A DNA methylation marker and detection method for auxiliary diagnosis of colorectal cancer
By screening out the CpG site cg16601494 in the promoter region of the TMEM240 gene, and developing detection methods based on digital PCR and TaqMan qPCR technology, the problem of insufficient sensitivity and specificity of existing colorectal cancer screening methods is solved, and efficient and non-invasive screening for early identification and risk assessment of colorectal cancer is achieved.
Patent Information
- Application Number
- CN202411632414.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-04-04
AI Technical Summary
Existing colorectal cancer screening methods such as fecal cryptovascular detection and colonoscopy have problems such as low sensitivity and specificity, complex operation and high cost, and are difficult to widely use in population screening.
By analyzing the methylation map of colorectal cancer tissue in the TCGA and GEO databases, the CpG site cg16601494 in the promoter region of the TMEM240 gene was screened out, and specific probes and primers were designed to detect the methylation level of this site were developed, and detection methods based on digital PCR and TaqMan qPCR technology were developed for auxiliary diagnosis of colorectal cancer.
Early identification and risk assessment of colorectal cancer is achieved, and the sensitivity and specificity of diagnosis is improved through non-invasive detection methods, providing an efficient and non-invasive screening method.
Smart Images
Figure CN119753137A_ABST
Abstract
Description
Technical Field
[0001] The present invention is related to the field of cancer detection, in particular to the detection technology of colorectal cancer methylation biomarkers. More specifically, the present invention provides a DNA methylation marker and a detection method for auxiliary diagnosis of colorectal cancer. Background Art
[0002] Colorectal cancer is one of the most common malignant tumors in the world, with the incidence and mortality rates ranking among the top, and showing a trend of younger and increasing incidence, posing a serious threat to public health. The early symptoms of colorectal cancer are usually not obvious, resulting in most patients entering the late stage when diagnosed, which increases the difficulty of treatment. Data show that the five-year survival rate of patients with stage IV colorectal cancer is less than 10%, while the five-year survival rate of patients with stage I can reach 90%. Therefore, early screening and timely intervention are crucial to improving patient survival rates. At present, the main screening methods include fecal occult blood test and colonoscopy. Although fecal occult blood test is easy to operate, it is difficult to be widely used in population screening due to its low sensitivity and specificity and interference from multiple factors. Although colonoscopy is the standard method for diagnosing colorectal cancer, its high cost and invasiveness reduce patient acceptance and make it difficult to promote on a large scale. Therefore, it is urgent to develop an efficient and non-invasive screening method.
[0003] Studies have found that the occurrence and progression of colorectal cancer are closely related to abnormal CpG island methylation in gene promoter regions. Changes in CG site methylation not only provide potential value for discovering new therapeutic targets, but can also be used for prognosis assessment and efficacy judgment. By detecting the abnormal methylation status of colorectal cancer-specific gene regions, the pathological mechanism can be revealed at the molecular level, providing a reliable basis for early diagnosis and clinical intervention. Summary of the invention
[0004] The present invention provides a colorectal cancer methylation gene CpG site marker and its application, which is mainly achieved by the following technical means:
[0005] First, by analyzing the methylation profiles of colorectal cancer tissues in the TCGA and GEO databases, the CpG site cg16601494 in the promoter region of the TMEM240 gene was screened out, and its methylation status was preliminarily screened as a diagnostic marker for colorectal cancer. Based on digital PCR technology, the present invention designed specific probes and primers for detecting the methylation level of the cg16601494 site in the promoter region of TMEM240, and verified its reliability in distinguishing normal from cancerous tissues in colorectal cancer tissues and adjacent tissues. Based on these tissue results, a method based on TaqMan qPCR and digital PCR technology was further developed for detecting methylation of this site in human stool samples, and its diagnostic efficacy was verified in preoperative stool samples of normal examinees and colorectal cancer patients.
[0006] The first object of the present invention is to provide a CpG site associated with colorectal cancer, wherein the CpG site cg16601494 is located at nucleotides 1475737-1475738 of the antisense strand of chromosome 1 of the human reference genome Hg19. The sequence is ACCGACGCCCCCAGAATCATGAAGATCATGGTGTTCGCGCTCATGGACATCGGGCGGGGC[CG]GGCCGGGCCGGAGCGCCGCCCCCCGGCCCCCCGGCGCCCCCGGCCCCGGCCCGATG CTGA (SEQ ID NO.13).
[0007] The second object of the present invention is to provide a biomarker associated with colorectal cancer, comprising the aforementioned CpG site cg16601494 with different methylation levels.
[0008] The third object of the present invention is to provide a reagent for detecting the methylation level of the aforementioned CpG site cg16601494, the reagent comprising the primer and probe set for amplifying the colorectal cancer methylation marker shown in SEQ ID NO.1 to SEQ ID NO.6:
[0009]
[0010] Among them, the primers are cg16601494-TMEM240-F shown in SEQ ID NO.1, cg16601494-TMEM240-R shown in SEQ ID NO.2, Control-F shown in SEQ ID NO.4, and Control-R shown in SEQ ID NO.5; the probes are cg16601494-TMEM240-P shown in SEQ ID NO.3, and Control-P shown in SEQ ID NO.6.
[0011] Furthermore, the primer and probe set for amplifying the colorectal cancer methylation marker is based on digital PCR detection technology or Taqman qPCR detection technology.
[0012] Furthermore, based on Taqman qPCR detection technology, the reagent of cg16601494 further includes a capture probe set for enriching the colorectal cancer methylation markers as shown in SEQ ID NO.7 to SEQ ID NO.12:
[0013]
[0014]
[0015] In a specific embodiment, the probes shown in SEQ ID NO. 7 to SEQ ID NO. 12 are modified with biotin.
[0016] In the TaqMan qPCR detection method, the capture probe group shown in SEQ ID NO.7-12 is first used to enrich the target DNA, and based on this, the methylation detection of the CpG site of the colorectal cancer-related gene is performed. It contains enrichment probes suitable for enriching the cg16601494 site and surrounding DNA in the promoter region of the TMEM240 gene, and primers and probe combinations and detection systems for detecting DNA methylation levels. This detection method is suitable for detecting stool samples for auxiliary diagnosis and screening of colorectal cancer. The DNA capture probe shown in SEQ ID NO.7-12 is designed for the sequence of the cg16601494 site on TMEM240 and the internal reference gene fragment that is not affected by bisulfite conversion, and the probe shown in SEQ ID NO.7-12 is modified with biotin.
[0017] The fourth object of the present invention is to provide a reagent for detecting the methylation level of the aforementioned CpG site cg16601494 for use in the preparation of a colorectal cancer diagnostic kit. Preferably, the reagent is the reagent for detecting the methylation level of the aforementioned CpG site cg16601494.
[0018] Furthermore, the methylation level of CpG site cg16601494 in colorectal cancer patients was significantly higher than that in healthy people.
[0019] Furthermore, the methylation level of the CpG site cg16601494 is measured by determining the methylation level of CpG in the DNA of a biological sample, wherein the biological sample is selected from a human colorectal cancer tissue sample or a corresponding adjacent cancer tissue sample, feces, blood, or saliva sample, and the DNA is converted by bisulfite.
[0020] After bisulfite treatment, methylated cytosine remains as C base, while unmethylated cytosine is converted to U base, resulting in differences in methylated and unmethylated sequences, which can be distinguished using specific primers and probes and generate fluorescent signals in the PCR amplification system.
[0021] Furthermore, the application is based on digital PCR detection technology.
[0022] Digital PCR reaction system: 10 μL of 2× digital PCR reaction premix, add primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6, the final concentration of primers is 900 nM, the final concentration of probes is 250 nM, the concentration of template DNA 5-8 is 0.1 ng / μL-20 ng / μL, and add ultrapure water to 20 μL;
[0023] The digital PCR reaction conditions are as follows:
[0024]
[0025] Furthermore, the application is based on Taqman qPCR detection technology.
[0026] TaqMan qPCR reaction system: 10 μL of 2×TaqMan PCR reaction premix; add primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6 to make the final concentration of primers 900 nM and the final concentration of probes 250 nM; add 8 μL of template DNA with a concentration of 0.1 ng / μL-20 ng / μL, and add ddH2O to 20 μL.
[0027] TaqMan qPCR reaction conditions are as follows:
[0028]
[0029]
[0030] The innovation and beneficial effects of the present invention are as follows:
[0031] 1. We discovered and verified for the first time that methylation of CpG site cg16601494 in the promoter region of the TMEM240 gene is a specific marker for colorectal cancer, and established a human tissue methylation detection method based on digital PCR.
[0032] 2. This invention detects the methylation level of CpG site cg16601494 in the promoter region of TMEM240 gene in human stool samples for the first time. The detection method developed based on TaqMan PCR and digital PCR technology has high sensitivity and specificity, achieving the goal of early identification of colorectal cancer risk through non-invasive detection. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 .30 Methylation levels of cg16601494 site in colorectal cancer and adjacent adjacent tissues (based on digital PCR detection).
[0034] Figure 2Methylation levels of cg16601494 in feces of colorectal cancer patients and healthy controls (based on Taqman qPCR detection).
[0035] Figure 3 ROC curve analysis of fecal cg16601494 site methylation in distinguishing colorectal cancer patients from healthy people. DETAILED DESCRIPTION
[0036] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.
[0037] Example 1: Digital PCR detection of methylation levels of colorectal cancer-specific methylation site cg16601494 in tissues
[0038] The present invention uses digital PCR to specifically detect methylation related to colorectal cancer. By designing DNA methylation-specific primers and probes for the CpG site cg16601494 and the surrounding area on the promoter region of the TMEM240 gene, the DNA sample to be tested treated with bisulfite is dropletized and amplified. In the PCR reaction, the methylation level of the CpG site cg16601494 of the TMEM240 gene in the sample is determined by the ratio of the number of positive droplets to the total number of droplets to determine whether there is a risk of colorectal cancer.
[0039] 1. Primer and probe design
[0040] According to the sequence of the cg16601494 site in the promoter region of the TMEM240 gene, ddPCR primers and probes for detection were designed. The 5' end of the probe was labeled with a fluorescent reporter group, where the TMEM240-cg16601494 probe was labeled with FAM and the internal reference gene was labeled with VIC. The selection of the fluorescent reporter group was determined according to the fluorescence range of the digital PCR instrument, and the MGB group was used at the end of the probe to increase the annealing temperature. The primer and probe sequences are as follows:
[0041] name 5'-3'sequence SEQ ID NO.1 cg16601494-TMEM240-F TTATGGTGTTCGCGTTTATGGAT SEQ ID NO.2 cg16601494-TMEM240-R GCCGAAAACCGAAAAACGA SEQ ID NO.3 cg16601494-TMEM240-P FAM-GGGTCGGGTCGGGT+MGB SEQ ID NO.4 Control-F TGTATGTATGTGAGTGTGGGAGAGAGA SEQ ID NO.5 Control-R TTTCTTCCACCCCTTCTCTTCC SEQ ID NO.6 Control-P VIC-CTCCCCCTCTAACTCTAT+MGB
[0042] Droplet digital PCR technology was used in the experiment. The digital PCR mixture was added to the droplet generator to generate 10,000-20,000 micro-reaction droplets for PCR amplification. Each PCR experiment was set up with a positive control (M), a negative control (U), an RNase-free water control, and a blank control (NTC).
[0043] The positive quality control is fully methylated human genomic DNA treated with bisulfite, and the negative quality control is non-methylated genomic DNA. The threshold is set based on the quality control and blank control to determine whether the sample contains methylated cg16601494 sites and determine their quantity. Data analysis is completed using commercial software such as QuantDrop.
[0044] 2. DNA Sample Extraction and Processing
[0045] The DNA template required for the detection of the present invention can be extracted from the patient's colorectal cancer tissue and adjacent tissue. The specific steps are as follows: (1) DNA extraction
[0046] Thirty pairs of pathologically confirmed colorectal cancer tissue and adjacent tissue samples were collected and prepared using a commercially available DNA extraction and detection method, following the instructions for the detection method. DNA samples were eluted from the centrifuge column with 50 μL of elution buffer and the concentration was determined for subsequent sulfite conversion.
[0047] (2) DNA sulfite conversion
[0048] The extracted DNA was bisulfite-converted using a commercial conversion method, and the operation was performed according to the conversion method instructions. Finally, the DNA sample was eluted with 20 μL of elution buffer for digital PCR detection.
[0049] 3. Digital PCR detection system for methylation of cg16601494 site on human TMEM240:
[0050] (1) Preparation of digital PCR reaction system
[0051] Divide the sulfite-converted sample into three portions, add 10 μL of 2× digital PCR premix to each 20 μL reaction system, with a final primer concentration of 900 nM and a final probe concentration of 250 nM. Add 5-8 μL of DNA sample with a concentration of 0.1 ng / μL-20 ng / μL, and make up to 20 μL with ultrapure water.
[0052] (2) Droplet generation and PCR amplification
[0053] Add 20 μL of the reaction mixture to the droplet generation chip (DG-20), add 5 μL of sealant to the sample well, add 50 μL of droplet generation oil to the oil well, seal the chip with a rubber pad, and slowly transfer it to the droplet generator (MicroDrop-400A) to generate droplets in about 2 minutes. Transfer 55 μL of the prepared droplets to a 96-well plate, and store it in a 4°C refrigerator for no more than 4 hours after sealing for PCR. Set the reaction conditions as follows:
[0054]
[0055] (3) Fluorescence signal detection and result determination
[0056] After the PCR reaction is completed, the samples are placed in a biochip analyzer (MicroDrop-100B) for analysis. The number of positive and negative droplets of each sample is detected one by one. The number of positive and negative droplets at the cg16601494 site on TMEM240 in the sample is analyzed and calculated using QuantDrop software.
[0057] (4) Analysis of test results
[0058] ddPCR results showed that the methylation level of cg16601494 on TMEM240 was significantly higher in colorectal cancer tissues than in adjacent tissues (see Figure 1 ).
[0059] Example 2: TaqMan qPCR detection of DNA methylation level at cg16601494 site in human feces samples
[0060] The present invention uses TaqMan qPCR technology to detect DNA methylation at specific sites of colorectal cancer in human fecal samples. By designing specific primers and probes, the cg16601494 site in the TMEM240 gene and the nearby methylation region are targeted, and amplification is performed on a DNA sample treated with bisulfite and prepared by dropletization. The methylation level of the cg16601494 site of the TMEM240 gene in the sample to be tested is determined according to the CT value of PCR amplification, thereby determining whether the subject suffers from colorectal cancer.
[0061] Fecal samples from 42 patients with pathologically diagnosed colorectal cancer and 30 healthy volunteers were collected. The sample size was 5-10 g and stored at 4°C for a short term and -80°C for a long term. The samples were taken out from -80°C and thawed at 4°C before use.
[0062] 1. DNA capture probe design
[0063] A DNA capture probe was designed for the sequence of the cg16601494 site in the TMEM240 gene and an internal reference gene fragment that is not affected by sulfite conversion, and was biotin-labeled. The sequence of the capture probe is as follows:
[0064]
[0065] 2. DNA Extraction and Preparation of Human Fecal Samples
[0066] (1) DNA extraction from stool samples
[0067] 1). Add the stool sample to 15 ml of buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl, 0.1% Tween-20), vortex mix for 5 minutes, then centrifuge at 14,000 rpm for 10 minutes at room temperature, and collect 10 mL of supernatant.
[0068] 2). Incubate 3.5 ml of supernatant at 70°C for 5 minutes.
[0069] 3). After vortexing for 30 seconds, centrifuge at 12000 rpm for 1 minute, transfer about 3.2 ml of supernatant to a new 5 mL centrifuge tube, add 150 μL proteinase K (1 mg / μL), and incubate at 56°C for 10 minutes.
[0070] 4). Add capture probes shown in SEQ ID NO. 7-12, incubate at 95° C. for 10 minutes, and then slowly return to room temperature.
[0071] 5). Add 100 μL of streptavidin magnetic beads, place the centrifuge tube on a rotating mixer, and rotate and mix at room temperature for 30 minutes.
[0072] 6). Place the centrifuge tube in a magnetic rack, discard the supernatant after magnetic separation, wash the magnetic beads twice with a buffer containing 10mM Tris-HCl (pH7.5), 1mM EDTA, 2M NaCl, and 0.1% Tween-20, and then wash twice with 1 ml TE buffer. After magnetic separation, discard the supernatant and retain the magnetic beads.
[0073] 7). Add at least 30 μL of elution buffer (10 mM EDTA, pH 8.2 and 95% formamide) to the washed magnetic beads, vortex to mix, and incubate at 95°C for 10 minutes.
[0074] 8). After centrifugation at 12000 rpm for 1 minute, transfer the supernatant to a new centrifuge tube for subsequent sulfite conversion.
[0075] (2) DNA sulfite conversion
[0076] Use the common commercial detection method on the market to treat the extracted DNA sample with bisulfite according to the detection method operation manual. Elute the DNA to be tested with 20μL elution buffer for TaqMan qPCR detection.
[0077] 3. TaqMan qPCR detection system for methylation level of human TMEM240 gene cg16601494 site
[0078] (1) TaqMan qPCR reaction system
[0079] Divide the sulfite-converted sample into three parts, and configure the reaction system of three sites respectively. Take 10μL 2×TaqMan PCR premix in each 20μL TaqMan qPCR reaction system; make the final concentration of primers and probes 900nM and 250nM respectively, and add 8μL template DNA with a concentration of 0.1ng / μL-20ng / μL. Perform PCR reaction according to the set conditions. The reaction conditions of TaqMan qPCR are as follows:
[0080]
[0081]
[0082] (2) Test results and analysis
[0083] Analysis of TaqMan qPCR results showed that the methylation level of the cg16601494 site of the TMEM240 gene in stool samples of colorectal cancer patients was higher than that in healthy control samples (see Figure 2 By detecting the methylation level of this site, the AUC value for diagnosing colorectal cancer was 0.9183 (see Figure 3 ).
[0084] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A CpG site associated with colorectal cancer, characterized in that: The CpG site cg16601494 is located at nucleotides 1475737-1475738 of the antisense strand of chromosome 1 of the human reference genome Hg19.
2. A biomarker associated with colorectal cancer, characterized in that: The CpG site cg16601494 of claim 1 comprising different methylation levels.
3. A reagent for detecting the methylation level of the CpG site cg16601494 according to claim 1, characterized in that: The reagents include primers and probe sets for amplifying the colorectal cancer methylation markers shown in SEQ ID NO.1 to SEQ ID NO.6: The primers are cg16601494-TMEM240-F shown in SEQ ID NO.1, cg16601494-TMEM240-R shown in SEQ ID NO.2, Control-F shown in SEQ ID NO.4, and Control-R shown in SEQ ID NO.5; The probes are cg16601494-TMEM240-P shown in SEQ ID NO.3 and Control-P shown in SEQ ID NO.
6.
4. The reagent according to claim 3, characterized in that The primer and probe set for amplifying the colorectal cancer methylation marker is based on digital PCR detection technology or Taqman qPCR detection technology.
5. The reagent according to claim 4, characterized in that When based on Taqman qPCR detection technology, the reagent of cg16601494 further includes a capture probe set for enriching the colorectal cancer methylation markers shown in SEQ ID NO.7 to SEQ ID NO.12: Preferably, the probes shown in SEQ ID NO.7 to SEQ ID NO.12 are modified with biotin.
6. Use of a reagent for detecting the methylation level of the CpG site cg16601494 according to claim 1 in the preparation of a colorectal cancer diagnostic kit, preferably, the reagent is the reagent according to any one of claims 3 to claim 5.
7. The use according to claim 6, characterized in that: The methylation level of CpG site cg16601494 in tumor tissues of colorectal cancer patients was significantly higher than that in healthy people.
8. The use according to claim 6, characterized in that: The methylation level of the CpG site cg16601494 is measured by determining the methylation level of CpG in the DNA of a biological sample, wherein the biological sample is selected from a human colorectal cancer tissue sample or a corresponding adjacent cancer tissue sample, feces, blood, or saliva sample, and the DNA is converted by bisulfite.
9. The use according to claim 6, characterized in that: The application is based on digital PCR detection technology, and the digital PCR reaction system is: 2×10 μL of digital PCR reaction premix, add the primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6, the final concentration of the primers is 900 nM, the final concentration of the probe is 250 nM, add 5-8 μL of template DNA with a concentration of 0.1 ng / μL-20 ng / μL, and add ultrapure water to 20 uL; The digital PCR reaction conditions are as follows: 。 10. The use according to claim 6, characterized in that: The application is based on Taqman qPCR detection technology, TaqMan qPCR reaction system: 10 μL of 2×TaqMan PCR reaction premix; add primers and probes shown in SEQ ID NO.1 to SEQ ID NO.6 to make the final concentration of primers 900 nM and the final concentration of probes 250 nM, and make up to 2 uL; 8 μL of template DNA with a concentration of 0.1 ng / μL-20 ng / μL. TaqMan qPCR reaction conditions are as follows: