo

[0071] method

[0072] Cell culture and transfection

[0073] Trophoblast cell lines were cultured in an incubator at 90% humidity, 37°C, and 5% CO2. Four human trophoblast cell lines (HTR-8 / SVneo, JAR, JEG3, and BeWo) were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China). HTR-8 / SVneo cells were cultured in DMEM (Gibco, USA) medium containing 10% FBS, JAR cells were cultured in RPMI 1640 (Gibco, USA) medium containing 10% FBS, JEG3 cells were cultured in MEM (Gibco, USA) medium containing 10% FBS, and BeWo cells were cultured in F12k (Gibco, USA) medium containing 20% ​​FBS. 100 U / ml penicillin and 100 mg / ml streptomycin were added to the above cultures. Trophoblast cell lines HTR-8 / SVneo and BeWo cells were cultured in 6-well plates until 80% confluence, DHRS4-flag high expression vector was constructed, and DHRS4-flag high expression vector was transfected into trophoblast HTR-8 / SVneo, and empty vector was used as control. The sequence of DHRS4 is shown in SEQ ID NO.1. RT-qPCR verified the high expression level of DHRS4 mRNA, the upstream primer sequence of the DHRS4 primer pair is shown in SEQ ID NO.2, and the downstream primer of the DHRS4 primer pair is shown in SEQ ID NO.3. Western Blotting experiment used DHRS4 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China).

[0074] SEQ ID NO.1

[0075] GCCACCATGCACAAGGCGGGGCTGCTAGGCCTCTGTGCCCGGGCTTGGAATTCGGTGCGGATGGCCAGCTCCGGGATGACCCGCCGGGACCCGCTCGCAAATAAGGTGGCCCTGGTAACGGCCTCCACCGACGGGATCGGCTTCGCCATCGCCCGGCGTTTGGCCCAGGACGGGGCCCATGTGGTCGTCAGCAGCCGGAAGCAGCAGAATGTGGACCAGGCGGTGGCCACGCTGCAGGGGGAGGGGCTGAGCGTGACGGGCACCGTGTGCCATGTGGGGAAGGCGGAGGACCGGGAGCGGCTGGTGGCCACGGCTGTGAAGCTTCATGGAGGTATCGATATCCTAGTCTCCAATGCTGCTGTCAACCCTTTCTTTGGAAGCATAATGGATGTCACTGAGGAGGTGTGGGACAAGACTCTGGACATTAATGTGAAGGCCCCAGCCCTGATGACAAAGGCAGTGGTGCCAGAAATGGAGAAACGAGGAGGCGGCTCAGTGGTGATCGTGTCTTCCATAGCAGCCTTCAGTCCATCTCCTGGCTTCAGTCCTTACAATGTCAGTAAAACAGCCTTGCTGGGCCTGACCAAGACCCTGGCCATAGAGCTGGCCCCAAGGAACATTAGGGTGAACTGCCTAGCACCTGGACTTATCAAGACTAGCTTCAGCAGGATGCTCTGGATGGACAAGGAAAAAGAGGAAAGCATGAAAGAAACCCTGCGGATAAGAAGGTTAGGCGAGCCAGAGGATTGTGCTGGCATCGTGTCTTTCCTGTGCTCTGAAGATGCCAGCTACATCACTGGGGAAACAGTGGTGGTGGGTGGAGGAACCCCGTCCCGCCTCGACTACAAGGACGACGATGACAAGTGA。

[0076] EDU experiment

[0077] 5-Ethynyl-2-deoxyuridine labeling / detection kit (Ribobio, Guangzhou, China) was used for EdU detection to analyze cell proliferation ability. HTR-8 / SVneo and BeWo cells were seeded into 24-well plates, with (2-3) × 10 4 Cells were then transfected with DHRS4-myc for 24-48 hours. The staining was processed according to the kit protocol and observed with an inverted fluorescence microscope (Nikon, Japan). The experiment was repeated three times independently.

[0078] MTT assay

[0079] Experimental steps:

[0080] After transfection of cells in 6-well plates for 24 to 48 hours, digest and resuspend with 0.25% trypsin (containing EDTA) (Gibco, USA), and use cell counting to adjust the cell density (3000-4000 cells / well) and then inoculate 100 μl of cell suspension in 96-well plates. Multiple replicate wells are set for each sample, and 5 wells are recommended. Four commonly used time periods are selected, including 0h, 24h, 48h, and 72h. MTT detection solution (90 μl of culture medium and 10 μl MTT) is added during this time period and culture is continued for 4h. At the set 4 time points, the detection reagent is added to each well and cultured for 4h. After that, the detection reagent in the well is carefully aspirated and 100 μl DMSO is added to terminate the reaction and dissolve the water-insoluble crystals formed by MTT in the cells. The absorbance value of each well is then measured on the 96-well plate at a specific wavelength (490nm) on an ELISA reader.

[0081] Transwell method

[0082] Transwell assay was used to analyze the ability of cell migration and invasion. A chamber with a pore size of 8 μm was used to inoculate 3×10 cells transfected with DHRS4-flag in serum-free medium. 4 HTR-8 / SVneo, BeWo cells / well were seeded into the upper chamber. The lower chamber was added to the culture medium containing 10% FBS. After culturing for 28 hours at 37°C and 5% CO2, the cells with higher migration ability in the upper chamber migrated to the lower chamber. Under an optical microscope, the number of migrated cells was counted in 5 randomly selected areas (Matrigel gel is required to detect the ability of cell invasion).

[0083] Flow cytometry analysis of cell apoptosis ratio

[0084] Take an appropriate amount of cells in logarithmic growth phase and inoculate them in 6-well plates. 24-48 hours after transfection, digest and resuspend the cells with 0.25% trypsin (without EDTA), collect the cell suspension in a 1.5ml centrifuge tube, and centrifuge at 1000g / min for 5min. Carefully discard the supernatant; wash and resuspend the cells 2-3 times with 1ml PBS, place in a centrifuge at 1000g / min, and centrifuge for 5min. After aspirating the residual PBS in the centrifuge tube, resuspend the cells with 200μl buffer after centrifugation, and count the cells. The number of cells should preferably reach 2×106 / well; the control group and experimental group use double staining, and the positive control group is set to single staining. The double staining tube includes 5μl of dye (Annexin V, 7-AAD) each. For the single staining group, select one of the dyes and add it to the tube separately, and mark the name of the dye added to this tube, flick the tube to mix the contents, and incubate in the dark for 15min. During the incubation process, prepare the flow cytometer supporting tubes and filter membranes, check the sheath fluid and waste fluid after the flow cytometer is turned on; after staining and incubation for 15 minutes, add 1 mL of PBS for washing and centrifuge at 2000 rpm × 5 minutes, retain the cell pellet, add 100 μl of PBS again to resuspend the cells and filter with a filter membrane; open the corresponding channels in the flow cytometer (Beckman, USA) software, including SSC, FSC, FITC and 7-ADD, remove unnecessary channels, run the instrument, record and analyze the data. DHRS4 high expression inhibits the proliferation, migration and invasion of trophoblast cells HTR-8 / SVneo and BeWo, and increases the apoptosis ratio, such as Figure 3 shown.

[0085] result

[0086] In order to explore the potential role of DHRS4 in regulating the biological functions of extravillous trophoblasts, the present invention constructed a high-expression plasmid vector of DHRS4 in vitro. The present invention used EDU experiments to verify that after high expression of DHRS4, the proliferation ability of HTR-8 / SVneo and BeWo trophoblast cell lines was significantly reduced ( Figure 3 A). At the same time, the present invention also uses MTT experiments to verify that the proliferation capacity of trophoblast cell lines HTR-8 / SVneo and BeWo is significantly downregulated after high expression of DHRS4 ( Figure 3 B). Through Transwell experiments, the present invention found that the invasion and migration abilities of the HTR-8 / SVneo trophoblast cell line with high expression of DHRS4 were significantly downregulated ( Figure 3 C). In addition, the present invention uses flow cytometry to verify whether DHRS4 is involved in regulating cell apoptosis. The results show that the proportion of HTR-8 / SVneo cell apoptosis (early apoptosis + late apoptosis) increased significantly after high expression of DHRS4 ( Figure 3 E).

[0087] To further explore the changes in DHRS4-regulated biological behavior of trophoblasts, the present invention used angiogenesis experiments to verify that the angiogenesis ability of the HTR-8 / SVneo trophoblast cell line with high expression of DHRS4 was significantly downregulated ( Figure 3 D).

[0088] Combined with the above experimental results, the present invention believes that high expression of DHRS4 significantly inhibits the proliferation, migration and invasion ability of the trophoblast cell line HTR-8 / SVneo, and increases the proportion of cell apoptosis.

[0089] Example 3

[0090] Verification of biological processes in which DHRS4 participates in regulating mitochondrial function

[0091] method

[0092] (1) Observation of the effect of high expression of DHRS4 on mitochondrial function in trophoblast cells under confocal fluorescence microscopy:

[0093] HTR-8 / SVneo trophoblast cells were cultured on glass slides, and the plasmids Empty vector and pcDNA3.1(+)-DHRS4 were transfected, respectively, and stained with MitoTracker Red CMXRos (100nM, Invitrogen, USA) for 30min at 37°C. After staining, the cells were washed twice with preheated PBS and fixed with preheated 4% paraformaldehyde for 15min. After washing with PBS, nuclear staining was performed for 10min at room temperature after adding DAPI, and fluorescent images were obtained using a Zeiss LSM 700 laser scanning confocal microscope (Zeiss, Germany). The excitation wavelengths of MitoTracker Red CMXRos and DAPI were 579nm and 405nm, respectively, and the images were collected and analyzed. The sequence of the DHRS4 is shown in SEQ ID NO.1.

[0094] (2) Detecting mitochondrial respiration rate to assess cellular energy metabolism status

[0095] After overexpression of DHRS4 or knockdown of DHRS4 in trophoblast HTR-8 / SVneo cells, mitochondrial stress tests were performed using the Seahorse XFp Cell Energy Metabolism Analysis System (Seahorse Bioscience, Billerica, MA, USA) to determine OCR and ECAR, using the Glycolysis Stress Test Kit and Mito Stress Test Kit, respectively; 200 μL of sterile calibrant (Catalog: 100840-000) was used in each well of the utility plate to hydrate the XFe96 sensor column (Catalog: 102416-100). The assembled sensor cartridge and universal plate were placed in a 37°C CO2-free incubator overnight. The treated cells were seeded into XFe96 cell culture microplates (Catalog: 101085-004) at a density of 10,000 cells / well (for OCR measurement) overnight, and the cell culture medium was replaced with SeahorseXF DMEM medium containing 10 mM glucose, 2 mM glutamine, and 1 mM pyruvate, and placed in a 37°C CO2-free incubator for 1 hour. Finally, the baseline OCR was measured and then three compounds that affect the bioenergetic process of the cell were injected in sequence: 20 μL oligomycin (1 μM) was added to port A, 22 μL FCCP (1 μM) was added to port B, and 25 μL Rotenone / Antimycin A (0.5 μM) was obtained in port C; similarly, ECAR was measured: glucose was added to port A, oligomycin was added to port B; 2-DG was added to port C; OCR and ECAR were measured in Seahorse Bioscience XF96 Extracellular Flux Analyzer (Agilent Technologies). The overexpression DHRS4 reagent used for transfecting cells, the sequence of DHRS4 is shown as SEQ ID NO.1; the sequence of shDHRS4-1# is shown as SEQ ID NO.4 and SEQ ID NO.5; the sequence of shDHRS4-2# is shown as SEQ ID NO.6 and SEQ ID NO.7.

[0096] SEQ ID NO.4

[0097] 5'-3'CCGGGCCCGGGCTTGGAATTCGGTGCTCGAGCACCGAATTCCAAGCCCGGGCT TTTTG;

[0098] SEQ ID NO.5

[0099] 5'-3'AATTCAAAAAGCCCGGGCTTGGAATTCGGTGCTCGAGCACCGAATTCCAAGCC CGGGC;

[0100] SEQ ID NO.6

[0101] 5'-3'CCGGGCTCTGTGCCCGGGCTTGGACTCGAGTCCAAGCCCGGGCACAGAGGCTTTTTG;

[0102] SEQ ID NO.7

[0103] 5'-3'AATTCAAAAAGCCTCTGTGCCCGGGCTTGGACTCGAGTCCAAGCCCGGGCAC AGAGGC.

[0104] (3) qPCR detection of mtDNA / nDNA ratio after mitochondrial isolation experiment

[0105] After the cells were broken by a grinder, the cell nucleus and mitochondria were separated using a mitochondrial separation and protein extraction kit (Proteintech, PK10016). The cell nucleus and mitochondria were lysed using a nuclear lysis buffer and a mitochondrial lysis buffer. The nuclear DNA and mitochondrial DNA were extracted using a DNA extraction kit and then quantified and compared by qPCR. tRNA was used for qPCR. Leu and β2M primer pair, the tRNA Leu The primer sequences are shown in SEQ ID NO.10 and SEQ ID NO.11; the β2M primer sequences are shown in SEQ ID NO.12 and SEQ ID NO.13. The RNA-seq results after overexpression of DHRS4 are shown in Figure 4 As shown in Figure 2, the phenotypic experimental results of DHRS4 affecting mitochondrial morphology are as follows Figure 5 As shown; DHRS4 affects mitochondrial quality and oxidative phosphorylation Figure 6 shown.

[0106] SEQ ID NO.10

[0107] 5′-3′CACCCAAGAACAGGGTTTGT;

[0108] SEQ ID NO.11

[0109] 5′-3′TGGCCATGGGTATGTTGTTA;

[0110] SEQ ID NO.12

[0111] 5'-3'TGCTGTCTCCATGTTTGATGTATCT;

[0112] SEQ ID NO.13

[0113] 5'-3'TCTCCTGCTCCCCACCTCTAAGT.

[0114] result

[0115] The present invention uses transcriptome sequencing technology (RNA sequencing, RNA-seq) to screen the differential expression profile of DHRS4 downstream genes. RNA-seq results are analyzed by overexpression or knockdown of DHRS4 to determine the changes in the mRNA abundance of downstream genes (<2 times) ( Figure 4 AB). GO analysis of expression profiles ( Figure 4 CD) and KEGG functional enrichment analysis ( Figure 4 EF), the results showed that the down-regulated genes caused by high expression of DHRS4 were associated with ATP production, oxidative phosphorylation and hydrogen peroxide (H2O2) production. Therefore, the present invention speculates that DHRS4 can affect the biological function of EVT by regulating mitochondrial function.

[0116] Subsequently, the present invention verified that changes in mitochondrial structure and function were associated with mtDNA abnormalities. The mtDNA and nDNA were extracted using mitochondrial separation experiments, and the mtDNA / nDNA ratio was calculated by RT-qPCR experiments. The results showed that the mtDNA / nDNA ratio was downregulated after high expression of DHRS4, while knocking down DHRS4 could upregulate the mtDNA / nDNA ratio, indicating that high expression of DHRS4 led to the blockage of mtDNA synthesis and replication ( Figure 5 AB). Secondly, the present invention uses Mito-Tracker Red CMXRos mitochondrial staining to find that after the trophoblast cell line HTR-8 / SVneo overexpresses DHRS4, the mitochondrial fluorescence intensity under a confocal microscope decreases and its morphology is broken and dot-like ( Figure 5 CD). Further considering that MitoTracker Green FM is localized in mitochondria but is not affected by their membrane potential, it can be used to quantify and compare mitochondrial mass. Flow cytometry was used to analyze the fluorescence intensity of mitochondria after high expression of DHRS4. The results verified that mitochondrial mass was significantly downregulated after high expression of DHRS4 ( Figure 6 A).

[0117] The present invention performed a Seahorse XF experiment, namely a mitochondrial oxygen consumption test (OCR), after overexpressing DHRS4 in the HTR-8 / SVneo trophoblast cell line. The results showed that after overexpressing DHRS4, HTR-8 / SVneo significantly decreased mitochondrial oxygen consumption in BeWo cells, wherein the basal respiration rate (Basalrespiration), maximum respiration rate (Maximal respiration), proton leak (Proton leak) and ATP production (ATP production) in the cells overexpressing DHRS4 were significantly lower than those in the control group ( Figure 6 BC). After knocking down DHRS4, the oxygen consumption rate of the trophoblast cell line increased significantly, that is, the basal respiration rate, maximum respiration rate, proton leakage and ATP output were significantly higher than those of the control group ( Figure 6 DE).

[0118] Example 4

[0119] Verification of DHRS4 / LONP2-TFAM pathway in L-NAME-induced PE rat placenta tissue experiment

[0120] method

[0121] Extraction of tissue (cell) RNA and RT-qPCR

[0122] Total RNA was isolated from cells transfected with DHRS4 overexpression vector, shDHRS4-1,2# lentiviral reagent, LONP2 overexpression vector and shLONP2-1,2# lentiviral reagent using Trizol reagent (Invitrogen), and its quality and quantity were evaluated by anoDrop2000c (Fisher Scientific, Waltham, Massachusetts, USA). RNA was reverse transcribed into cDNA by HIScriptIII All-in-one RT SuperMix kit (Vazyme). Quantitative PCR was then performed using TaqPro universal SYBR qPCR master mix kit (Vazyme) and specific DHRS4, LONP2 and TFAM primers. The DHRS4 overexpression vector used for transfection, the sequence of which is shown in SEQ ID NO.1. The shDHRS4-1,2# reagents used for transfecting cells, the sequence of the shDHRS4-1# is shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the shDHRS4-2# is shown in SEQ ID NO.6 and SEQ ID NO.7. The LONP2 overexpression vector used for transfection, the sequence of the LONP2 is shown in SEQ ID NO.14. The shLONP2-1,2# reagents used for transfecting cells, the sequence of the shLONP2-1# is shown in SEQ ID NO.15 and SEQ ID NO.16; the sequence of the shLONP2-2# is shown in SEQ ID NO.17 and SEQ ID NO.18. The specific DHRS4, LONP2 and TFAM primer sequences used in RT-qPCR experiments, the upstream primer sequence of the DHRS4 primer pair is shown in SEQ ID NO.2, and the downstream primer of the DHRS4 primer pair is shown in SEQ ID NO.3. The upstream primer sequence of the LONP2 primer pair is shown in SEQ ID NO. 19, and the downstream primer of the LONP2 primer pair is shown in SEQ ID NO. 20. The upstream primer sequence of the TFAM primer pair is shown in SEQ ID NO. 21, and the downstream primer of the TFAM primer pair is shown in SEQ ID NO. 22.

[0123] SEQ ID NO.14

[0124]

[0125] SEQ ID NO.15

[0126] 5'-3'CCGGGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTCCTGGCTT TTTG;

[0127] SEQ ID NO.16

[0128] 5'-3'AATTCAAAAAGCCAGGAGTAGCAATAGGTTTCTCGAGAAACCTATTGCTACTC CTGGC;

[0129] SEQ ID NO.17

[0130] 5'-3'CCGGCCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACTGAGGTT TTTG;

[0131] SEQ ID NO.18

[0132] 5'-3'AATTCAAAAACCTCAGTCAATGCCAGAATATCTCGAGATATTCTGGCATTGACT GAGG;

[0133] SEQ ID NO.19

[0134] 5'-3'GTCTTGTTCTTCCAGTGGG:

[0135] SEQ ID NO.20

[0136] 5'-3'GAGGAATAATGACTTGCTTCAG;

[0137] SEQ ID NO.21

[0138] 5'-3'GCCCTAAGTCCCTGTGTCAT;

[0139] SEQ ID NO.22

[0140] 5'-3'TGCATTTGTCCCGAGATGTT。

[0141] MG132

[0142] Experimental preparation: Vector and LONP2 overexpression vectors were transfected into HTR-8 / SVneo trophoblast cells using lipo2000. 24 hours after transfection, 20 μM MG132 was added and incubated for 4 hours. Then, pre-cooled cell lysis buffer (containing PMSF and phosphatase inhibitors) was added, lysed on ice for 30 minutes, and centrifuged at 12000r / min for 20 minutes at 4°C to extract supernatant protein. Western blotting experiment was then performed for verification.

[0143] CHX ubiquitination assay

[0144] Experimental preparation: Vector and LONP2 overexpression vectors were transfected into HTR-8 / SVneo trophoblast cells using lipo2000, respectively. 24 hours after transfection, cells were treated with CHX at a concentration range of 20 μg / ml or 50 μg / ml for 0, 4, 12, and 24 hours. Pre-cooled cell lysis buffer (containing PMSF and phosphatase inhibitors) was then added, lysed on ice for 30 minutes, and then centrifuged at 12000 r / min for 20 minutes at 4°C to extract supernatant protein. Western blotting experiments were then performed for verification. The LONP2 overexpression vector used for transfection, the sequence of the LONP2 is shown in SEQ ID NO.14.

[0145] Western Blotting Experiment

[0146] HTR-8 / SVneo and BeWo cells were harvested after transfection in 6-well plates. Then, total cell protein was extracted using RIPA protein extraction reagent (MCE, USA) and protease inhibitors (MCE, USA). Proteins were separated by 10% SDS-PAGE and transferred to 0.22um PVDF membrane (Sigma). The PVDF membrane was blocked in 5% skim milk and then placed on a shaker at 4°C and infiltrated with diluted primary antibodies. The next day, secondary antibodies were incubated after TBST washing, and images were collected and processed by FusionCaptAdvance Fx5 software (Vilber Lourmat). All experiments were repeated three times independently. Western Blotting experiments used DHRS4 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China), LONP2 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China) and TFAM polyclonal antibody (dilution ratio: 1:2000, Proteintech, China).

[0147] Immunofluorescence experiments

[0148] Immunofluorescence assay was used to detect the expression of related proteins (DHRS4, LONP2 and TFAM): 1×10 cells were plated per well. 6 Cells were planted in a 6-well culture plate, and coverslips were placed to allow the cells to crawl. When 60% of the cells were attached to the wall, the DHRS4 overexpression vector was transfected. 24 hours after transfection, 2 ml of 4% paraformaldehyde was added to each well to fix the cells, and the cells were decolorized and incubated on a shaker at room temperature for 30 minutes. The cells were washed with PBS for 5 minutes. 2 ml of blocking solution was added to each well and decolorized and incubated on a shaker at room temperature for 30 minutes. Then 100 μl of primary antibody was dropped into each well and incubated at 4°C overnight. The cells were washed with PBS 3 times / 5 minutes, and the secondary antibody was incubated for 1.5 hours. After washing with PBS, DAPI was added to each well and incubated at room temperature for 10 minutes. Anti-fluorescence quenching agent was dropped on the slide, the slide in the six-well plate was taken out, and placed on the slide. After staining, it was immediately observed and photographed under a fluorescence microscope. Immunofluorescence experiments were performed using DHRS4 polyclonal antibody (dilution ratio: 1:200, Proteintech, China), LONP2 polyclonal antibody (dilution ratio: 1:200, Proteintech, China), and TFAM polyclonal antibody (dilution ratio: 1:500, Proteintech, China).

[0149] Statistical analysis

[0150] Normally distributed data are shown as ֿ ± SEM and compared by two-tailed Student's t-test using GraphPad Prism 7.0 (www.GraphPad.com). The number of independent experiments is indicated in the figure legends. P values ​​less than 0.05 were considered statistically significant (*p < 0.05 and **p < 0.01; ns, not statistically significant).

[0151] result

[0152] (1) Overexpression of DHRS4 can inhibit the expression of TFAM. Figure 7 shown.

[0153] Based on transcriptome sequencing and experimental results, we screened out mitochondrial-related genes for subsequent research. First, RT-qPCR was used to detect mitochondrial-related genes after high expression of DHRS4, including TFAM, peroxisome proliferator-activated receptor γ coactivator 1-α (PPAR-γcoactivator 1alpha, PGC1α), optic atrophy protein 1 (opticatrophy 1, OPA1), mitochondrial fission protein 1 (Mitochondrial Fission 1, FIS1) and human nuclear respiratory factor (Nuclear Respiratory Factor 1, NRF1). The experimental results showed that the expression of TFAM was significantly downregulated in HTR-8 / SVneo and BeWo cells with high expression of DHRS4 ( Figure 7 A). RT-qPCR and western blotting experiments verified that after high expression of DHRS4 in HTR-8 / SVneo and BeWo trophoblast cell lines, the expression of TFAM was significantly reduced ( Figure 7 BE), and after knocking down DHRS4 in trophoblast cell lines HTR-8 / SVneo and BeWo, TFAM expression was significantly upregulated ( Figure 7 FI).

[0154] (2) DHRS4 inhibits the expression of TFAM by binding to and upregulating the expression of LONP2. Figure 8 and 9 shown.

[0155] According to the results of mass spectrometry analysis, GO and KEGG functional enrichment analysis revealed that proteins bound to DHRS4 also participate in mitochondrial oxidative phosphorylation, ATP synthesis and other biological functions ( Figure 8 AB). Subsequently, through PPI network analysis, the present invention found that DHRS4 is closely associated with LONP2 ( Figure 8 C). LONP2 is a Lon protease (Lon protease, Lon). LONP2 is an ATP-dependent protease that is mainly responsible for the degradation of abnormal proteins in cells to maintain protein expression in the body and is widely involved in activities such as cell apoptosis, cell differentiation and DNA repair. The present invention uses Co-IP experiments and western blotting to verify that DHRS4 and LONP2 bind to each other ( Figure 8 D), and the present invention uses PLA and IF experiments to verify that DHRS4 and LONP2 are co-localized in trophoblasts ( Figure 8E). To further clarify the linear regulatory relationship between DHRS4 and LONP2, RT-qPCR and western blotting experiments were used to verify that the expression of LONP2 increased significantly after high expression of DHRS4 in HTR-8 / SVneo and BeWo trophoblast cell lines ( Fig. 9 AD), and after knockdown of DHRS4 in HTR-8 / SVneo trophoblasts, LONP2 was significantly down-expressed ( Fig. 9 EH).

[0156] The results of RNA-seq analysis and ubiquitination experiments after knocking down LONP2 are shown in Fig.10 shown.

[0157] To explore whether there is a regulatory relationship between LONP2 and TFAM, RNA sequencing (RNA-seq) was used to screen the differential expression profile of LONP2 downstream genes. GO and KEGG functional enrichment analysis showed that LONP2 was closely related to autophagy and mitochondrial oxidative phosphorylation ( Fig.10 AB). Therefore, RT-qPCR and western blotting experiments were used to verify that LONP2 was highly expressed in HTR-8 / SVneo trophoblast cell lines, and the expression of TFAM was significantly reduced (Figure ( Fig.10 CF), and knockdown of LONP2 in the trophoblast cell line HTR-8 / VSneo significantly upregulated TFAM expression ( Fig.10 GJ). Next, we added MG132 and CHX to verify that LONP2 could inhibit the expression of TFAM protein through ubiquitination modification, thereby reducing the amount of TFAM protein ( Fig.10 KL).

[0158] (3) Validation of the DHRS4 / LONP2-TFAM pathway in L-NAME-induced PE rat placenta tissue experiments. Fig.11 shown.

[0159] The present invention further constructs an L-NAME-induced PE rat model ( Fig.11 A). During pregnancy, the present invention recorded the fluctuation of blood pressure (systolic and diastolic pressure) of the two groups of pregnant mice. The results showed that compared with the control group, the blood pressure of the pregnant mice in the L-NAME group showed a gradual upward trend after GD 7.5 days ( Fig.11 B), after termination of pregnancy at 18.5 days of gestation, the weight of fetus and placenta of L-NAME-induced PE rats was significantly lower than that of the control group ( Fig.11C). Western blotting experiments verified that the expression of DHRS4 and LONP2 increased in the rat placenta induced by L-NAME, while the expression of TFAM decreased ( Fig.11 D). In addition, the present invention performed H&E staining of rat placental tissue, and the results showed that the villous vascular cavity in the placenta of pregnant rats with PE induced by L-NAME became smaller, the blood vessels were blocked, the villous edema and hyalin degeneration were observed ( Fig.11 E). Further use of IHC ( Fig.11 F&I) and immunofluorescence experiments ( Fig.11 GH&J) verified that DHRS4 was significantly overexpressed in the placenta tissue of rats with L-NAME-induced PE, while TFAM expression was downregulated ( Fig.11 FJ).

[0160] Example 5

[0161] method

[0162] (1) CRISPR-Cas9 technology to construct a mouse model with high expression of DHRS4

[0163] Ensembl data showed that the hDHRS4 gene has 8 transcripts, 6 of which have complete CCDS. This scheme selected DHRS4-201 (ENST00000313250.10) to make the model, with a CDS length of 837nt and encoding 278aa. H11 is located on chromosome 11 of the mouse, which is a safe site for the insertion of exogenous genes. Exogenous genes integrated into this site can be stably and efficiently expressed without destroying the function of endogenous genes. Combined with the use of the Cre-loxP recombination system, it can be used to construct a versatile conditional gene knock-in mouse model. CRISPR-Cas9 technology was used to insert the CAG-LSL-hDHRS4-3xFlag-PolyA gene fragment into the H11 site of the mouse. The brief process is as follows: construct the vector in vitro, microinject CRISPR-Cas9 and Donor vector into the fertilized eggs of C57BL / 6JGpt mice, and obtain F0 generation mice. The F0 positive mice verified by PCR and sequencing were mated with C57BL / 6JGpt mice to obtain a stable and heritable F1 positive mouse model.

[0164] (2) Measurement of mouse blood pressure, detection of urine protein, and differential analysis of blood and placental mRNA and protein

[0165] The method established by this project group was followed (ZouY et al., Molecules, 2016). Blood pressure was measured by tail cuff method using BP98A (Softron) - mice were fixed in cages, and the tails of mice were fully exposed. After the heart rate and blood pressure were stable, the blood pressure of all groups was measured using a programmed electronic sphygmomanometer. Systolic and diastolic blood pressure were recorded at least five times and up to ten times, and the average was taken for further statistical analysis. Serum samples of mice were prepared, and the concentrations of DHRS4, LONP2 and TFAM were measured using ELISA kits (R&D Systems). Urine of mice was collected on days 0.5, 4.5, 9, 13.5 and 18.5 of pregnancy, respectively, and stored at -80°C. Urine albumin and creatinine concentrations were measured using kits (Beyotime). Total protein in placental tissue was extracted using RNA extraction kit (Sigma), and the differences in DHRS4, LONP2 and TFAM protein levels in each group were detected and analyzed by Western Blotting experiments. Western Blotting experiments used DHRS4 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China), LONP2 polyclonal antibody (dilution ratio: 1:1000, Proteintech, China) and TFAM polyclonal antibody (dilution ratio: 1:2000, Proteintech, China).

[0166] (3) Placental pathological tissue section staining

[0167] After 18.5 days of pregnancy, the experimental mice were killed and placental samples were obtained. The placental tissue was fixed in 10% neutral formaldehyde and stored at 4°C. After 24 hours, it was embedded in paraffin for pathological sections and HE staining was used to observe pathological changes in placental tissue. The DHRS4 pathway was verified in the in vivo experiment of mice overexpressing the DHRS4 genome. Fig.12 shown.

[0168] result

[0169] The present invention uses Cas9 technology to construct a placenta-specific high-expression DHRS4 pregnant mouse model (hDHRS4+ / -EIf5-Cre+ / -)( Fig.12 A). During pregnancy, the fluctuations of blood pressure (systolic and diastolic) of the two groups of pregnant mice were recorded. The results showed that compared with the control group, the blood pressure of the gene mouse group gradually increased after 7.5 days of pregnancy ( Fig.12 B), and the weight of fetuses and placentas in the transgenic mice group was significantly smaller than that in the control group ( Fig.12 CD), the present invention performed H&E staining on the placental tissues of two groups of pregnant mice, and the results showed that the infarction foci in the placenta of the genetic mice increased significantly ( Fig.12E). IHC was further used to verify that DHRS4 was significantly overexpressed in the placental tissue of genetic mice, while TFAM expression was significantly downregulated ( Fig.12 FG). In addition, western blotting experiments verified that DHRS4 and LONP2 were significantly overexpressed in the placental tissue of the gene mouse group, while TFAM expression was significantly downregulated ( Fig.12 H). Furthermore, these results suggest that DHRS4-mediated regulation of the LONP2-TFAM axis is involved in the pathogenesis and progression of PE.

[0170] It should be noted that the above content only illustrates the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications all fall within the protection scope of the claims of the present invention.

Claims

1. Use of a reagent for detecting DHRS4 expression level in the preparation of a preeclampsia diagnostic kit, characterized in that: The sequence of the DHRS4 is shown in SEQ ID NO.

1.

2. Use of the reagent for detecting DHRS4 expression level according to claim 1 in preparing a preeclampsia diagnostic kit, characterized in that: The reagent for detecting DHRS4 includes a primer pair for specifically detecting DHRS4 expression.

3. Use of the reagent for detecting DHRS4 expression level according to claim 2 in preparing a preeclampsia diagnostic kit, characterized in that: The upstream primer sequence of the primer pair is shown as SEQ ID NO.2, and the downstream primer sequence of the primer pair is shown as SEQ ID NO.

3.

4. Use of the reagent for detecting DHRS4 expression level according to claim 1 in preparing a preeclampsia diagnostic kit, characterized in that: DHRS4 is highly expressed in patients with preeclampsia.

5. Use of a DHRS4 low expression reagent in the preparation of a drug for treating preeclampsia, characterized in that: The sequence of the DHRS4 is shown in SEQ ID NO.

1.

6. Use of the DHRS4 low expression reagent according to claim 5 in the preparation of a drug for treating preeclampsia, characterized in that: The low expression reagents include shDHRS4-1#, shDHRS4-2#, and shDHRS4-3#; the sequence of the shDHRS4-1# is shown in SEQ ID NO.4 and SEQ ID NO.5; the sequence of the shDHRS4-2# is shown in SEQ ID NO.6 and SEQ ID NO.7; the sequence of the shDHRS4-3# is shown in SEQ ID NO.8 and SEQ ID NO.

9.

7. A kit for diagnosing preeclampsia, characterized in that: The kit comprises the primer pair according to claim 2 or 3.

8. A drug for treating preeclampsia, characterized in that: The drug includes a DHRS4 low expression agent, and the sequence of the DHRS4 is shown as SEQ ID NO.1.

Images